Skip to main content
Frontiers in Oncology logoLink to Frontiers in Oncology
. 2021 Feb 9;10:588360. doi: 10.3389/fonc.2020.588360

RETRACTED: Long Non-Coding RNA ELFN1-AS1 Promoted Colon Cancer Cell Growth and Migration via the miR-191-5p/Special AT-Rich Sequence-Binding Protein 1 Axis

Yongjun Du 1,, Yanmei Hou 1,, Yongbo Shi 2,, Juan Liu 3, Tingxin Li 4,*
PMCID: PMC7900510  PMID: 33634016

Abstract

Long non-coding RNAs (lncRNAs) are reported to participate in tumor development. It has been manifested in previous researches that lncRNA ELFN1-AS1 is involved in early-stage colon adenocarcinoma with potential diagnostic value. However, no studies have revealed the specific mechanism of ELFN1-AS1 in colon cancer, and there are no other studies on whether ELFN1-AS1 is associated with tumorigenesis. In our study, ELFN1-AS1 with high expression in colon cancer was selected by TCGA analysis, and the survival analysis was carried out to verify it. Subsequently, qRT-PCR was adopted for validating the results in tissues and cell lines. Cell counting kit-8 (CCK8), 5-ethynyl-2’-deoxyuridine (EdU), cell colon, cell apoptosis, cell cycle, cell migration, and invasion assays were utilized to assess the role of ELFN1-AS1 in colon cancer. Results uncovered that ELFN1-AS1 expression was prominently raised in colon cancer cells and tissues. ELFN1-AS1 decrement restrained cells to grow through interfering with distribution of cell cycle and promoting apoptosis. Meanwhile, ELFN1-AS1 decrement weakened the capacity of cells to migrate and invade. What’s more, ELFN1-AS1 was uncovered to act as a competing endogenous RNA (ceRNA) to decrease miR-191-5p expression, thus raising special AT-rich sequence-binding protein 1 (SATB1), a downstream target of ceRNA. To sum up, ELFN1-AS1 drives colon cancer cells to proliferate and invade through adjusting the miR-191-5p/SATB1 axis. The above results disclose that lncRNA ELFN1-AS1 is possibly a novel treatment target for colon cancer cases.

Keywords: long non-coding RNA ELFN1-AS1, special AT-rich sequence-binding protein 1, colon cancer, ceRNA, miR-191-5p

Introduction

The American Cancer Society statistics manifest that colon cancer has a incidence rate of 10.2% and a death rate of 9.2% in human, ascending from the fourth place to the second (1, 2). Colon cancer cases at the early stage are generally treated by tumor resection, and the combined therapy with chemotherapeutic drugs is usually applied in colon cancer cases at different stages, especially at the late stage (3). These drugs include cytotoxic drugs (oxaliplatin, 5-fluorouracil, capecitabine and irinotecan) and biological agents (panitumumab, bevacizumab and cetuximab) (4, 5). In the beginning, the combined chemotherapy is useful in most colon cancer cases, but owing to drug resistance, the disease recurs in approximately 50% of the cases, with over 10% reduction in the five-year survival rate of late-stage cases (6, 7). Besides, liver metastasis arises at the time of first diagnosis in about 25% of colon cancer cases, and occurs within three years after first surgery in about 50% of them (8). Thus, investigation of the molecular mechanism of metastasis meets the clinical needs.

Long non-coding RNAs (lncRNAs) exert vital impacts in diversely adjusting gene expression, including chromatin modification as well as transcriptional and posttranscriptional processing (9). Aberrant modulation of lncRNAs usually induces tumor to form, grow and metastasize (10). For example, lncRNA DLEU2 adjusts non-small cell lung cancer cells to proliferate and invade by controlling the miR-30c-5p/SOX9 axis (11). In addition, the elevated lncRNA PANDAR indicates poor prognosis and boosts cervical cancer cells to proliferate (12). LncRNA ELFN1-AS1 promotes esophageal cancer progression by up-regulating GFPT1 via sponging miR-183-3p (13). Meanwhile, ELFN1-AS1 accelerates cell proliferation, invasion and migration via regulating miR-497-3p/CLDN4 axis in ovarian cancer (14). What more, previous study has revealed that ELFN1-AS1 is involved in early-stage colon adenocarcinoma with potential diagnostic value (15). However, no studies have revealed the specific mechanism by which ELFN1-AS1 plays a role in colon cancer, and researches on whether ELFN1-AS1 is linked to tumorigenesis are deficient.

MicroRNAs (miRNAs) are small ncRNAs that bind to the three prime untranslated region (3’-UTR) of downstream mRNAs and give rise to mRNA degradation or translation inhibition (16). The aberrant modulation of miRNAs commonly boosts cancers to form and develop (17). For example, the elevated miRNA-146a represses biological behaviors of ESCC by IRS2 suppression (18). Besides, miR-146b-5p promotes papillary thyroid carcinoma cells to migrate and invade (19). It has been identified that miR-191-5p restrains tumor in renal cell carcinoma (20) and colon adenocarcinoma (21), but whether miR-191-5p is co-regulated with ELFN1-AS1 to regulate colon cancer is unknown.

In this research, lncRNA ELFN1-AS1 expression level was identified to rise in colon cancer cells and tissues. The rising ELFN1-AS1 facilitated colon cancer cells to grow, migrate and invade. What’s more, ELFN1-AS1 sponged miR-191-5p and played a biological role.

Materials and Methods

Collection of Colon Cancer Samples and Culture of Colon Cancer Cells

Twenty pairs of colon cancer samples were collected from Huai’an Second People’s Hospital and The Affiliated Huai’an Hospital of Xuzhou Medical University. All patients gave the written informed consent, and all assay regimens gained the approval of the Clinical Research Ethics Committees of Huai’an Second People’s Hospital and The Affiliated Huai’an Hospital of Xuzhou Medical University.

The normal colonic epithelial cell line NCM460 and colon cancer cell lines (SW620, HT-29, HCT 116, LoVo, and SW480) were purchased from Cell Bank of Typical Culture Preservation Commission, Chinese academy of Sciences. Then they were cultured in a humid environment with 5% CO2 at 37°C in RPMI-1640 containing 10% fetal bovine serum.

Real-Time PCR Assay, Transfection of Cells as Well as Production and Transduction of Lentiviruses

TRIzol reagent (Invitrogen) was utilized for total RNA extraction from colon cancer cells as per the guideline of the manufacturer. After that, the extracted RNA was subjected to reverse transcription into cDNA using the Reverse Transcription Kit from Takara. Table 1 displays the applied primers.

Table 1.

Primers used in the study.

Forward Reverse
ELFN1-AS1 5′- AAAAGTTGACGCCGCATTCT -3′ 5′- GAGAATGGATTGTGGGTGCC-3′
miR-191-5p 5′-ACACTCCAGCTGGGCGACGAAAACCCUAA- 3′ 5′- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTTCCGTTG -3′
U6 5′-CTCGCTTCGGCAGCACA-3′ 5′-AACGCTTCACGAATTTGCGT-3′
SATB1 5′- GATCATTTGAACGAGGCAACTCA-3′ 5′- TGGACCCTTCGGATCACTCA-3′
GAPDH 5′- TCGGAGTCAACGGATTTGGTCGT-3′ 5′- TGCCATGGGTGGAATCATATTGGA-3

MiR-191-5p, anti-miR-191-5p, miR-NC, and anti-miR-NC that were applied for cell transfection were synthesized by Ruibo (Guangzhou, China), and the plasmid pcDNA-3.1-special AT-rich sequence-binding protein 1 (SATB1) was provided by Santa Cruz. As per the guideline of the manufacturer, transfection with oligonucleotides was executed with the use of lipofectamine 2000 reagent from Invitrogen.

The aforementioned shRNAs sequences aiming for ELFN1-AS1 underwent cloning into the pLKO.1 vector from Addgene as per the guideline of the manufacturer. Lentiviruses aiming for ELFN1-AS1 (sh-ELFN1-AS1) and the empty lentiviral vector (sh-NC) were employed to co-infect cells together with 8μg/mL Polybrene for subsequent assays.

Cell Counting Kit-8 Assay and 5-ethynyl-2′-deoxyuridine Assay

In a 96-well plate, the cells treated in advance were inoculated and then incubated with CCK8 reagent provided by DingGuo Bio for 2 h at 37°C. Finally, a microplate reader provided by BioTek was employed to detect the absorbance (450 nm).

Next, EdU assay was executed with the use of Cell-Light EdU Cell Proliferation/DNA Kit acquired from Guangzhou RiboBio Co., Ltd. (China). In detail, the cells were immobilized with 4% paraformaldehyde and dyed with Apollo Dye Solution subsequent to EdU incubation for 2 h, followed by mounting with Hoechst 33342. Ultimately, photographing and quantification were carried out for EdU-positive cells.

Transwell Assay, Cell Cycle, and Apoptosis Assay

Cells were inoculated into the Transwell chambers undergoing 30 min of Matrigel coating at 37°C on the upper side, while 500 μl of complete medium into the bottom side. After 48 h, the cells on the bottom side were rinsed with PBS, immobilized in 4% paraformaldehyde and dyed with crystal violet solution. Ultimately, photos were taken under a microscope. Analysis for cells in each group was conducted thrice.

Next, the cells were trypsinized for separation, rinsed twice with forecooling PBS, and immobilized in 70% ethanol at -20°C nightlong. Following suspension in 100 μg/ml of RNaseA and 50 μg/ml of propidium iodide (PI) both provided by KeyGen BioTECH, the immobilized cells were suspended and incubated at room temperature for 40 min. Eventually, the cells were filtered, and flow cytometry was executed to detect the cell cycle.

For apoptosis assay, the cells were washed with PBS and then stained using the Annexin V-FITC Apoptosis Detection Kit (Affymetrix eBioscience) according to the instructions. Ultimately, the cells were analyzed with a FACS flow cytometer (BD Biosciences).

Western Blot Detection

RIPA lysis buffer provided by Thermo Scientific was utilized for protein separation from cells, and the protein concentration was measured using BCA Protein assay kit from Beyotime. Later, electrophoresis was carried out for proteins separation, and the separated proteins were transferred onto a PVDF membrane and blocked by skim milk (5%). Afterwards, SATB1 (Lot No. ab92307) and GAPDH (Lot No. ab9484) primary antibodies from Abcam were applied for membrane incubation nightlong at 4°C, and secondary antibodies conjugated with horseradish peroxidase were utilized for sealing the membrane at room temperature for 1 h. Ultimately, BioSpectrum 600 Imaging System from UVP (CA, USA) was adopted to obtain images. The selected concentration in this research was 1: 500.

RNA-Binding Protein Immunoprecipitation Experiment

In RIP experiment, the EZ-Magna RIP Kit used in the RIP assay was commercially acquired from Millipore (Billerica, MA, USA). After miR-191-5p or miR-NC transfection into cells, Ago2-RIP assays were executed. In the first place, the cells underwent lysis by RIP lysis buffer with RNase and proteinase inhibitors provided by Millipore. Secondly, the RIP lysates were subjected to RIP buffer, which contained magnetic beads conjugated with human anti-Ago2 antibody or nonspecific mouse IgG antibody (Millipore). Next, the immunoprecipitates were digested using proteinase K, and the gathering of ELFN1-AS1 was examined using RT-PCR and gel staining. Ultimately, the RNA concentration was detected via a NanoDrop spectrophotometer, and q-RT-PCR analysis was conducted for the purified RNA.

Dual Luciferase Reporter Assay

Following amplification of the 3’-UTRs of SATB1 and ELFN1-AS1, they were independently cloned into the firefly luciferase gene downstream in the pGL3 vector from Promega, which was named as wild-type (WT) 3’-UTR. According to the detection using QuickChange site-directed mutagenesis kit from Stratagene (Cedar Creek, USA), there were mutant miR-191-5p binding sites in SATB1 3’-UTR, which was called MUT 3’-UTR. Colon cancer cells were transfected together with WT-3’-UTR or MUT-3’-UTR and miR-NC or miR-191-5p. Subsequent to 48 h of transfection, dual luciferase reporter assay system provided by Promega was employed for the luciferase assay. Analysis in each group was executed thrice.

Subcellular Distribution

The Cytoplasmic and Nuclear RNA Purification Kit (Norgen Biotek Corp.) was used to examine RNA degradation in the cytoplasm or nucleus. SW620 and HT-29 cells were lysed on ice for 5 min and then centrifuged at 12,000xg for 3 min. The supernatant was collected to examine RNAs originating in the cytoplasm, and the nuclear pellet was employed to extract RNAs from the nuclei. Total RNA in each fraction was quantified using RT-qRCR with U6 and GAPDH as internal references for the nucleus and cytoplasm, respectively.

Immunofluorescence Staining

After immobilization and sealing, tissues were incubated in antibody of SATB1 (Invitrogen, Carlsbad, California, USA) at 4°C for 24 h. After being washed, cells were incubated in FITC-labeled IgG (H+L) (Beyotime, Nantong, China) for 60 min. Later, DAPI was used for nucleus staining. The protocol was described in detail in the previous study (22).

Tumor Formation in the Body

BALB/c-nu/nu mice at the age of five weeks received subcutaneous seeding of 2×106 SW620 cells (sh-ELFN1-AS1 or sh-NC) in the flank. Tumor volumes were determined every 7 days and calculated as (length x width2)/2. Twenty-eight days after subcutaneous injection, tumors were obtained and weighed following the execution of the mice. As per the US National Institute of Health Guidelines for Use of Experimental Animals, the mice were maintained and received experiments in SPF Animal Laboratory at Xuzhou Medical University that were approved by the Ethnic Committee for Experimental Animals in Huai’an Second People’s Hospital and The Affiliated Huai’an Hospital of Xuzhou Medical University.

Statistical Analysis

GraphPad Prism 6.0 software (GraphPad Software, Inc.) was used for statistical analyses. Experimental results are expressed as the mean ± standard deviation (SD). The statistically significant differences between tumor tissues and adjacent normal tissues were determined using paired Student’s t-test. The statistically significant differences between other two groups were determined using Mann-Whitney U-test or unpaired Student’s t-test, where appropriate. The comparisons among different groups (multigroup comparisons) were analyzed by one-way ANOVA followed by the post hoc Bonferroni test. Log-rank test and Kaplan-Meier method were used to assess survival rates. P <0.05 suggested a statistically significant difference.

Results

LncRNA ELFN1-AS1 Expression Level was Raised in Colon Cancer Cells and Tissues

Based on TCGA database analysis, ELFN1-AS1 with a high expression in colon cancer was selected as a research object ( Figure 1A ). RT-PCR was executed to inquire ELFN1-AS1 expression level in the pairs of primary colon cancer tissues and non-tumor tissues. Results unraveled that colon cancer tissues expressed ELFN1-AS1 at a markedly higher level than non-tumor colon tissues ( Figure 1B ). Similarly, colon cancer cells also expressed ELFN1-AS1 at a notably higher level than NCM460 ( Figure 1C ). What’s more, TCGA database analysis disclosed that raised ELFN1-AS1 expression was related to short overall survival of colon cancer patients ( Figure 1D ).

Figure 1.

Figure 1

LncRNA ELFN1-AS1 expression level is raised in colon cancer tissues and cell lines. (A) TCGA data analysis is carried out to select ELFN1-AS1 with high expression in colon cancer. (B) ELFN1-AS1 expression prominently rises in the primary colon cancer tissues. (C) ELFN1-AS1 expression is higher in colon cancer cells than in normal colonic epithelial cell line. (D) TCGA data analysis results showed that high ELFN1-AS1 expression level is related to a shorter overall survival. Data are shown as the means ± SEM of three experiments. *P < 0.05, **P < 0.01, ***P < 0.001.

Long Non-Coding RNA ELFN1-AS1 Decrement Restrained Colon Cancer In Vitro

SW620 and HT-29 cells with the highest ELFN1-AS1 expression level were established firstly, and their ELFN1-AS1 was pulled down ( Figure 2A ). As the transfection efficiency of sh-ELFN1-AS1-1 is best, sh-ELFN1-AS1-1 was selected as sh-ELFN1-AS1 for further studies. CCK-8 assay, EdU, cell colony-forming experiment disclosed that ELFN1-AS1 decrement prominently curbed cells to proliferate ( Figures 2B–D ). Moreover, flow cytometry uncovered that the cell frequency in sh-ELFN1-AS1 group was higher at G1 phase and lower at the S phase ( Figure 2E ). Later, whether lncRNA ELFN1-AS1 exerted impacts on apoptosis was figured out using apoptosis analysis. Results corroborated that ELFN1-AS1 decrement triggered colon cancer cell apoptosis ( Figure 3A ). Ultimately, Transwell assay was executed to determine lncRNA ELFN1-AS1’s impacts on colon cancer cell migration and invasion. It was disclosed that ELFN1-AS1 repression alleviated colon cancer cell migration and invasion ( Figures 3B, C ).

Figure 2.

Figure 2

LncRNA ELFN1-AS1 decrement restrains colon cancer cell proliferation and cell cycle. (A) ELFN1-AS1 expression in SW620 and HT-29 cells treated with sh-NC or ELFN1-AS1 shRNAs. (B) CCK-8 assay, (C) EdU (bar = 100μm), and (D) cell colony-forming experiment were performed to test cell proliferation of SW620 and HT-29 cells. (E) sh-ELFN1-AS1 cells show a remarkably lower frequency at S phase. Data are shown as the means ± SEM of three experiments. **P < 0.01, ***P < 0.001.

Figure 3.

Figure 3

LncRNA ELFN1-AS1 down-regulation promotes colon cancer cell apoptosis, but inhibits cell migration and invasion. (A) ELFN1-AS1 decrement aggravates colon cancer cell apoptosis. (B) ELFN1-AS1 decrement weakens the ability of colon cancer cells to migrate (bar = 100 μm). (C) ELFN1-AS1 decrement weakens the ability of colon cancer cells to invade (bar = 100 μm). Data are shown as the means ± SEM of three experiments. **P < 0.01, ***P < 0.001.

Mutual Inhibition Between Long Non-Coding RNA ELFN1-AS1 and miR-191-5p Expression

lncRNA subcellular distribution determines the biological role (23). Colon cancer cells were separated into the cytoplasm and nuclear fractions to verify the ELFN1-AS1 cellular location, with GAPDH and U6 as controls, respectively. RT-qPCR results revealed that ELFN1-AS1 was mainly distributed in the cytoplasmic fraction of colon cancer cells ( Figure 4A ). MiRNAs with complementary base matching ELFN1-AS1 was looked up using RegRNA 2.0 (http://regrna2.mbc.nctu.edu.tw/), among which emphasis was put on miR-191-5p, a recognized tumor-suppressing factor that restraining cancer cells to proliferate and invade (20, 21). Results manifested that relative to non-tumor colon tissues, miR-191-5p expression was decreased in colon cancer tissues ( Figure 4B ), and sh-ELFN1-AS1 could significantly increase miR-191-5p levels in SW620 and HT-29 cells ( Figure 4C ). Besides, the biding sites between miR-191-5p and ELFN1-AS1 were displayed in Figure 4D . Later, the speculated miR-191-5p binding site of ELFN1-AS1 (ELFN1-AS1-WT) and a mutant miR-191-5p binding site of ELFN1-AS1 (ELFN1-AS1-MUT) underwent cloning into reporter plasmids. Co-transfection with miR-191-5p and ELFN1-AS1-WT strongly weakened the luciferase activity, whereas co-transfection with miR-191-5p and ELFN1-AS1-MUT had no influence on the luciferase activity ( Figure 4D ). Then, whether miR-191-5p could negatively regulate ELFN1-AS1 expression was tested. As displayed in Figure 4E , cells receiving miR-191-5p treatment expressed ELFN1-AS1 at a reduced level, but those receiving anti-miR-191-5p treatment expressed ELFN1-AS1 at a raised level. Finally, RIP assays verified the gathering of miR-191-5p and ELFN1-AS1 in Ago2 immunoprecipitates rather than control IgG immunoprecipitates ( Figure 4F ). Collectively, the above data imply that miR-191-5p is able to bind to ELFN1-AS1 in a direct way and to inversely regulate ELFN1-AS1 expression.

Figure 4.

Figure 4

Mutual repression between lncRNA ELFN1-AS1 and miR-191-5p. (A) Cytoplasmic and nuclear levels of ELFN1-AS1 in colon cancer cells assessed by RT-qPCR. (B) qRT-PCR assay reveals the miR-191-5p level in colon cancer tissues. (C) sh-ELFN1-AS1 cells express miR-191-5p at a higher level than sh-NC cells. (D) The binding sites between miR-191-5p on ELFN1-AS1. And dual luciferase reporter assay was performed to verify binding relationship of miR-191-5p and ELFN1-AS1. (E) miR-191-5p inversely modulates ELFN1-AS1 expression. (F) ELFN1-AS1 and miR-191-5p gather in Ago2 immunoprecipitates compared with control IgG immunoprecipitates. Data are shown as the means ± SEM of three experiments. **P < 0.01, ***P < 0.001.

Special AT-Rich Sequence-Binding Protein 1 Was the Direct Target of miR-191-5p

MiRNAs function primarily by modulating the downstream targets of them (24, 25). Then, the target genes of miR-191-5p were looked up using Targetscan 7.2 (http://www.targetscan.org/vert_72/, top ten genes) and miRDB (http://mirdb.org/, score ≥ 85). As shown in the Figure 5A , four target genes were found. Then, we detected the expression of these four genes (NEURL4, TAF5, TMOD2, and SATB1). We found that only the expression of SATB1 was downregulated after miR-191-5p mimics transfection in SW620 cells ( Figure 5B ). Thus, SATB1 was selected from the speculated target genes of miR-191-5p for later research. It was manifested by luciferase assay that the luciferase activities in SW620 and HT-29 cells receiving co-transfection with miR-191-5p and WT-SATB1-3’-UTR were weakened relative to other groups ( Figure 5C ). SATB1 expression level in colon cancer tissues was also detected. Western blot assay validated that SATB1 expression was elevated in colon cancer tissues relative to non-tumor colon tissues ( Figure 5D ). Immunofluorescence staining showed the same results ( Figure 5E ). Besides, miR-191-5p restrained SATB1 protein to be expressed in SW620 and HT-29 cells ( Figure 5F ). In sh-ELFN1-AS1 cells, the level of SATB1 was discovered to be lower than that in sh-NC cells. Nevertheless, anti-miR-191-5p treatment restored SATB1 in sh-ELFN1-AS1 cells ( Figure 5G ). In all, the above data suggest that the SATB1 is a downstream target gene of miR-191-5p and modulated by ELFN1-AS1.

Figure 5.

Figure 5

miR-191-5p/SATB1 axis mediates ELFN1-AS1’s impacts on cell growth and invasion. (A) Bioinformatics analysis with miRDB and TargetScan 7.2. (B) The expression of the predictive target genes after miR-191-5p mimics transfection in SW620 cells. (C) The binding sites between miR-191-5p and SATB1. Dual luciferase assay uncovers that co-transfection with miR-191-5p and SATB1-WT evidently weakens the luciferase activity. (D) SATB1 protein expression rises in colon cancer tissues relative to normal tissues. C, cancer tissues; N, normal tissues. (E) Western blot assay discloses that colon cancer tissues express SATB1 at an elevated level than normal tissues. (F) miR-191-5p represses SATB1 protein expression in colon cancer cells. (G) Anti-miR-191-5p treatment gives rise to the restoration of SATB1 in sh-ELFN1-AS1 cells. Data are shown as the means ± SEM of three experiments. **P < 0.01. ***P < 0.001, ns, no significance.

Long Non-Coding RNA ELFN1-AS1 Decrement Impeded Tumor to Grow in the Body

Whether ELFN1-AS1 decrement impeded tumor to grow in the body was explored. It was disclosed that the growth of SW620 cells was slower in the case of lncRNA ELFN1-AS1 repression ( Figure 6A ). The average weight and volume of xenograft tumors in sh-ELFN1-AS1 group were less than those in sh-NC group ( Figures 6B, C ). Later, lncRNA ELFN1-AS1 expression in the resected tumor tissues was examined. Results unraveled that sh-ELFN1-AS1 group had decreased ELFN1-AS1 expression relative to sh-NC group ( Figure 6D ). Lastly, staining was executed for tumor sections to detect SATB1 expression, and it was disclosed that SATB1 expression was expressed at a lower level in sh-ELFN1-AS1 group ( Figure 6E ). To sum up, it can be inferred that ELFN1-AS1 boosts the tumor to grow in the body.

Figure 6.

Figure 6

ELFN1-AS1 inhibition curbs the tumor to grow in the body. (A) Xenograft tumors. (B) The growth of xenograft tumors from sh-ELFN1-AS1 cells is slower than that of xenograft tumors from sh-NC cells. (C) The mean weight of xenograft tumors. (D) ELFN1-AS1 expression in xenograft tumors is determined. (E) ELFN1-AS1 decrement pronouncedly reduces SATB1 in tumors compared with negative control group. ***P < 0.001.

Long Non-Coding RNA ELFN1-AS1 Regulated Colon Cancer Cell Proliferation, Invasion, Apoptosis, and Cycle Through miR-191-5p/SATB1 Axis

To verify the function of ELFN1-AS1/miR-191-5p/SATB1 in colon cancer, rescue experiments were carried out for SW620 and HT-29 cells. SW620 (sh-ELFN1-AS1) and HT-29 (sh-ELFN1-AS1) cells stably transfected with sh-ELFN1-AS1 were cultured and divided into 3 groups and transfected with NC, anti-miR-191-5p, and pcDNA-SATB1, respectively. The results of CCK-8 and EdU experiments showed that the proliferation abilities of anti-miR-191-5p group and pcDNA-SATB1 group were significantly increased ( Figures 7A, B ). In addition, anti-miR-191-5p and pcDNA-SATB1 also enhanced the invasive abilities of SW620 (sh-ELFN1-AS1) and HT-29 (sh-ELFN1-AS1) cells ( Figure 7C ), but inhibited G1 arrest ( Figure 7D ) and apoptosis ( Figure 7E ) of colon cancer cells.

Figure 7.

Figure 7

lncRNA ELFN1-AS1 modulates colon cancer cell proliferation, invasion, cell cycle, and cell apoptosis through miR-191-5p/SATB1 axis. (A) CCK-8 assay and (B) EdU assay reveal that anti-miR-191-5p and pcDNA-SATB1 promote cell proliferation in SW620 (sh-ELFN1-AS1) and HT-29 (sh-ELFN1-AS1) cells (bar = 100 μm). (C) Cell invasion assay in SW620 (sh-ELFN1-AS1) and HT-29 (sh-ELFN1-AS1) cells (bar = 100 μm). (D) Cell cycle assay in SW620 and HT-29 cells stably transfected with sh-ELFN1-AS1. (E) Cell apoptosis assay in SW620 and HT-29 cells stably transfected with sh-ELFN1-AS1. Data are show as the means ± SEM of three experiments. **P < 0.01, ***P < 0.001.

Discussion

Colon cancer ranks third among the most common cancers globally, and it is the second most frequently seen cause of death correlated with cancer (26). At present, prior to the development of new and effective treatment methods for colon cancer, there is a need to figure out the possible mechanisms by which colon cancer develops and progresses. Recently, lncRNAs have been indicated to exert pivotal effects in the development of different tumors, including colon cancer (27). TCGA data were used to analyze lncRNAs associated with colon cancer, high-expression ELFN1-AS1 was selected as a research object and validated in population tissues and cells.

Functional assays unraveled that repression of ELFN1-AS1 restrained SW620 and HT-29 cells to proliferate, migrate, and invade. Besides, ELFN1-AS1 was disclosed to boost the G1-S phase transition of cell cycle and likely to protect SW620 and HT-29 cells from apoptosis. The abovementioned findings imply that ELFN1-AS1 is an oncogene and it facilitates the formation of colon cancer.

SATB1 is a nuclear matrix-correlated protein involved in chromatin organization with a higher order and in modulating the expression of tissue-specific genes (28). It has been manifested that SATB1 is related to the development of different cancers, including oral squamous cell carcinoma (29), colorectal cancer (30), bladder cancer (31), and prostate cancer (32). Nonetheless, it has been reported that SATB1 decrement restrains breast cancer cells to proliferate, grow and invade by modulating gene expression (33). In this research, stably reducing ELFN1-AS1 expression pronouncedly attenuated the abilities of colon cancer cells to proliferate and invade, which could be reversed by SATB1 overexpression.

This research has several deficiencies. First, a larger sample size is required to further explore the clinical value of ELFN1-AS1. Second, more target genes or miRNAs should be applied to interact with ELFN1-AS1. Third, more different mouse models need be used to further verified our conclusion.

In conclusion, ELFN1-AS1 is prominently raised in colon cancer tissues and cell lines. Furthermore ELFN1-AS1 could promote proliferation and migration of colon cancer cells through miR-191-5p/STAB1 axis.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics Statement

The studies involving human participants were reviewed and approved by The Affiliated Huai’an Hospital of Xuzhou Medical University. The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by The Affiliated Huai’an Hospital of Xuzhou Medical University.

Author Contributions

YD and TL performed the experiments and prepared the manuscript. YH and YS collected and analyzed the data. YH supported the administration and technique, and provided the materials. JL and TL designed and supervised the study, and revised the manuscript. All authors contributed to the article and approved the submitted version.

Funding

NThis study was supported by The National Key R&D Program of China (No.2017YFC0113901 granted to Liu Yuping).

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  • 1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin (2018) 68(6):394–424. doi:  10.3322/caac.21492 [DOI] [PubMed] [Google Scholar]
  • 2. Wen J, Min X, Shen M, Hua Q, Han Y, Zhao L, et al. ACLY facilitates colon cancer cell metastasis by CTNNB1. J Exp Clin Cancer Res (2019) 38(1):401. doi:  10.1186/s13046-019-1391-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Tamas K, Walenkamp AM, de Vries EG, van Vugt MA, Beets-Tan RG, van Etten B, et al. Rectal and colon cancer: Not just a different anatomic site. Cancer Treat Rev (2015) 41(8):671–9. doi:  10.1016/j.ctrv.2015.06.007 [DOI] [PubMed] [Google Scholar]
  • 4. Banerjee A, Pathak S, Subramanium VD, Dharanivasan D, Murugesan R, Verma RS. Strategies for targeted drug delivery in treatment of colon cancer: current trends and future perspectives. Drug Discovery Today (2017) 22(8):1224–32. doi:  10.1016/j.drudis.2017.05.006 [DOI] [PubMed] [Google Scholar]
  • 5. Cartwright TH. Treatment decisions after diagnosis of metastatic colorectal cancer. Clin Colorectal Cancer (2012) 11(3):155–66. doi:  10.1016/j.clcc.2011.11.001 [DOI] [PubMed] [Google Scholar]
  • 6. Meyers BM, Cosby R, Quereshy F, Jonker D. Adjuvant Chemotherapy for Stage II and III Colon Cancer Following Complete Resection: A Cancer Care Ontario Systematic Review. Clin Oncol (R Coll Radiol) (2017) 29(7):459–65. doi:  10.1016/j.clon.2017.03.001 [DOI] [PubMed] [Google Scholar]
  • 7. Siegel RL, Miller KD, Fedewa SA, Ahnen DJ, Meester RGS, Barzi A, et al. Colorectal cancer statistics, 2017. CA Cancer J Clin (2017) 67(3):177–93. doi:  10.3322/caac.21395 [DOI] [PubMed] [Google Scholar]
  • 8. Rosen AW, Degett TH, Gogenur I. [Individualized treatment of colon cancer]. Ugeskr Laeger (2016) 178(31). [PubMed] [Google Scholar]
  • 9. Sun Q, Hao Q, Prasanth KV. Nuclear Long Noncoding RNAs: Key Regulators of Gene Expression. Trends Genet (2018) 34(2):142–57. doi:  10.1016/j.tig.2017.11.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Sun W, Yang Y, Xu C, Guo J. Regulatory mechanisms of long noncoding RNAs on gene expression in cancers. Cancer Genet (2017) 216-217:105–10. doi:  10.1016/j.cancergen.2017.06.003 [DOI] [PubMed] [Google Scholar]
  • 11. Zhou Y, Shi H, Du Y, Zhao G, Wang X, Li Q, et al. lncRNA DLEU2 modulates cell proliferation and invasion of non-small cell lung cancer by regulating miR-30c-5p/SOX9 axis. Aging (Albany NY) (2019) 11(18):7386–401. doi:  10.18632/aging.102226 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Huang HW, Xie H, Ma X, Zhao F, Gao Y. Upregulation of LncRNA PANDAR predicts poor prognosis and promotes cell proliferation in cervical cancer. Eur Rev Med Pharmacol Sci (2017) 21(20):4529–35. [PubMed] [Google Scholar]
  • 13. Zhang C, Lian H, Xie L, Yin N, Cui Y. LncRNA ELFN1-AS1 promotes esophageal cancer progression by up-regulating GFPT1 via sponging miR-183-3p. Biol Chem (2020) 401(9):1053–61. doi:  10.1515/hsz-2019-0430 [DOI] [PubMed] [Google Scholar]
  • 14. Jie Y, Ye L, Chen H, Yu X, Cai L, He W, et al. ELFN1-AS1 accelerates cell proliferation, invasion and migration via regulating miR-497-3p/CLDN4 axis in ovarian cancer. Bioengineered (2020) 11(1):872–82. doi:  10.1080/21655979.2020.1797281 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Liu JX, Li W, Li JT, Liu F, Zhou L. Screening key long non-coding RNAs in early-stage colon adenocarcinoma by RNA-sequencing. Epigenomics (2018) 10(9):1215–28. doi:  10.2217/epi-2017-0155 [DOI] [PubMed] [Google Scholar]
  • 16. Tutar Y. miRNA and cancer; computational and experimental approaches. Curr Pharm Biotechnol (2014) 15(5):429. doi: 10.2174/138920101505140828161335 [DOI] [PubMed] [Google Scholar]
  • 17. Zagryazhskaya A, Zhivotovsky B. miRNAs in lung cancer: a link to aging. Ageing Res Rev (2014) 17:54–67. doi:  10.1016/j.arr.2014.02.009 [DOI] [PubMed] [Google Scholar]
  • 18. Liu H, Ren G, Zhu L, Liu X, He X. The upregulation of miRNA-146a inhibited biological behaviors of ESCC through inhibition of IRS2. Tumour Biol (2016) 37(4):4641–7. doi:  10.1007/s13277-015-4274-5 [DOI] [PubMed] [Google Scholar]
  • 19. Lima CR, Geraldo MV, Fuziwara CS, Kimura ET, Santos MF. MiRNA-146b-5p upregulates migration and invasion of different Papillary Thyroid Carcinoma cells. BMC Cancer (2016) 16:108. doi:  10.1186/s12885-016-2146-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Chen P, Pan X, Zhao L, Jin L, Lin C, Quan J, et al. MicroRNA-191-5p exerts a tumor suppressive role in renal cell carcinoma. Exp Ther Med (2018) 15(2):1686–93. doi:  10.3892/etm.2017.5581 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Chen XY, Zhang J, Hou LD, Zhang R, Chen W, Fan HN, et al. Upregulation of PD-L1 predicts poor prognosis and is associated with miR-191-5p dysregulation in colon adenocarcinoma. Int J Immunopathol Pharmacol (2018) 32:2058738418790318. doi:  10.1177/2058738418790318 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Min X, Wen J, Zhao L, Wang K, Li Q, Huang G, et al. Role of hepatoma-derived growth factor in promoting de novo lipogenesis and tumorigenesis in hepatocellular carcinoma. Mol Oncol (2018) 12(9):1480–97. doi:  10.1002/1878-0261.12357 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Miao H, Wang L, Zhan H, Dai J, Chang Y, Wu F, et al. A long noncoding RNA distributed in both nucleus and cytoplasm operates in the PYCARD-regulated apoptosis by coordinating the epigenetic and translational regulation. PloS Genet (2019) 15(5):e1008144. doi:  10.1371/journal.pgen.1008144 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Bhaskaran M, Mohan M. MicroRNAs: history, biogenesis, and their evolving role in animal development and disease. Vet Pathol (2014) 51(4):759–74. doi:  10.1177/0300985813502820 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Roberts JT, Borchert GM. Computational Prediction of MicroRNA Target Genes, Target Prediction Databases, and Web Resources. Methods Mol Biol (2017) 1617:109–22. doi:  10.1007/978-1-4939-7046-9_8 [DOI] [PubMed] [Google Scholar]
  • 26. Cheng Y, Zhu Y, Xu J, Yang M, Chen P, Xu W, et al. PKN2 in colon cancer cells inhibits M2 phenotype polarization of tumor-associated macrophages via regulating DUSP6-Erk1/2 pathway. Mol Cancer (2018) 17(1):13. doi:  10.1186/s12943-017-0747-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Wu Q, Meng WY, Jie Y, Zhao H. LncRNA MALAT1 induces colon cancer development by regulating miR-129-5p/HMGB1 axis. J Cell Physiol (2018) 233(9):6750–7. doi:  10.1002/jcp.26383 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Nakayama Y, Mian IS, Kohwi-Shigematsu T, Ogawa T. A nuclear targeting determinant for SATB1, a genome organizer in the T cell lineage. Cell Cycle (2005) 4(8):1099–106. doi: 10.4161/cc.4.8.1862 [DOI] [PubMed] [Google Scholar]
  • 29. Li YC, Bu LL, Mao L, Ma SR, Liu JF, Yu GT, et al. SATB1 promotes tumor metastasis and invasiveness in oral squamous cell carcinoma. Oral Dis (2017) 23(2):247–54. doi:  10.1111/odi.12602 [DOI] [PubMed] [Google Scholar]
  • 30. Brocato J, Costa M. SATB1 and 2 in colorectal cancer. Carcinogenesis (2015) 36(2):186–91. doi:  10.1093/carcin/bgu322 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Choudhary D, Clement JM, Choudhary S, Voznesensky O, Pilbeam CC, Woolbright BL, et al. SATB1 and bladder cancer: Is there a functional link? Urol Oncol (2018) 36(3):93 e13–21. doi:  10.1016/j.urolonc.2017.10.004 [DOI] [PubMed] [Google Scholar]
  • 32. Mao LJ, Yang CH, Fan L, Gao P, Yang DR, Xue BX, et al. SATB1 promotes prostate cancer metastasis by the regulation of epithelial-mesenchymal transition. BioMed Pharmacother (2016) 79:1–8. doi:  10.1016/j.biopha.2016.01.038 [DOI] [PubMed] [Google Scholar]
  • 33. Han HJ, Russo J, Kohwi Y, Kohwi-Shigematsu T. SATB1 reprogrammes gene expression to promote breast tumour growth and metastasis. Nature (2008) 452(7184):187–93. doi:  10.1038/nature06781 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.


Articles from Frontiers in Oncology are provided here courtesy of Frontiers Media SA

RESOURCES