Skip to main content
NCBI home page
Oxidative Medicine and Cellular Longevity logoLink to Oxidative Medicine and Cellular Longevity
. 2021 Feb 15;2021:8841726. doi: 10.1155/2021/8841726

Antioxidant and Anti-Inflammatory Effects of Crocin Ameliorate Doxorubicin-Induced Nephrotoxicity in Rats

Mona A Hussain 1,✉, Noha M Abogresha 2, Ghada AbdelKader 3, Ranya Hassan 4, Eman Z Abdelaziz 5, Sahar M Greish 2,6
PMCID: PMC7899759  PMID: 33628387

Abstract

Doxorubicin is a drug that belongs to the anthracycline antibiotics. Nephrotoxicity is one of the serious side effects of doxorubicin treatment. Crocin, which is one of the most bioactive components of saffron, has antioxidant, anti-inflammatory, and antitumor effects. The current study was aimed at investigating the possible protective effects of crocin against doxorubicin-induced nephrotoxicity to elucidate the underlying mechanism of this effect. The study included four groups, six rats in each group: normal control, crocin control, doxorubicin, and crocin/doxorubicin. Doxorubicin and crocin/doxorubicin groups received intraperitoneal injections of doxorubicin (3.5 mg/kg twice weekly for 3 weeks). Rats in the crocin control group and the crocin/doxorubicin group were treated with intraperitoneal injections of crocin (100 mg/kg body weight per day) for 3 weeks. Biomarkers of kidney function and oxidative stress as well as the abundance of mRNA for nuclear factor-κβ and inducible nitric oxide synthase were evaluated. In addition, the abundance of cyclooxygenase 2 and tumor necrosis factor α immunoreactivity was evaluated. Crocin treatment had renoprotective effects manifested by significant improvement in kidney function as well as a reduction in the abundance of biomarkers of oxidative stress markers and inflammatory mediators. In conclusion, crocin has a protective effect against doxorubicin-induced nephrotoxicity in rats by serving as an antioxidant and attenuating the expression of NF-κB, iNOS, COX2, and TNFα.

1. Introduction

Doxorubicin is a member of the anthracycline family of cytotoxic antibiotics and one of the most potent and commonly used chemotherapeutic agents for the treatment of several types of cancer [1]. The antitumor activity of doxorubicin is attributed to its ability to intercalate into the DNA helix and/or bind covalently to proteins involved in DNA replication and transcription resulting in inhibition of DNA, RNA, and protein synthesis, leading ultimately to cell death [2]. Doxorubicin's cytotoxic effect on cells also involves inhibition of topoisomerase II activity to further impair transcription [3]. Oxidative damage to cell membranes, DNA, and proteins is another mechanism of action of doxorubicin [4]. Cardiotoxicity, neurotoxicity, hepatotoxicity, and nephrotoxicity are serious side effects of doxorubicin treatment. Doxorubicin causes almost irreversible kidney damage as the ability of the kidney to regenerate and heal is limited. This damage manifests as nephropathy, proteinuria, and glomerulosclerosis, and it has serious harmful effects on the entire body [3].

The detailed mechanisms of doxorubicin-induced renal damage remain unknown [5, 6]; however, several studies implicate oxidative stress [5, 7–9]. In addition, El-Moselhy and El-Sheikh suggest that oxidative stress induced by doxorubicin also stimulates the release of tumor necrosis factor α (TNFα), which would further activate multiple signaling pathways, including the nuclear factor κB (NF-κB) inflammatory pathway [10]. Consistent with this, several researchers demonstrated that doxorubicin increased NF-κB, TNFα, inducible nitric oxide synthase (iNOS), and cyclooxygenase 2 (COX2) in renal tissue [11, 12]. Hence, we are in need of an adjuvant therapy for doxorubicin chemotherapy that would have both the antioxidant and anti-inflammatory effects required to protect against the renal damage associated with doxorubicin treatment.

Crocin is one of the most bioactive components of saffron (Crocus sativus L.), a monocotyledon species of the Iridaceae family. Saffron is cultivated in many areas of the world including Egypt [13]. Crocin has different pharmacological properties, including antioxidant, anti-inflammatory, and antitumor effects [14, 15]. Crocin was previously reported to have a cardioprotective effect in doxorubicin-treated rats [16, 17]. In addition, crocin attenuates the negative hematological effects of doxorubicin treatment in rats [18].

Crocin treatment also reduced nephropathy in other pathological settings, including gentamicin-induced nephrotoxicity [19], diabetes [20], carbon tetrachloride nephropathy [21], and methotrexate nephropathy [22]. The reported anti-inflammatory properties of crocin included reducing the abundance of COX2 and TNFα mRNA as well as iNOS expression and nitric oxide production via downregulation of NF-κB activity [23]. To the best of our knowledge, the effect of crocin on doxorubicin-induced nephropathy has not been addressed before. Hence, the present study was undertaken to investigate (1) the possible protective effects of crocin on doxorubicin-induced nephrotoxicity and (2) the underlying mechanisms mediating this effect.

2. Materials and Methods

This work was performed at the Medical Physiology Department, Faculty of Medicine, Suez Canal University, Ismailia, Egypt.

2.1. Animals

Twenty-four adult male albino Sprague-Dawley rats, body weight 130-175 g, were purchased from the Egyptian Organization for Biological Products and Vaccines (Giza, Egypt). This study was performed in accordance with the Guide for the Care and Use of Laboratory Animals (1985), NIH, Bethesda, and was approved by the Ethics Committee of the Suez Canal University Faculty of Medicine. All rats were allowed to acclimatize for one week prior to the experiment and were housed in plastic cages maintained at controlled room temperature (22-24°C) with a 12-hour diurnal (day and night change) cycle and free access to tap water and a standard rat chow diet. Rats were randomly allocated to four groups: normal control, crocin control, doxorubicin, and crocin/doxorubicin groups.

2.2. Doxorubicin-Induced Nephrotoxicity and Crocin Treatment

Rats in the doxorubicin and crocin/doxorubicin groups received intraperitoneal injections of doxorubicin (3.5 mg/kg, doxorubicin-HCl, Pfizer, Egypt) twice weekly for 3 weeks [24]. Rats in the crocin control and crocin/doxorubicin groups received intraperitoneal injections of crocin (100 mg/kg, Sigma-Aldrich, Catalog #17304) daily [19] for 3 weeks.

2.3. Urine Collection and Blood Sampling

At the end of the study, 24-hour urine samples were collected to determine urine albumin and creatinine levels. Rats were then anesthetized with ether, and retrobulbar blood samples were collected and processed by centrifugation at 2000 × g for 15 min. Serum samples were separated, collected in clean tubes, and stored at -80°C until use. Anesthetized rats were sacrificed by decapitation, and laparotomy was done for kidney collection. Right kidneys were kept in 10% buffered formalin solution for subsequent processing for histopathological and immunohistochemical evaluation. Left kidneys were frozen and stored at -80°C prior to homogenization and subsequent assays.

2.4. Assay of Biochemical Markers of Kidney Function in Blood and Urine

Serum albumin, blood urea nitrogen (BUN), creatinine, and urine albumin and creatinine were determined using commercial kits on the Cobas c311 analyzer (Roche Diagnostics, Germany). The standard conventional formula (urinary creatinine concentration (U) (mg/ml) × urine volume (V) (ml/min)/serum creatinine concentration (P) (mg/ml)) was used for creatinine clearance calculation [25].

2.5. Assays of Oxidative Stress in Kidney Homogenate

Kidneys were homogenized in 10 volumes (w/v) of Tris buffer (10 mM Tris HCl, 1 mM EDTA, 0.32 M sucrose, pH 7.8) using a Teflon and glass homogenizer (Glas Col homogenizer system, Vernon Hills, USA). The homogenate was sonicated and then centrifuged at 20,000 × g for 10 min. Lipid peroxides (malondialdehyde, MDA) and superoxide dismutase (SOD) activity were assayed in renal tissue homogenate by the colorimetric method using specific kits supplied by Biodiagnostic, Egypt, according to the manufacturer's instructions.

2.6. Quantitative Real-Time Polymerase Chain Reaction (qPCR) for NF-κB and iNOS mRNA Expression in Kidney Tissues

Total RNA was isolated from left kidney frozen tissue using the Qiagen tissue extraction kit (Qiagen, USA) according to the manufacturer's instructions. Extracted RNA was quantified by spectrophotometry (dual wavelength Beckman, spectrophotometer, USA). The RNA integrity was assessed using agarose gel electrophoresis and ethidium bromide staining. The total RNA (0.5–2 μg) was used to prepare cDNA using a high fidelity reverse transcription kit (Fermentas, USA). Real-time qPCR amplification and analysis were performed using an Applied Biosystems instrument with StepOne™ software (version 3.1). Reaction mixtures contained SYBR Green Master Mix (Applied Biosystems), gene-specific forward and reverse primers (10 mM), and cDNA and nuclease-free water. The sequences of PCR primer pairs used for each gene are shown in Table 1. Cycling conditions were 10 min at 95°C followed by 40 cycles of 15 seconds at 95°C and 1 min at 60°C [26, 27].

Table 1.

Primer sequence used for qPCR.

Primer Sequence
NF-κB Forward CAGCTCTTCTCAAAGCAGCA
Reverse TCCAGGTCATAGAGAGGCTCA
iNOS Forward CTTTGCCACGGACGAGAC
Reverse TCATTGTACTCTGAGGGCTGAC
Open in a new tab

2.7. Histological and Morphometric Analysis of the Kidney

Right kidneys were dissected and immediately transferred to 10% buffered formalin solution for fixation. Kidneys were dehydrated using a series of solutions of increasing ethanol content and then embedded in paraffin. Sections of 4 μm thickness were cut, stained with hematoxylin and eosin (H&E), and examined with an Olympus light microscope. About 20 sections for the H&E stained kidney sections were selected for the measurement of glomerular, proximal, and distal tubular areas [28] using ImageJ. The glomerular area was assessed at ×100 magnification while proximal and distal tubular areas were assessed at ×400 magnification.

2.8. Immunohistochemical Evaluation of the Kidney

Kidney sections were cut, rehydrated, deparaffinized, and mounted for immunostaining. TNFα immunostaining was using a polyclonal rabbit anti-TNFα antibody diluted 1 : 400 (GeneTex, Cat# GTX110520). COX2 immunostaining used a polyclonal rabbit anti-COX2 antibody diluted 1 : 100 (GeneTex, Cat# GTX1100656). Twenty sections were evaluated for each group. The DAB-stained cytoplasmic option in the IHC profiler ImageJ plugin was used, as described by Varghese et al. [29]. Images were acquired using an Olympus microscope and camera interfaced with an IBM desktop computer. Images were acquired at ×10 glomerular areas and ×40 proximal and distal tubular areas.

2.9. Statistical Analysis

Parametric data were expressed as mean ± standard error of mean (SEM), and nonparametric data were presented as median and range (minimum-maximum). For comparisons of quantitative variables among the study groups, one-way ANOVA followed by the Bonferroni post hoc test was used if data were parametric, while the Kruskal-Wallis (KW) test was used if data were nonparametric. Statistical analysis was done by the Statistical Package for Social Sciences (SPSS) program version 20. Data were considered statistically significant with p ≤ 0.05.

3. Results

3.1. Effect of Doxorubicin and Crocin on Kidney Function Biochemical Markers

The assessment of biochemical markers of kidney function revealed significant deterioration of kidney function in the doxorubicin group. Specifically, there was a decrease in serum albumin concentration in the doxorubicin group in comparison with both the normal control group and the crocin control group (p = 0.008 and p = 0.015, respectively), an increase in serum creatinine concentration in the doxorubicin group in comparison with the normal control group (p = 0.034), an increase in urine albumin concentration in the doxorubicin group in comparison with the normal control group (p = 0.036), a decrease in urine creatinine concentration in the doxorubicin group in comparison with both the normal control group and the crocin control group (p = 0.021 and p = 0.038, respectively), an increase in urine albumin/creatinine ratio (ACR) in the doxorubicin group in comparison with the normal control, crocin control, and crocin/doxorubicin groups (p = 0.004, p = 0.007, and p = 0.0007, respectively), and a decrease in the creatinine clearance rate in the doxorubicin group in comparison with the normal control group (p = 0.034). The biomarkers of kidney function in the crocin+doxorubicin group did not differ significantly from those of the normal control group (Table 2 and Figure 1). Hence, administration of crocin with doxorubicin attenuated the ability of doxorubicin to impair kidney function.

Table 2.

Kidney function biochemical markers: BUN and serum albumin and creatinine concentration, urine albumin and creatinine concentration, and urine albumin creatinine ratio (ACR) (mean ± SEM) in the study groups.

BUN (mg/dl) Serum albumin (mg/dl) Serum creatinine (mg/dl) Urine albumin (mg/dl) Urine creatinine (mg/dl) ACR (mg/g)
Normal control group 14.5 ± 0.5 3.37 ± 0.13  0.22 ± 0.09 0.1 ± 0.02 28.18 ± 8.1 2.98 ± 0.49
Crocin control group 13.45 ± 1.45 3.23 ± 0.13 0.38 ± 0.08  0.40 ± 0.37 28.85 ± 5.91 18.23 ± 5.78
Doxorubicin group 18 ± 1.47 1.93 ± 0.22† 0.57 ± 0.03‡ 0.64 ± 0.14‡ 2.83 ± 1.28§ 926.85 ± 319.32
Crocin/doxorubicin group 19.27 ± 3.24 2.37 ± 0.35 0.46 ± 0.03 0.51 ± 0.23 13.46 ± 4.59 85.53 ± 14.24
Open in a new tab

†Significant decrease in serum albumin concentration in the doxorubicin group vs. the normal control group and the crocin control group (p = 0.008 and 0.015, respectively). ‡Significant increase in serum creatinine concentration in the doxorubicin group vs. the normal control group (p = 0.034) and significant increase in urine albumin concentration in the doxorubicin group vs. the normal control group (p = 0.036). §Significant decrease in urine creatinine concentration in the doxorubicin group vs. the normal control group and the crocin control group (p = 0.021 and 0.038, respectively). Significant increase in urine ACR in the doxorubicin group vs. the normal control, crocin control, and crocin/doxorubicin groups (p < 0.01 in all comparisons).

Figure 1.

Figure 1

Open in a new tab

Creatinine clearance rate (mean ± SEM) in the study groups. †Significant decrease in creatinine clearance rate in the doxorubicin group vs. the normal control group (p = 0.034).

3.2. Effect of Doxorubicin and Crocin on Renal Oxidative Stress

Analysis of biomarkers of oxidative stress showed that doxorubicin caused a significant increase in MDA, a marker of lipid peroxidation compared with the normal control group (p = 0.017). There was also a significant decrease in the antioxidant SOD in the doxorubicin group in comparison with the normal control group and the crocin control group (p = 0.018 and p = 0.024, respectively). The administration of crocin in combination with doxorubicin decreased in MDA (p = 0.026) and increased SOD (p = 0.012) in renal tissues relative to the doxorubicin group (Table 3).

Table 3.

Oxidative stress marker concentration (mean ± SEM) in the renal tissues in the study groups.

MDA (nmol/g tissue) SOD (μ/g tissue)
Normal control group 17.47 ± 3.93 3.48 ± 0.08
Crocin control group 33.36 ± 2.26 3.33 ± 0.08
Doxorubicin group 76 ± 21.13† 1.03 ± 0.68§
Crocin/doxorubicin group 22.59 ± 2.85‡ 3.5 ± 0.013
Open in a new tab

†Significant increase in MDA concentration in renal tissues in the doxorubicin group vs. the normal control group (p = 0.017). ‡Significant decrease in MDA concentration in renal tissues in the crocin/doxorubicin group vs. the doxorubicin group (p = 0.026). §Significant decrease in SOD concentration in renal tissues in the doxorubicin group vs. the normal control group, the crocin control group, and the crocin/doxorubicin group (p = 0.018, 0.024, and 0.012, respectively).

3.3. Effect of Doxorubicin and Crocin on NF-κB and iNOS mRNA Expression in Renal Tissues

To elucidate the possible mechanism underlying the findings described above, NF-κB and iNOS mRNA were quantified in renal tissue by qPCR. Doxorubicin increased the abundance of renal NF-κB mRNA compared with both the normal control group and the crocin group (p < 0.01 for both). Crocin administration with doxorubicin decreased the abundance of NF-κB mRNA relative to the doxorubicin group (p < 0.01) (Figure 2). The abundance of iNOS mRNA was also greater in the doxorubicin group when compared with the normal control group, crocin group, and crocin/doxorubicin group (p < 0.01 for all comparisons). However, although the administration of crocin plus doxorubicin decreased iNOS mRNA relative to doxorubicin alone, it remained elevated when compared with both the normal control group and the crocin group (p < 0.01 for both comparisons) (Figure 3).

Figure 2.

Figure 2

Open in a new tab

NF-κB mRNA expression (mean ± SEM) in renal tissues of the study groups. †Significant increase in renal NF-κB mRNA expression in the doxorubicin group vs. the normal control group, the crocin group, and the crocin/doxorubicin group (p < 0.01 in all comparisons).

Figure 3.

Figure 3

Open in a new tab

iNOS mRNA relative expression (mean ± SEM) in renal tissues of the study groups. †Significant increase in renal iNOS mRNA relative expression in the doxorubicin group vs. the normal control group and the crocin control group (p < 0.01 in both comparisons). §Significant decrease in renal iNOS mRNA relative expression in the crocin/doxorubicin group vs. the doxorubicin group (p < 0.01). ‡Significant increase in renal iNOS mRNA relative expression in the crocin/doxorubicin group vs. the normal control group and the crocin control group (p < 0.01 in both comparisons).

3.4. Histopathological and Morphometric Analysis of the Kidney

Histopathological evaluation of sections of the renal cortex in the normal control group and the crocin control group showed normal renal corpuscle and tubule morphology. In the doxorubicin group, renal sections revealed distorted stroma with multiple vacuoles, congested and dilated blood vessels, some of the renal corpuscles were edematous with obliterated Bowman's capsules, and other corpuscles were degenerated. Some renal tubules were dilated whereas others were compressed and obliterated. In the crocin/doxorubicin group, renal sections showed reduced pathological change and preservation of normal renal cortex architecture (Figure 4). Morphometric analysis revealed a greater glomerular area in the doxorubicin group relative to both the normal control group and the crocin/doxorubicin group (p = 0.048 and p = 0.035, respectively) (Figure 5). In addition, the proximal convoluted tubule area was reduced in the doxorubicin group in comparison with the normal control, crocin control, and crocin/doxorubicin groups (p < 0.01, p = 0.046, and p < 0.01, respectively) (Table 4).

Figure 4.

Figure 4

Open in a new tab

Histopathological results of the kidney in the study group. Section in the renal cortex of (a) the normal control group, (b) the crocin control group, (c) the doxorubicin group, and (d) the crocin/doxorubicin group. c: nephrogenic corpuscles; T: tubules; arrow: points to blood vessels; asterisk: points to degenerated nephrogenic corpuscles (H&E ×10).

Figure 5.

Figure 5

Open in a new tab

Glomerular area (μm2) (mean ± SEM) in the study groups. †Significant increase in glomerular area in the doxorubicin group vs. the normal control group and the crocin/doxorubicin group (p = 0.048 and 0.035, respectively).

Table 4.

Area of renal proximal convoluted tubules and distal convoluted tubules μm2 (median, minimum, and maximum) in the study groups.

Area of renal proximal convoluted tubules Area of renal distal convoluted tubules
Normal control group 6173.13 (3811.22-16503.69) 4433.99 (1102.16-11303.81)
Crocin control group 6857.18 (3870.87-12009.27) 5013.93 (3234.47-10969.46)
Doxorubicin group 3543.64 (1347.17-8035.63)∗ 3966.79 (1331.53-14499.75)
Crocin/doxorubicin group 7015.2 (2312.6-14123.54) 5575.57 (664-13746.85)
Open in a new tab

∗Significant decrease in the area of proximal convoluted tubules in the doxorubicin group vs. the normal control, crocin control, and crocin/doxorubicin groups (p < 0.01, p = 0.046, and p < 0.01, respectively).

3.5. TNFα and Cyclooxygenase 2 Immunohistochemistry in Renal Tissues

The abundance of TNFα and cyclooxygenase 2 immunoreactivity was assessed in renal tissue sections immunohistochemically. Immunostaining for TNFα was negative in both normal control and crocin control groups. In contrast, the doxorubicin group showed intense staining, which was markedly decreased in the crocin/doxorubicin group (Figure 6). Staining for COX2 revealed negligible levels in both normal control and crocin control groups, whereas the intensity of COX2 immunoreactivity was markedly increased in the doxorubicin group. Administration of crocin along with doxorubicin decreased the abundance of COX2 immunoreactive staining in comparison with that of sections from the crocin/doxorubicin group (Figure 7).

Figure 6.

Figure 6

Open in a new tab

Renal TNFα immunostaining with ImageJ IHC profiler analysis in the study groups. Analysis of renal slides of the different groups stained with TNFα immunostaining using the ImageJ IHC profiler revealed that control and crocin groups gave a low negative reaction to the TNFα immunostaining while doxorubicin presented a positive reaction in contrast to the crocin/doxorubicin group which presented a negative reaction.

Figure 7.

Figure 7

Open in a new tab

Renal COX2 immunostaining with ImageJ IHC profiler analysis in the study groups. Analysis of renal slides of the different groups stained with COX2 immunostaining using the ImageJ IHC profiler revealed that control and crocin groups gave a low positive reaction to the COX2 immunostaining while the doxorubicin group presented a positive reaction in contrast to the crocin/doxorubicin group which presented a negative reaction.

4. Discussion

Kidney injury is a global health problem associated with high morbidity, mortality, and healthcare costs. In addition, drug-induced nephrotoxicity is a major concern associated with the administration of chemotherapeutic agents. Anticancer therapy generally affects multiple organs, including the kidneys, leading to acute and chronic kidney diseases, renal dysfunction, and end-stage renal disease. Doxorubicin is an antitumor drug with a wide spectrum of activity in human cancers that, unfortunately, has serious side effects, including nephrotoxicity [30]. The current study investigated the protective effect of crocin treatment on doxorubicin-induced nephrotoxicity. Doxorubicin administration caused significant deterioration of kidney function and marked histopathological changes, as reported previously [24, 31], that were attenuated by coadministration of crocin.

In this study, the mechanisms underlying doxorubicin-induced nephrotoxicity were addressed by evaluating the renal markers of oxidative stress markers and the expression of NF-κB, iNOS, COX2, and TNFα. MDA, a biomarker of lipid peroxidation, was increased, and SOD was decreased, indicating that doxorubicin treatment induced an oxidant-antioxidant imbalance in renal tissue. This finding agrees with several previous studies [6, 11]. It has been suggested that the increase of reactive oxygen species leads to activation of NF-κB which, in turn, leads to the induction of key inflammatory mediators including iNOS, TNFα, and COX2. The increase in these proinflammatory mediators in turn leads to tissue injury and further activation of NF-κB. This positive feedback mechanism is believed to amplify inflammatory signals and exacerbate tissue injury [32].

To the best of our knowledge, the findings of the current study demonstrate for the first time that crocin has a protective effect against doxorubicin-induced nephrotoxicity in rats by preserving renal structure and function. Furthermore, our findings suggest that the renoprotective effects of crocin may be attributed to prevention of the doxorubicin-induced increase in NF-κB, iNOS, COX2, and TNFα expression resulting in a reduction in oxidative stress in the kidneys.

The observed antioxidant effect of crocin in renal tissues is consistent with the results of previous studies showing crocin inhibited the increase in lipid peroxidation induced by cisplatin in renal tissue [33]. Crocin supplementation has also been shown to ameliorate the renal oxidant/antioxidant imbalance induced by advancing age in rats [14]. Finally, by preserving the oxidant-antioxidant balance, crocin prevented methotrexate-induced renal damage [22].

All inflammatory disorders are associated with a release of reactive oxygen species with proinflammatory molecules [13]. And the anti-inflammatory effect of crocin is based on its antioxidant and free radical scavenging properties. Previous studies have reported that crocin treatment significantly reduced the abundance of mRNA for proinflammatory mediators interleukin-6 and TNFα in the kidneys of aged rats [14]. Crocin treatment has also been shown to slow the progression of diabetic nephropathy by modulating the oxidative burden and the inflammatory cascade [20]. Finally, crocin prevented the increase in intercellular adhesion molecule-1 and TNFα mRNA associated with ischemia-reperfusion induced renal injuries in rats [34].

It is known that NF-κB regulates the expression of iNOS, COX2, and proinflammatory cytokines at the transcriptional level [35]. Interestingly, we found that crocin downregulated the doxorubicin-induced increase in NF-κB mRNA, which in turn attenuated the increase in iNOS mRNA as well as COX2 and TNFα immunoreactivity in renal tissues. Consistent with these observations, crocin was shown to decrease the protein levels of the NF-κB p65 subunit in the hippocampus of lipopolysaccharide-treated mice [36] and reduce the expression of NF-κB and consequently inhibit the downstream inflammatory cascade manifested by decreasing the expression of COX2 and levels of TNFα and IL-1β in thioacetamide-induced liver fibrosis in mice [37].

Interestingly, despite the ability of crocin to prevent the doxorubicin-induced increase in NF-κB mRNA, the abundance of iNOS mRNA was significantly higher in the crocin/doxorubicin group than observed in the normal control group. However, it was previously reported that in most in vitro studies, only a combination of multiple cytokines was able to elicit a profound increase in iNOS mRNA, whereas a single stimulus exhibited only a moderate effect in specific cell types. These observations suggest that two or more signal transduction pathways are necessary to fully upregulate iNOS expression. One important intracellular signal transduction pathway is the activation of NF-κB. Alternative pathways include the Janus tyrosine kinase- (JAK-) signal transducers and activators of transcription (STAT). In addition, the mitogen-activated protein kinase (MAPK) pathway most likely contributes to iNOS gene expression [38]. Hence, we suggest that doxorubicin increased the abundance of iNOS mRNA through the activation of two or more signal transduction pathways: the NF-κB represents one of these pathways and is inhibited by crocin. Hence, the crocin-mediated inhibition of the ability of doxorubicin to increase NF-κB mRNA resulted in a partial decrease in doxorubicin-induced iNOS expression while the other doxorubicin-activated pathways also leading to iNOS upregulation were not targeted by crocin. A limitation of the current study is that the observed changes in the renal expression of NF-κB and iNOS have not yet been confirmed at the protein level.

In conclusion, the present study shows that, as an adjuvant therapy for doxorubicin chemotherapy, crocin has a renoprotective effect in that it attenuated doxorubicin-induced nephrotoxicity in rats by serving as an antioxidant and suppressing the doxorubicin-induced increase in NF-κB, iNOS, COX2, and TNFα. Further studies are required to evaluate other possible mechanisms mediating the renoprotective effects of crocin and to address the safety of using crocin/doxorubicin cotreatment in humans.

Acknowledgments

The authors are grateful to Bruce G. Allen, PhD-Professor, Department of Medicine, Montreal Heart Institute, University of Montreal, Montréal, Québec, Canada, for providing meticulous language editing for the manuscript.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Additional Points

Key Points. (1) Crocin has a renoprotective effect on doxorubicin-induced nephrotoxicity. (2) Crocin inhibits renal expression of NF-κB, iNOS, COX2, and TNFα in nephrotoxicity.

Conflicts of Interest

All authors declare no related conflicts of interest.

References

  • 1.Cagel M., Grotz E., Bernabeu E., Moretton M. A., Chiappetta D. A. Doxorubicin: nanotechnological overviews from bench to bedside. Drug Discovery Today. 2017;22(2):270–281. doi: 10.1016/j.drudis.2016.11.005. [DOI] [PubMed] [Google Scholar]
  • 2.Carvalho C., Santos R., Cardoso S., et al. Doxorubicin: the good, the bad and the ugly effect. Current Medicinal Chemistry. 2009;16(25):3267–3285. doi: 10.2174/092986709788803312. [DOI] [PubMed] [Google Scholar]
  • 3.Armstrong J., Dass C. R. Doxorubicin action on mitochondria: relevance to osteosarcoma therapy? Current Drug Targets. 2018;19(5):432–438. doi: 10.2174/1389450116666150416115852. [DOI] [PubMed] [Google Scholar]
  • 4.Shafei A., El-Bakly W., Sobhy A., et al. A review on the efficacy and toxicity of different doxorubicin nanoparticles for targeted therapy in metastatic breast cancer. Biomedicine and Pharmacotherapy. 2017;95:1209–1218. doi: 10.1016/j.biopha.2017.09.059. [DOI] [PubMed] [Google Scholar]
  • 5.Sindhu E. R., Nithya T. R., Binitha P. P., Kuttan R. Amelioration of doxorubicin-induced cardiac and renal toxicity by oxycarotenoid lutein and its mechanism of action. Journal of Environmental Pathology, Toxicology and Oncology. 2016;35(3):237–247. doi: 10.1615/JEnvironPatholToxicolOncol.2016014010. [DOI] [PubMed] [Google Scholar]
  • 6.Bilgic S., Armagan I. Effects of misoprostol treatment on doxorubicin induced renal injury in rats. Biotechnic and Histochemistry. 2020;95(2):113–120. doi: 10.1080/10520295.2019.1645356. [DOI] [PubMed] [Google Scholar]
  • 7.Ajith T. A., Aswathy M. S., Hema U. Protective effect of Zingiber officinale roscoe against anticancer drug doxorubicin-induced acute nephrotoxicity. Food and Chemical Toxicology. 2008;46(9):3178–3181. doi: 10.1016/j.fct.2008.07.004. [DOI] [PubMed] [Google Scholar]
  • 8.Kim D. R., Lee S. Y., Kim J. S., et al. Ameliorating Effect of Gemigliptin on Renal Injury in Murine Adriamycin- Induced Nephropathy. BioMed Research International. 2017;2017:10. doi: 10.1155/2017/7275109.7275109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Liu X., Cao W., Qi J., et al. Leonurine ameliorates adriamycin-induced podocyte injury via suppression of oxidative stress. Free Radical Research. 2018;52(9):952–960. doi: 10.1080/10715762.2018.1500021. [DOI] [PubMed] [Google Scholar]
  • 10.El-Moselhy M. A., El-Sheikh A. A. K. Protective mechanisms of atorvastatin against doxorubicin-induced hepato-renal toxicity. Biomedicine and Pharmacotherapy. 2014;68(1):101–110. doi: 10.1016/j.biopha.2013.09.001. [DOI] [PubMed] [Google Scholar]
  • 11.Zhang Y., Xu Y., Qi Y., et al. Protective effects of dioscin against doxorubicin-induced nephrotoxicity via adjusting FXR-mediated oxidative stress and inflammation. Toxicology. 2017;378:53–64. doi: 10.1016/j.tox.2017.01.007. [DOI] [PubMed] [Google Scholar]
  • 12.Benzer F., Kandemir F. M., Kucukler S., Comaklı S., Caglayan C. Chemoprotective effects of curcumin on doxorubicin-induced nephrotoxicity in Wistar rats: by modulating inflammatory cytokines, apoptosis, oxidative stress and oxidative DNA damage. Archives of Physiology and Biochemistry. 2018;124(5):448–457. doi: 10.1080/13813455.2017.1422766. [DOI] [PubMed] [Google Scholar]
  • 13.Korani S., Korani M., Sathyapalan T., Sahebkar A. Therapeutic effects of crocin in autoimmune diseases: a review. BioFactors. 2019;45(6):835–843. doi: 10.1002/biof.1557. [DOI] [PubMed] [Google Scholar]
  • 14.Samarghandian S., Azimi-Nezhad M., Borji A., Farkhondeh T. Effect of crocin on aged rat kidney through inhibition of oxidative stress and proinflammatory state. Phytotherapy Research. 2016;30(8):1345–1353. doi: 10.1002/ptr.5638. [DOI] [PubMed] [Google Scholar]
  • 15.Rahim V. B., Khammar M. T., Rakhshandeh H., Samzadeh-Kermani A., Hosseini A., Askari V. R. Crocin protects cardiomyocytes against LPS-induced inflammation. Pharmacological Reports. 2019;71(6):1228–1234. doi: 10.1016/j.pharep.2019.07.007. [DOI] [PubMed] [Google Scholar]
  • 16.Elsherbiny N. M., Salama M. F., Said E., El-Sherbiny M., Al-Gayyar M. M. H. Crocin protects against doxorubicin-induced myocardial toxicity in rats through down-regulation of inflammatory and apoptic pathways. Chemico-Biological Interactions. 2016;247:39–48. doi: 10.1016/j.cbi.2016.01.014. [DOI] [PubMed] [Google Scholar]
  • 17.Chu X., Zhang Y., Xue Y., et al. Crocin protects against cardiotoxicity induced by doxorubicin through TLR-2/NF-κB signal pathway in vivo and vitro. International Immunopharmacology. 2020;84, article 106548 doi: 10.1016/j.intimp.2020.106548. [DOI] [PubMed] [Google Scholar]
  • 18.Khanmohammadi R., Azerbaijani M. A., Khorsandi L. S., Peeri M. Effect of high-intensity interval training and crocin on hematological parameters in doxorubicin-induced male rats. Iranian Journal of Pediatric Hematology and Oncology. 2018;8(4):202–212. [Google Scholar]
  • 19.Mohamadi Yarijani Z., Najafi H., Madani S. H. Protective effect of crocin on gentamicin-induced nephrotoxicity in rats. Iranian Journal of Basic Medical Sciences. 2016;19(3):337–343. [PMC free article] [PubMed] [Google Scholar]
  • 20.Abou-Hany H. O., Atef H., Said E., Elkashef H. A., Salem H. A. Crocin mediated amelioration of oxidative burden and inflammatory cascade suppresses diabetic nephropathy progression in diabetic rats. Chemico-Biological Interactions. 2018;284:90–100. doi: 10.1016/j.cbi.2018.02.001. [DOI] [PubMed] [Google Scholar]
  • 21.Erdemli M. E., Gul M., Altinoz E., Aksungur Z., Gul S., Bag H. G. Can crocin play a preventive role in Wistar rats with carbon tetrachloride-induced nephrotoxicity? Iranian Journal of Basic Medical Sciences. 2018;21(4):382–387. doi: 10.22038/ijbms.2018.26101.6412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jalili C., Ghanbari A., Roshankhah S., Salahshoor M. R. Toxic effects of methotrexate on rat kidney recovered by crocin as a consequence of antioxidant activity and lipid peroxidation prevention. Iranian Biomedical Journal. 2020;24(1):39–46. doi: 10.29252/ibj.24.1.39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Veisi A., Akbari G., Mard S. A., Badfar G., Zarezade V., Mirshekar M. A. Role of crocin in several cancer cell lines: an updated review. Iranian Journal of Basic Medical Sciences. 2020;23(1):3–12. doi: 10.22038/IJBMS.2019.37821.8995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Elsherbiny N. M., El-Sherbiny M. Thymoquinone attenuates doxorubicin-induced nephrotoxicity in rats: role of Nrf2 and NOX4. Chemico-Biological Interactions. 2014;223:102–108. doi: 10.1016/j.cbi.2014.09.015. [DOI] [PubMed] [Google Scholar]
  • 25.Galal H. M., Abd El-Rady N. M. Aqueous garlic extract supresses experimental gentamicin induced renal pathophysiology mediated by oxidative stress, inflammation and Kim-1. Pathophysiology. 2019;26(3–4):271–279. doi: 10.1016/j.pathophys.2019.07.002. [DOI] [PubMed] [Google Scholar]
  • 26.Forman K., Vara E., García C., Ariznavarreta C., Escames G., Tresguerres J. A. F. Cardiological aging in SAM model : effect of chronic treatment with growth hormone. Biogerontology. 2010;11(3):275–286. doi: 10.1007/s10522-009-9245-z. [DOI] [PubMed] [Google Scholar]
  • 27.Amin S. N., Hassan S. S., Rashed L. A. Effects of chronic aspartame consumption on MPTP-induced parkinsonism in male and female mice. Archives of Physiology and Biochemistry. 2018;124(4):292–299. doi: 10.1080/13813455.2017.1396348. [DOI] [PubMed] [Google Scholar]
  • 28.Rangan G. K., Tesch G. H. Quantification of renal pathology by image analysis (methods in renal research) Nephrology. 2007;12(6):553–558. doi: 10.1111/j.1440-1797.2007.00855.x. [DOI] [PubMed] [Google Scholar]
  • 29.Varghese F., Bukhari A. B., Malhotra R., De A. IHC profiler: an open source plugin for the quantitative evaluation and automated scoring of immunohistochemistry images of human tissue samples. PloS One. 2014;9(5, article e96801) doi: 10.1371/journal.pone.0096801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Sabapathy V., Cheru N. T., Corey R., Mohammad S., Sharma R. A novel hybrid cytokine IL233 mediates regeneration following doxorubicin-induced nephrotoxic injury. Scientific Reports. 2019;9(1):p. 3215. doi: 10.1038/s41598-019-39886-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Khames A., Khalaf M. M., Gad A. M., Abd El-raouf O. M., Kandeil M. A. Nicorandil combats doxorubicin-induced nephrotoxicity via amendment of TLR4/P38 MAPK/NFκ-B signaling pathway. Chemico-Biological Interactions. 2019;311, article 108777 doi: 10.1016/j.cbi.2019.108777. [DOI] [PubMed] [Google Scholar]
  • 32.Natarajan K., Abraham P., Kota R., Isaac B. NF-κB-iNOS-COX2-TNF α inflammatory signaling pathway plays an important role in methotrexate induced small intestinal injury in rats. Food and Chemical Toxicology. 2018;118:766–783. doi: 10.1016/j.fct.2018.06.040. [DOI] [PubMed] [Google Scholar]
  • 33.Naghizadeh B., Mansouri S. M. T., Mashhadian N. V. Crocin attenuates cisplatin-induced renal oxidative stress in rats. Food and Chemical Toxicology. 2010;48(10):2650–2655. doi: 10.1016/j.fct.2010.06.035. [DOI] [PubMed] [Google Scholar]
  • 34.Mohamadi Yarijani Z., Pourmotabbed A., Pourmotabbed T., Najafi H. Crocin has anti-inflammatory and protective effects in ischemia-reperfusion induced renal injuries. Iranian Journal of Basic Medical Sciences. 2017;20(7):753–759. doi: 10.22038/ijbms.2017.9005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Periyasami G., Antonisamy P., Perumal K., Stalin A., Rahaman M., Alothman A. A. A competent synthesis and efficient anti-inflammatory responses of isatinimino acridinedione moiety via suppression of in vivo NF- κB, COX-2 and iNOS signaling. Bioorganic Chemistry. 2019;90, article 103047 doi: 10.1016/j.bioorg.2019.103047. [DOI] [PubMed] [Google Scholar]
  • 36.Zhang L., Previn R., Lu L., Liao R. F., Jin Y., Wang R. K. Crocin, a natural product attenuates lipopolysaccharide-induced anxiety and depressive-like behaviors through suppressing NF-kB and NLRP3 signaling pathway. Brain Research Bulletin. 2018;142:352–359. doi: 10.1016/j.brainresbull.2018.08.021. [DOI] [PubMed] [Google Scholar]
  • 37.Algandaby M. M. Antifibrotic effects of crocin on thioacetamide-induced liver fibrosis in mice. Saudi Journal of Biological Sciences. 2018;25(4):747–754. doi: 10.1016/j.sjbs.2016.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lechner M., Lirk P., Rieder J. Inducible nitric oxide synthase (iNOS) in tumor biology: the two sides of the same coin. Seminars in Cancer Biology. 2005;15(4):277–289. doi: 10.1016/j.semcancer.2005.04.004. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.

Articles from Oxidative Medicine and Cellular Longevity are provided here courtesy of Wiley

RESOURCES