Abstract
Two proteases produced by the SARS-CoV-2 virus, the main protease and papain-like protease, are essential for viral replication and have become the focus of drug development programs for treatment of COVID-19. We screened a highly focused library of compounds containing covalent warheads designed to target cysteine proteases to identify new lead scaffolds for both Mpro and PLpro proteases. These efforts identified a small number of hits for the Mpro protease and no viable hits for the PLpro protease. Of the Mpro hits identified as inhibitors of the purified recombinant protease, only two compounds inhibited viral infectivity in cellular infection assays. However, we observed a substantial drop in antiviral potency upon expression of TMPRSS2, a transmembrane serine protease that acts in an alternative viral entry pathway to the lysosomal cathepsins. This loss of potency is explained by the fact that our lead Mpro inhibitors are also potent inhibitors of host cell cysteine cathepsins. To determine if this is a general property of Mpro inhibitors, we evaluated several recently reported compounds and found that they are also effective inhibitors of purified human cathepsin L and B and showed similar loss in activity in cells expressing TMPRSS2. Our results highlight the challenges of targeting Mpro and PLpro proteases and demonstrate the need to carefully assess selectivity of SARS-CoV-2 protease inhibitors to prevent clinical advancement of compounds that function through inhibition of a redundant viral entry pathway.
Keywords: SARS-CoV-2, Main Protease, Papain-Like Protease, Cathepsin Cross-Reactivity, Viral Entry
Graphical Abstract

The emergence of the novel coronavirus, SARS-CoV-2 in late December 20191 created a global pandemic, which has prompted unprecedented efforts to combat the virus using diverse vaccine and therapy strategies. One of the more promising therapeutic approaches involves repurposing existing drugs that can be rapidly advanced into clinical studies. Other strategies build on existing knowledge and lead molecules that were developed in response to earlier coronavirus outbreaks2. Two promising targets that emerged from the SARS-CoV-1 outbreak in 2003 were the essential main protease (Mpro) and papain-like protease (PLpro)3. These two cysteine proteases are encoded in the viral polyprotein as non-structural protein (Nsp) 3 and Nsp5. They are responsible for cleavage of the viral polyprotein into several structural and non-structural proteins prior to formation of the replication organelle that is established in close proximity to virus assembly sites3. Therefore, inhibition of one or both of these enzymes effectively blocks viral RNA replication and thus virus transmission.
Several covalent inhibitors containing various electrophilic warheads including α-ketoamides, aldehydes, α,β-unsaturated ketones and vinyl sulfones have been developed as inhibitors of Mpro 4–7. Recently, a small molecule containing an α-hydroxy ketone warhead (PF-07304814) entered human clinical trials (ClinicalTrials.gov, NCT04535167)8. The development of covalent small molecule inhibitors of PLpro has been more challenging, perhaps due to a dominant non-proteolytic function and preference for relatively large ubiquitin-like protein substrates9,10. This premise is further supported by the fact that, while some small peptide-based inhibitors have been reported9, the most successful inhibitors target exosites involved in ubiquitin recognition10–12. While both Mpro and PLpro are considered to be promising therapeutic targets, several properties of these proteases, combined with the past history of efforts to develop protease inhibitors for other RNA viruses such as hepatitis C virus (HCV)13 portend multiple challenges for drug discovery efforts. Like other proteases from RNA viruses, the Mpro protease liberates itself from a large polyprotein through N-terminal autocleavage before the mature, active dimer can be formed6,14,15. This initial event is difficult to inhibit due to the favorability of the intramolecular reaction. After maturation, the dimeric protease is likely localized to defined regions inside the cytosol or at membrane surfaces in proximity to its viral protein substrates resulting in relatively high local substrate concentrations. In addition, a number of viral proteases have been found to undergo product inhibition where they retain their cleaved substrates within the active site, thus requiring displacement for effective inhibitor binding16,17. Additionally, inhibition of Mpro prior to formation of its semi-active monomer is likely impossible due to the fact that this early stage intermediate lacks a properly formed active site14,15,18. Thus, inhibitors must be highly bioavailable and cell permeant such that they can reach local concentrations that are sufficient to compete with native substrates and inhibit the viral protease early in the infection cycle.
Another significant challenge for targeting Mpro and PLpro is the potential for any lead molecule to target host proteases with similar substrate preferences. This is compounded by the diverse set of cellular systems used to evaluate lead molecules, which express different levels and types of proteases. There also remains controversy about which cell type best represents primary sites of infection in vivo19,20. In particular, priming of the receptor binding domain (RBD) of the S-glycoprotein of SARS-CoV-2 by host proteases is required after binding to the angiotensin converting enzyme-2 (ACE2) entry receptor21. This process can be mediated by multiple proteases including cysteine cathepsins B and L or the transmembrane protease serine 2 (TMPRSS2)22,23. While high expression levels of both cathepsins and TMPRSS2 have been confirmed in lung tissue24, cell lines commonly used for viral infection assays have varying expression levels of both protease classes which can have a dramatic impact on the mechanism used by the virus for entry20. The redundancy of these pathways not only poses a challenge for antiviral drugs that are targeted towards host factors such as cathepsins or TMPRSS2 (K1177725,26, E64d or camostat27), but also for drugs that display off-target activity towards these enzymes.
In this work, we screened a highly focused library of ~650 cysteine reactive molecules against PLpro and Mpro using a fluorogenic substrate assay to identify novel lead molecules as potential antiviral agents. From this screen, we identified six inhibitors containing various electrophiles, which demonstrated time-dependent inhibition of recombinant Mpro. Notably, we did not identify any viable hits for PLpro. Two of the six lead Mpro inhibitors were active in cellular infectivity assays using A549 epithelial lung cells, but their potency decreased significantly upon expression of TMPRSS2 as was the case for established cysteine cathepsin inhibitors (E64d and K11777) and multiple previously reported Mpro inhibitors. This loss of potency could be best explained by the fact that TMPRSS2 expression provides an alternate entry pathway for the virus and therefore any lost antiviral activity was likely mediated by cathepsin inhibition. Indeed, we confirm cathepsin cross-reactivity of our newly discovered Mpro inhibitors as well as for several of the reported Mpro inhibitors. These results highlight the challenges for selection of Mpro inhibitors based on antiviral activity without complete understanding of their target selectivity as it can result in advancement of compounds based on disruption of redundant entry pathways rather than on direct antiviral effects.
RESULTS AND DISCUSSION
To identify potential inhibitors of Mpro and PLpro, we developed fluorogenic substrate assays that allowed us to screen a focused library of cysteine reactive molecules. We based the design of internally quenched-fluorescent Mpro substrates on recent specificity profiling of the P1-4 residues using non-natural amino acids with a C-terminal 7-amino-4-carbamoylmethylcoumarin (ACC) reporter7. However, because the reported structures have relatively low turnover rates, we decided to make extended versions of these substrates that combine the optimal P1-4 residues with the native cleavage consensus of the P1’-P3’ residues (i.e., residues C-terminal of the scissile bond)7,28. This required synthesis of substrates using a quencher/fluorophore pair rather than an ACC reporter (Fig. 1A; Fig S1). A dramatic increase was observed in the catalytic rate of substrate conversion by Mpro as we incorporated more prime site residues into the substrate sequence (Fig 1B–C). This result explains the reason for the overall low kinetic rate constants for reported ACC substrates, which lack any prime side residues. As a substrate for the PLpro protease, we synthesized the reported ACC peptide derived from the ubiquitin consensus sequence LRGG (N-terminal acetylated substrate referred to as: Ac-LRGG-ACC)9. For activity assays we used recombinant Mpro and PLpro that were cloned for expression in E. coli and subsequently purified (Fig S2A–B). We then optimized enzyme and substrate concentrations such that the Z-factors for each assay were consistently above 0.5. We found that substrate turnover by PLpro required the presence of reducing agent DTT(Fig S3).
Figure 1. Design of quenched-fluorescent Mpro substrates for the inhibitor screening assay.

A) Chemical structures of internally quenched Mpro substrates. B) Progress curves and C) initial velocities of Mpro substrates. 10 μM substrate was added to 100 nM Mpro immediately prior to fluorescence readout.
After having established optimal assay conditions, we screened a library of approximately 650 compounds designed to inhibit cysteine proteases29,30. Because this set of compounds contains a diverse but highly focused set of cysteine-reactive molecules, we have found that it produces viable lead scaffolds for virtually all the cysteine protease targets that we have screened. The library contains molecules with electrophiles including aza-peptide epoxyketones, aza-peptide vinylketones, epoxides, halomethylketones, acyloxymethylketones and sulfones. We screened the library by measuring residual enzymatic activity after 30 min incubation of Mpro substrate 2 and Ac-LRGG-ACC for PLpro. We set a threshold of maximum 10% residual Mpro activity and identified 27 hits. In subsequent time-dependent inhibition assays, the hits were further narrowed down to six validated reproducible covalent Mpro inhibitors (Fig 2A). Surprisingly, when we screened the same compound library for inhibition of PLpro we identified only one compound that initially made the 10% cutoff, but this compound proved to be a false positive and we therefore ended up with no viable lead molecules for PLpro (Fig 2B). An explanation for the absence of PLpro lead scaffolds in our library likely relates to the DUB like character of the protease together with its extremely narrow substrate specificity. The six validated Mpro hits can be categorized based on their electrophile class into aza-epoxyketones, chloro- and acyloxymethylketones and chloroacetamides (Fig 2C). We measured the kinetic inhibition parameter kinact/KI, for each compound (Fig 2D, Fig S4) and found that the aza-peptide epoxide, JCP474, was the most potent inhibitor of Mpro with a kinact/KI value of 2,526 ± 967 mol·sec−1.
Figure 2. Screening of covalent inhibitor library against SARS-CoV-2 Mpro and PLpro.

Residual activity of A) Mpro and B) PLpro after 30 minutes incubation with 20 μM of each compound measured by cleavage rate of Mpro substrate 2 and Ac-LRGG-ACC for PLpro. C) Structures of Mpro hit compounds and D) their kinetic inhibition values measured without preincubation. Data are means ± SD of at least two replicate experiments
Interestingly, this compound was previously identified as a covalent inhibitor of SARS-CoV-1 Mpro (kinact/KI: 1900 ± 400 mol·sec−1)31. Following a recent report about the need for validation of Mpro inhibitors under reducing conditions in order to exclude pan thiol-reactive compounds32, we verified our screening assay in presence of reducing agent DTT in the assay buffer. Here we found that of the six validated Mpro hits, only JCP543 was partially sensitive to the reducing environment, losing approximately half of its inhibitory capacity at in presence of 4 mM DTT (Fig. S5). This potential non-specific interaction of JCP543 with Mpro is further supported by the fact that we were not able to measure second order inhibition constants for this compound (Fig. 2D). Finally, to confirm that our screening assay using the newly designed substrate was effective for identifying Mpro inhibitors, we tested the previously reported inhibitors 11a and 11b as well as GC373 and GC376 (Fig S5; see figure 5 for structures). All four of these inhibitors showed effective inhibition of substrate processing at similar levels to the identified hits and none were sensitive to DTT levels.
Figure 5. Reported Mpro inhibitors cross react with cathepsin B and L.

A) Inhibition of recombinant cathepsins. Protease was incubated for 10 min with inhibitor prior to addition of substrate 6QC and fluorescent readout. Data are means ± SD of two replicate experiments. B) In-cell competition labeling with BMV109. A549+ACE2 cells were subjected to 1h treatment with inhibitor at indicated concentrations followed by 1h incubation with 1 μM BMV109. Cells were lysed and ran on SDS-PAGE gels that were scanned for in-gel fluorescence. Bar graphs represent relative densitometric quantification of two replicate experiments ± SD. C) Plots of EC50 curves of reported Mpro inhibitors in A549+ACE2 cells +/− TMPRSS2. Data are means ± SD of two replicate experiments.
To probe the therapeutic potential of our Mpro inhibitors, we tested all of the compounds for inhibition of SARS-CoV-2 infection using a cellular model. A number of different types of host cells have been used in SARS-CoV-2 infection assays, with the most common cell type being Vero E6 cells of primate origin. However, as Vero E6 cells are not an accurate mimic of the human airway and lung epithelial cells that are the primary site of SARS-CoV-2 infection, we set out to instead use cells of human origin that more accurately represent lung epithelial tissue. Two of these model systems are Calu-333 and A54933, of which only the latter does not have sufficient ACE2 expression levels to allow for efficient infection with SARS-CoV-222. Hence, we stably expressed the ACE2 entry receptor in A549 cells and achieved a high level of infection (typically greater than 50% infection) and replication during a 24-hours observation period. Using the A549+ACE2 system, we found that only two out of the six initial lead compounds blocked viral replication in these cells (Fig 3A). Surpisingly, using the Calu-3 system, we noted that all compounds including the benchmark antiviral remdesivir, showed a substantial loss in potency that likely is due to drug efflux mechanisms34, thereby preventing the use of these cells for our studies of the Mpro inhibitors (Fig. S6). The two most potent inhibitors of Mpro in vitro, JCP474 and JCP543 were inactive in the cellular infection assay, likely due to the fact that they are both tripeptides with a polar P1 glutamine or asparagine residue resulting in poor cell permeability. The only two compounds that demonstrated activity were the chloromethylketone JCP400 and the acyloxymethylketone JCP403. These compounds showed relatively weak potency with greater than 75% inhibition only when applied at concentrations above 20 μM, which is well below cytotoxic concentrations (Fig. S7). This drop in potency of compounds in the cellular infection assay is consistent with what has been reported for other Mpro inhibitors2,6, and is likely due to poor cellular uptake and the difficulty in achieving complete inhibition of Mpro inside the host cell.
Figure 3. Potency of Mpro hits in cellular SARS-CoV-2 infection assays.

A) Two out of six newly identified Mpro inhibitors are active in A549+ACE2 infection model. B) SARS-CoV-2 inhibition curves of Remdesivir, E64d and K11777 in A549+ACE2 cells with or without expression of TMPRSS2. C) SARS-CoV-2 inhibition curves of Mpro inhibitors JCP400 and JCP403 in A549+ACE2 cells with or without expression of TMPRSS2. Data are means ± SD of two replicate experiments.
One of our concerns about screening for Mpro inhibitors in our cysteine protease inhibitor library was the potential for hits to have cross-reactivity with other cysteine proteases. This becomes particularly problematic if compounds are only active against the virus at relatively high concentrations. The most likely family of off-target host proteases are the cysteine cathepsins, which are broadly expressed in many cell types and are accessible to small molecule and peptide-based inhibitors because of their lysosomal localization. Furthermore, recent studies have shown that SARS-CoV-2 can utilize multiple pathways to enter into the host cell that depend on a variety of cellular proteases among which are cathepsin B and L, TMPRSS2 and furin22,23,35. One of the primary routes involves processing of the viral spike protein by the TMPRSS2 protease. This pathway is highly redundant with a pathway involving processing by cathepsin L (recent work has shown that Cat B is unable to independently process the spike protein36). Therefore, cathepsin inhibitors such as E64d and K11777 are highly potent inhibitors of viral entry in some cell lines but this activity is lost upon expression of TMPRSS222. Hence, we sought to assess if either of our two lead Mpro inhibitors were active in the cellular assay as a result of inhibition of host cathepsins rather than as a result of inhibiting the virus encoded Mpro enzyme.
To address this issue, we generated A549+ACE2 cells that also express TMPRSS2, which is not expressed to a detectable level in regular A549 cells (data not shown), and investigated if expression of this alternate protease resulted in any change in antiviral activity. We first tested remdesivir and E64d and found that remdesivir was equipotent in both cell lines, while E64d completely lost its potency upon expression of TMPRSS2, consistent with previous studies22 (Fig 3B). Following a recent report showing that the cathepsin inhibitor K11777 is a highly potent SARS-CoV-2 antiviral compound36, we included this molecule in our analysis and found that it too lost all of its activity upon expression of TMPRSS2. For our two lead Mpro inhibitors, we found that their apparent EC50 values dropped by two to three-fold upon expression of TMPRSS2 (Fig 3C). Notably, both compounds displayed some signs of cytotoxicity at concentrations above 50 μM (Fig S7).
To confirm that the observed drop in potency of lead molecules upon TMPRSS2 expression was due to off-target reactivity of the compounds with cysteine cathepsins, we performed competition inhibition studies using the covalent cathepsin activity-based probe (ABP) BMV109. This ABP has been used to quantify levels of cathepsin activity in various cell-based systems37–41. Using this labeling approach, we found that JCP400 and JCP403 are both able to compete with BMV109 labeling of Cat B and L in A549+ACE2 cells (Fig 4A). As further validation of the off-target activity of the two lead molecules, we also tested the compounds for their ability to inhibit purified Cat B and L enzymes. These results confirmed that both are relatively potent inhibitors of cathepsins with IC50 values in the low micromolar range (Fig 4A–B).
Figure 4. JCP400 and JCP403 inhibit cathepsin L and B.

A) JCP400 and JCP403 compete with covalent labeling of broad spectrum cathepsin ABP BMV109 in A549+ACE2 cells. Cells were incubated with each compound for 1 h prior to addition of BMV109 B) JCP400 and JCP403 inhibit substrate cleavage of recombinant cathepsin L and B. Data are means ± SD of two replicate experiments.
Having confirmed that our newly identified compounds were cross-reactive with host cathepsins and that this activity was responsible for the bulk of their antiviral activity, we questioned whether previously reported Mpro inhibitors might have similar properties. We first evaluated five reported Mpro inhibitors for inhibition of human recombinant Cat B and L using a fixed time point fluorogenic substrate in vitro assay (Fig 5A). Surprisingly, the three aldehyde-containing inhibitors GC373, 11a, and 11b were highly potent with nanomolar IC50 values for both Cat L and Cat B. Rupintrivir, on the other hand, displayed no inhibition toward Cat B (tested up to 250 μM) and had only weak micromolar activity against Cat L.
We next evaluated whether the inhibitors were active against Cat B and L in A549+ACE2 cells. In-cell competition of the selected compounds with cathepsin labeling by BMV109 demonstrated that all of the reported Mpro inhibitors modified the active site residues of Cat B and L (Fig 5B, Fig S8). Consistent with the recombinant enzyme data, compounds 11a and 11b were active against cellular Cat B and L in the micromolar range with complete competition at 20 μM. The inhibitor GC373 and its pro-drug form GC376 show similar competition of Cat L between 5-10 μM and were slightly less potent toward Cat B with competition beginning between 20-50 μM. Rupintrivir was active against Cat L starting at 20 μM and showed only slight inhibition of Cat B labeling even at 100 μM.
Finally, we tested the reported Mpro inhibitors for activity in the A549+ACE2 cells with and without expression of TMPRSS2 to determine if cross reactivity with cathepsins was contributing to their antiviral activity. Indeed, we found that all five inhibitors showed a loss in potency upon TMPRSS2 expression similar to what we observed for our newly identified Mpro inhibitors. The effect appeared to be most prominent for aldehyde 11b, which showed an 11-fold drop in potency. Interestingly, the α,β-unsaturated ketone rupintrivir, which has low micromolar activity in the cells lacking TMPRSS2, completely lost its antiviral activity when TMPRSS2 was expressed even though it showed minimal cathepsin cross reactivity (Fig 5B). Together with a lack of inhibitory activity against recombinant Mpro (Fig S9), this strongly suggests that rupintrivir derives all of its activity in cellular assays from weak inhibition of Cat L or possibly activity against other redundant proteases that can process the RBD to facilitate viral entry. The other compounds 11a, GC373 and GC376 displayed a 4-5-fold decrease in potency upon expression of TMRPSS2 in the host cell (Fig 5C). Taken together, these results suggest that all of the tested Mpro inhibitors have some level of antiviral activity that is due to inhibition of host derived cathepsins and which is overcome to varying degree by the use of an alternate spike protein processing pathway employed by SARS-CoV-2.
In conclusion, inhibition of the Mpro and PLpro proteases is considered to be a potentially viable therapeutic strategy for the treatment of COVID-19. However, because animal models of SARS-CoV-2 infection are still being optimized and controversy remains about cell systems that most accurately mimic aspects of the human infection (including the relative redundancy of either TMPRSS2, furin or cathepsin mediated viral entry35), it will be critical to assess key parameters of target selectivity of drug leads prior to clinical testing in humans. Furthermore, variability within the cellular systems used for antiviral testing can lead to flawed conclusions about lead candidate efficacy. The majority of current approaches only use inhibition of viral replication as a metric for efficacy of lead molecules without any direct confirmation of target inhibition. Only recently, has inhibition of processing of a genetically expressed Mpro substrate or labeling of active Mpro enzyme been established as a measure of Mpro activity in cells7,42. In this work, we describe our efforts to screen a library of approximately 650 diverse covalent inhibitor scaffolds against the two primary SARS-CoV-2 cysteine proteases, Mpro and PLpro. We failed to identify any inhibitors of PLpro and ultimately found only two inhibitors of Mpro that exerted antiviral activity in cell infection models, but only at relatively high concentrations. However, we found that the antiviral activity of these lead molecules as well as several previously reported Mpro inhibitors was related to their ability to inhibit host cathepsins, thus highlighting the importance of understanding compound selectivity and verifying target engagement. Taken together, our results point out the challenges for developing inhibitors of SARS-CoV-2 proteases and suggest that using strategically chosen cell lines for antiviral testing can help to prevent selection of compounds whose mechanisms of action can be easily overcome by redundant viral entry pathways. We strongly believe that our findings are of particular importance in light of drugs that are widely suggested for advancement into clinical trials such as rupintrivir43,44, or even have entered clinical trials such as K11777 (Selva Therapeutics, received FDA authorization for IND) and PF-07304814. Future anti-viral lead molecules targeting SARS-CoV2 or other future CoVs should be carefully tested for cross reactivity against all of the possible redundant host protease pathways before advancement into clinical trials to prevent unexpected failures of compounds as a result of false confidence from cellular efficacy data.
METHODS
Mpro expression and purification.
Recombinant Mpro and the expression plasmid were gifts from D. Nomura (Berkeley). Expression and purification were performed as previously described for Mpro from SARS-CoV45 and SARS-CoV-26. The gene encoding Mpro was synthesized and cloned into the pGEX vector resulting in a GST-Mpro-6xHis fusion construct (pGEX-Mpro), with the native Mpro cut site between GST and Mpro and a PreScission protease cut site between Mpro and the 6xHis tag. During expression, the N-terminal GST fusion is autoproteolytically cleaved by Mpro to yield the native N-terminus of the protease. Cleavage by 3C protease during purification yields the native C-terminus.
E. coli BL21 (DE3) were transformed with pGEX-Mpro and cultured in 1 L of 2xYT medium with ampicillin (100 μg/mL) at 37 °C. When the culture reached an OD600 of 0.8, protein expression was induced by addition of isopropyl-D-thiogalactoside (IPTG) to a final concentration of 0.5 mM. Expression was allowed to continue for 5 h at 37 °C. Cells were collected by centrifugation, resuspended in Buffer A (20 mM Tris, 150 mM NaCl, pH 7.8), and lysed by sonication. The lysate was clarified by centrifugation at 15,000 x g for 30 min at 4 °C. Clarified lysate was purified by NiNTA affinity using a HisTrap FF column (Cytiva). After loading the lysate, the column was washed with Buffer A and then protein was eluted over a gradient from Buffer A to Buffer B (20 mM Tris, 150 mM NaCl, 500 mM imidazole, pH 7.8). 3C protease was added to pooled elution fractions, and the mixture was dialyzed overnight at 4 °C into Buffer C (20 mM Tris, 150 mM NaCl, 1 mM DTT, pH 7.8). The dialyzed mixture was passed over a HisTrap FF column to remove the leaved HisTag fragment and the His-tagged 3C protease. Mpro eluted in the flowthrough and was concentrated and buffer exchanged to Buffer D (20 mM Tris, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, pH 7.8) using an Amicon 10kDa spin filter. Purified Mpro was aliquoted and stored at −80 °C. PLpro expression and purification. For cloning of PLpro with an N-terminal 6xHis-SUMO1 tag, synthetic fragments of the Nsp3 coding sequence derived from the original Wuhan strain were purchased from BioCat. and inserted into pUC57. The amino acid sequence of PLpro (amino acids 1524-1883) was identified based on a homology blast using SARS-CoV-1 as template. The PLpro sequence was amplified from pUC57-NSP3-BsaI-free-Fragments 1 and 2. The PCR products for SUMO1, PLpro fragment 1 and PLpro fragment 2, containing overlapping overhangs with unique restriction sites, were mixed in equimolar amounts and ligated into a linearized pet28a vector, resulting in a 6xHis-SUMO1-PLpro construct.
PCR primers:
fw SUMO1w/AgeImut: AATTCGAGCTCATGTCTGACCAGGAGGCA
rev SUMO1w/AgeImut: TCCTCACACCACCGGTTTGTTCCTGATAAACTTCAATCACATC
fW proPLfrag1: TCAGGAACAAACCGGTGGTGTGAGGACCATCAAGGTG
rev proPLfrag1: CAGAAAGCTAGGATCCGTGGTGTGGTAGT
fw proPLfrag2: ACCACACCACGGATCCTAGCTTTCTGGGCAGG
rev proPLfrag2: GTGCGGCCGCAAGCTTTCACTTGTAGGTCACAGGCTTGA
E. coli BL21 (DE3) were transformed with 6xHis-SUMO1-PLpro in pet28a. Cells were grown in 2 liters LB medium supplemented with 50 μg/mL kanamycin at 37 °C. At an OD600 of 0.6, cells were further diluted with precooled LB medium supplemented with kanamycin, to a final volume of 4 liters. Protein expression was induced by addition of 0.1 mM IPTG and 0.1 mM ZnSO4 at 18 °C. Following a 24 h induction, cells were harvested by centrifugation and resuspended in Lysis buffer (50 mM NaH2PO4, 300 mM NaCl ,10 mM Imidazole pH 8.0, 1 mM ß-Mercaptoethanol), followed by sonication. Cell lysates were incubated with 50 μg / ml DNase I and 1 mM MgCl2, at 4 °C for 45 min, and subsequently subjected to ultracentrifugation at 100,000 x g for 1 h at 4 °C.
Next, the clarified lysates were incubated with NiNTA beads (Qiagen) to capture 6xHis-SUMO1-PLpro. Following extensive washing, GST-SENP was added to the beads to cleave at the C-terminus of SUMO1, resulting in elution of untagged PLpro with the native N-terminus. GST-SENP was captured and removed from the eluate by incubation with GSH beads (GE Healthcare). Purified PLpro was further concentrated using an Amicon 5 kDa spin filter to a final concentration of 1 mg/ml and stored at −80 °C (50 mM NaH2PO4 pH 8.0, 300 mM NaCl). Proteolytic activity of purified PLpro against Z-LRGG-AMC was tested over time. Prior to activity assays, PLpro was activated by incubation in reaction buffer (150 mM NaCl, 20 mM Tris-HCl pH 7.5, 0.05% Tween-20, 0.2 mg/mL Ovalbumin) containing 5 mM DTT. RFU values were measured immediately in an Enspire Plate Reader (PerkinElmer). Each dot represents the mean of 3 independent experiments.
Virus stock.
The SARS-CoV-2 isolate used in this study was derived from a patient at Heidelberg University Hospital. This Heidelberg strain was passaged in VeroE6 cells, aliquoted and stored at −80° C. Virus titer was measured by plaque assay in VeroE6 cells.
Cell lines.
Calu-3, VeroE6 and A549 cells were obtained from American Type Culture Collection (ATCC) and tested at regular intervals for mycoplasma contamination. Generation and cultivation of A549 cells stably expressing ACE2 (A549+ACE2) was described recently46. A549+ACE2 cells stably expressing the TMPRSS2 protease were generated by lentiviral transduction. Lentivirus stocks were produced by transfection of HEK293T cells with a pWPI plasmid encoding for TMPRSS2 and the pCMV-Gag-Pol and pMD2-VSV-G packaging plasmids (kind gifts from D. Trono, Geneva). Two days after transfection, supernatant containing lentiviruses were collected, filtered through a 0.44 μm pore size filter, and used for transduction of A549+ACE2 cells followed by selection with 2 μg/mL puromycin. For all viral infection assays, the cells were cultured in Dulbecco’s modified Eagle medium (DMEM, Life Technologies) containing 10% or 20% fetal bovine serum, 100 U/mL penicillin, 100 μg/mL streptomycin and 1% non-essential amino acids (complete medium). For all other assays, A549+ACE2 cells were cultured in Roswell Park Memorial Institute (RPMI, Corning, REF: 10-040-CV) 1640 medium containing 2 g/L of glucose, 0.3 g/mL of L-glutamine, and supplemented with 10 v/v% FBS, 100 units/mL penicillin, 100 μg/mL streptomycin, and 625 μg/mL of Geneticin (G418). All cells were grown in a 5% CO2 humidified incubator at 37 °C.
Primary library screening.
A compound library of 646 diverse molecules containing electrophilic warheads were kept in 1, 10 or 50 mM DMSO stock solutions at −80 °C for long-term storage. All assays were conducted in black, opaque flat squared bottom 384-well plates (Greiner Bio-One, REF: 781076) containing a final reaction volume of 50 μL. Assays volumes and concentrations used were as follows: 0.5 μL of 1 mM compound was added to the wells, followed by 25 μL of 200 nM Mpro or 150 nM PLpro (Mpro buffer: 150 mM NaCl, 20 mM Tris pH 7.5, 1 mM EDTA, PLpro buffer: 150 mM NaCl, 20 mM Tris pH 7.5, 0.05% Tween-20 and 2 mM DTT). 4 mM DTT was added to Mpro buffer in indicated experiments. After 30 min incubation at 37 °C, 24.5 μL of 20 μM Mpro substrate 2 or 100 μM Ac-LRGG-ACC (for PLpro) was added to the wells and the fluorescent measurement was started immediately. The final concentrations of compound, enzyme and substrate were 10 μM, 100 nM / 75 nM, 10 μM / 50 μM (Mpro / PLpro) respectively. Each 384-well plate contained at least 20 positive controls in which the compound was 10 μM ebselen for Mpro assays and heat inactivated (10 min, 95 °C) enzyme for PLpro assays. Similarly, at least 20 negative controls were incorporated in each 384-well plate where 0.5 μL compound was swapped with 0.5 μL DMSO. Raw slope values were calculated as the slope of the absolute RFU versus time for the first 15 min of the experiment. Then, percentage activity was calculated by normalizing between slope values of the positive and negative controls. The inhibition threshold for Mpro was 90 % whereas for PLpro a threshold of 80 % was chosen because of the low hit rate. All fluorescent measurements for substrates containing a sulfo-Cy5 or ACC moiety were read above the well with a Biotek Cytation3 Imaging Reader (7.00 mm read height, gain = 100, Cy5 = λex 650 nm; λem 670 nm or ACC = λex 355 nm; λem 460 nm, gain = 65, and normal read speed).
IC50 value and kinetic parameter determination.
Dose-response studies were performed by mixing 200 nM Mpro with 20 μM KS011 in a 384-well plate. Immediately before starting the fluorescence measurement, a dilution series of 6-10 different concentrations of inhibitor were added to the wells and the fluorescence intensity was recorded for 1 h. Apparent IC50 values were estimated by fitting the normalized linear slopes to eq 1 using a four-parameter fit. Using the same data, kobs at each inhibitor concentration was estimated by nonlinear fitting of each progress curve to eq 2. The could be determined by nonlinear fitting of eq 3 to as function of inhibitor concentration.
| (1) |
| (2) |
| (3) |
Inhibition studies with recombinant cathepsin B and L were performed with by incubating the serially diluted compounds for 10 min with either 40 nM Cat B or 10 nM Cat L (kind gifts from B. Turk, Ljubljana) in 50 mM citrate buffer (pH = 5.5, 5 mM DTT, 0.1% triton X, 0.5% CHAPS) and subsequent addition of 10 μM quenched-fluorescent substrate 6QC47. Fluorescence intensity was recorded using a plate reader at λex 650 nm, λem 670 nm. Apparent IC50 values were determined similarly as for MPpro assays. All experiments were performed in duplicate. All data were analyzed using GraphPad Prism (v8.4).
Competition assay in living A549 cells.
In a 24-well plate, 1 μL of 200x inhibitor concentration was added to approximately 105 A549+ACE2 cells in 200 μL medium containing 1% DMSO and incubated for 1 h at 37 °C. 1 μL of BMV109 was added at a final concentration of 1 μM and incubated for 1h. Medium was removed, and cells were detached from culture plate by incubating with 100 μL 0.05 % Trypsin, 0.5 mM EDTA solution for 10 min at 37 °C. Cells were spun down, washed twice with PBS and lysed by four succeeding freeze-thaw cycles via submersion of Eppendorf tubes in a 37 °C water bath and liquid nitrogen respectively. Protein concentration of lysate was determined using BCA assay, Laemmli’s sample buffer was added at 4-fold dilution and samples were boiled for 5 min before running them on 15% SDS-PAGE gel. In-gel detection of fluorescently labeled proteins was performed directly by scanning the wet gel slabs on the Typhoon Variable Mode Imager (Amersham Biosciences) using Cy5 settings (λex 650 nm, λem 670 nm). Densitometric analysis of protein bands on gels was performed using ImageJ (v1.52p).
Antiviral assays.
A549+ACE2+/−TMPRSS2 were seeded at a density of 1.5 x 104 cells per well of a flat bottom 96-well plate (Corning). On the next day, for each compound serial dilutions of at least ten concentrations were prepared in complete DMEM and added to the cells. After 30 minutes, SARS-CoV-2 (MOI=1) is added into the compound containing medium. 24 h post infection, plates were fixed with 6% of formaldehyde and cells were permeabilized using 0.2% Triton-X100 in PBS for 15 min at room temperature. After washing with PBS and blocking with 2% milk in PBS / 0.02% Tween-20 for 1 hour at room temperature, cells were incubated with a double strand RNA-specific antibody (Scicons, Hungary) for 1 hour at room temperature. After three times washing with PBS, bound primary antibody was detected with a secondary antibody (anti-mouse IgG), conjugated to horseradish peroxidase. Bound secondary antibody was quantified using TMB (3,3’,5,5’-Tetramethylbenzidine) substrate (Thermo Fisher Scientific) and photometry at 450 nm in a plate reader. Background absorbance was measured at 620 nm. To determine cytotoxicity of the compounds, non-infected A549-derived cells were treated in the same way as the infected cells. After 24 hours, intracellular ATP content was quantified by using the CellTiter Glo® Luminescent Cell Viability Assay (Promega) according to the instructions of the manufacturer. Values were normalized using solvent control (0.5% DMSO). Each experiment was performed in duplicate, and two independent biological replicates were conducted.
Chemistry methods.
All reactions were performed exposed to atmospheric air unless noted otherwise and with solvents not previously dried over molecular sieves or other drying agents. Reactions containing light sensitive materials were protected from light. The ACS reagent grade N,N’- dimethylformamide (DMF), molecular biology grade dimethyl sulfoxide (DMSO), and all other commercially available chemicals were used without further purification. Reaction progress and purity analysis was monitored using an analytical LC-MS. The LC-MS systems used was either a Thermo Fisher Finnigan Surveyor Plus equipped with an Agilent Zorbax 300SB-C18 column (3.5 μm, 3.0 x 150 mm) coupled to a Finnigan LTQ mass spectrometer or an Agilent 1100 Series HPLC equipped with a Luna 4251-E0 C18 column (3 μm, 4.6 x 150 mm) coupled to a PE SCIEX API 150EX mass spectrometer (wavelengths monitored = 220, 254 and 646 nm). Purification of intermediates and final compounds was carried out using either a semi-preparative Luna C18 column (5 μm, 10 x 250 mm) attached to an Agilent 1260 Infinity HPLC system or a CombiFlash Companion/TS (Teledyne Isco) with a 4 or 12 g reverse phase C18 RediSep Rf Gold column (wavelengths monitored = 220 & 254 nm). Intermediates were identified by their expected m/z using LC-MS. Rupintrivir was purchased from Tocris Bio-Techne. E64d was a gift from American Life Sciences Pharmaceuticals (to Christoph Peters) and Remdesivir was purchased.
Synthesis of internally quenched and fluorogenic substrates.
Fmoc-ACC-OH was synthesized as described48. Standard Fmoc chemistry was performed on Rink AM resin as described47. Internally quenched peptide substrate sequences were synthesized on 2-Chlorotrityl resin using standard Fmoc chemistry as previously described49. Peptides were cleaved from resin using 1,1,1,2,2,2-hexafluoroisopropanol to maintain the protecting groups on the amino acid side chains. After cleavage from the resin, Sulfo-Cy5-COOH (2 eq) was coupled to the free N-terminus by mixing with coupling reagent O-(1H-6-Chlorobenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HCTU) (1.2 eq) and 2,4,6-collidene (1.2 eq) in DMF. The solution of activated acid was added to the amine and agitated at RT overnight. After the reaction went to completion according to LC-MS, the intermediate was purified using preparative reverse phase HPLC. After the purified product was collected and concentrated in vacuo, removal of protecting groups was achieved by dissolving the intermediate in 80:20 TFA:DCM and stirring at RT for 1 h. The reaction was then concentrated in vacuo and the crude material was used without further purification. Coupling of sulfo-QS21-Osu was achieved by dissolving the intermediate in DMSO and DIPEA (1.5 eq) and agitating for 24h at 37 °C. The reaction was then purified using preparative HPLC and fractions were collected and concentrated in vacuo. The residue was dissolved in 1:1 MeCN:H2O (0.1% TFA) and lyophilized to yield the Mpro substrate (1-4) as a blue powder.
Supplementary Material
Synopsis:
Image of SARS-CoV-2 viral life cycle inside a host cell highlighting existing challenges for targeting viral proteases as a therapeutic strategy for COVID-19. Challenges include achieving selectivity of viral protease inhibitors over host proteases, redundancy of protease mediated viral entry pathways, end-product inhibition and difficulty of inhibiting PLpro due to its preference for folded protein substrates . All of these factors increase the likelihood of escape by the virus after protease inhibitor treatment.
ACKNOWLEDGMENTS
We thank members of the Dan Nomura lab at University of California, Berkeley for providing original stocks of the Mpro protease and plasmids; James Powers (University of Georgia), William Roush (The Scripps Research Institute) and Benjamin Cravatt (The Scripps Research Institute) for the directed irreversible inhibitors of cysteine proteases; Joanna Lemieux at University of Alberta for providing GC376 and GC373 compounds; Hong Liu at Shanghai Institute of Materia Medica for providing compounds 11a and 11b; Ania Plaszczyca for initial help to establish the in-cell ELISA SARS-CoV-2 detection protocol; members of the Boris Turk Lab at Jozef Stefan Institute for providing the recombinant cathepsin proteases used in this study. TOC graphic was created with BioRender.com.
FUNDING
This work was funded by the National Institutes of Health grant R01 EB028628 (to M.B.). K.S. was supported by the Dekker-Padget Dutch2USA internship program, Nijbakker-Morra foundation, Dr. Hendrik-Muller foundation and the Radboud individual travel grant. J.C.W. was supported by the American Cancer Society–Grand View League Research Funding Initiative Postdoctoral Fellowship, PF-19-105-01-CCE. B.M.B. was supported by the A. P. Giannini Foundation Postdoctoral Fellowship. R.B. and C.P. were supported by the MWK - Sonderfördermaßnahme COVID-19 Forschung - FR9 and the German Center for Infection Research (DZIF) - TTU Emerging Infections TTU01.806 and TTU01.810.
Footnotes
SUPPORTING INFORMATION AVAILABLE
The main data supporting the results of this study are available withing the paper and its Supporting Information. The raw and analyzed datasets are available upon reasonable request to the corresponding authors.
COMPETING FINANCIAL INTERESTS
The authors declare no competing financial interests
Data Availability.
All data and information necessary to reproduce the results reported in this manuscript are provided. Any additional data that support the findings of this study is available upon reasonable request.
REFERENCES
- (1).Zhou P; Yang X; Lou; Wang XG; Hu B; Zhang L; Zhang W; Si HR; Zhu Y; Li B; Huang CL; Chen HD; Chen J; Luo Y; Guo H; Jiang R. Di; Liu MQ; Chen Y; Shen XR; Wang X; Zheng XS; Zhao K; Chen QJ; Deng F; Liu LL; Yan B; Zhan FX; Wang YY; Xiao GF; Shi ZL A Pneumonia Outbreak Associated with a New Coronavirus of Probable Bat Origin. Nature 2020, 579 (7798), 270–273. 10.1038/s41586-020-2012-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (2).Jin Z; Du X; Xu Y; Deng Y; Liu M; Zhao Y; Zhang B; Li X; Zhang L; Peng C; Duan Y; Yu J; Wang L; Yang K; Liu F; Jiang R; Yang X; You T; Liu X; Yang X; Bai F; Liu H; Liu X; Guddat LW; Xu W; Xiao G; Qin C; Shi Z; Jiang H; Rao Z; Yang H Structure of Mpro from SARS-CoV-2 and Discovery of Its Inhibitors. Nature 2020, 582 (7811), 289–293. 10.1038/s41586-020-2223-y. [DOI] [PubMed] [Google Scholar]
- (3).De Wit E; Van Doremalen N; Falzarano D; Munster VJ SARS and MERS: Recent Insights into Emerging Coronaviruses. Nat Rev Microbiol 2016, 14 (8), 523–534. 10.1038/nrmicro.2016.81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (4).Yang H; Xie W; Xue X; Yang K; Ma J; Liang W; Zhao Q; Zhou Z; Pei D; Ziebuhr J; Hilgenfeld R; Kwok YY; Wong L; Gao G; Chen S; Chen Z; Ma D; Bartlam M; Rao Z Design of Wide-Spectrum Inhibitors Targeting Coronavirus Main Proteases. PLoS Biol 2005, 3 (10). 10.1371/journal.pbio.0030324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (5).Dai W; Zhang B; Jiang XM; Su H; Li J; Zhao Y; Xie X; Jin Z; Peng J; Liu F; Li C; Li Y; Bai F; Wang H; Cheng X; Cen X; Hu S; Yang X; Wang J; Liu X; Xiao G; Jiang H; Rao Z; Zhang LK; Xu Y; Yang H; Liu H Structure-Based Design of Antiviral Drug Candidates Targeting the SARS-CoV-2 Main Protease. Science (80- ) 2020, 368 (6497), 1331–1335. 10.1126/science.abb4489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (6).Zhang L; Lin D; Sun X; Curth U; Drosten C; Sauerhering L; Becker S; Rox K; Hilgenfeld R Crystal Structure of SARS-CoV-2 Main Protease Provides a Basis for Design of Improved a-Ketoamide Inhibitors. Science (80- ) 2020, 368 (6489), 409–412. 10.1126/science.abb3405. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (7).Rut W; Groborz K; Zhang L; Sun X; Zmudzinski M; Pawlik B; Wang X; Jochmans D; Neyts J; Młynarski W; Hilgenfeld R; Drag M SARS-CoV-2 Mpro Inhibitors and Activity-Based Probes for Patient-Sample Imaging. Nat Chem Biol 2020. 10.1038/s41589-020-00689-z. [DOI] [PubMed] [Google Scholar]
- (8).Boras B; Jones RM; Anson BJ; Arenson D; Aschenbrenner L; Bakowski MA; Beutler N; Binder J; Chen E; Eng H; Hammond J; Hoffman R; Kadar EP; Kania R; Kimoto E; Kirkpatrick MG; Lanyon L; Lendy EK; Lillis JR; Luthra SA; Ma C; Noell S; Obach RS; O'Brien MN; O'Connor R; Ogilvie K; Owen D; Pettersson M; Reese MR; Rogers T; Rossulek MI; Sathish JG; Steppan C; Ticehurst M; Updyke LW; Zhu Y; Wang J; Chatterjee AK; Mesecar AD; Anderson AS; Allerton C Discovery of a Novel Inhibitor of Coronavirus 3CL Protease as a Clinical Candidate for the Potential Treatment of COVID-19. bioRxiv 2020, 2020.09.12.293498. [Google Scholar]
- (9).Rut W; Lv Z; Zmudzinski M; Patchett S; Nayak D; Snipas SJ; El Oualid F; Huang TT; Bekes M; Drag M; Olsen SK Activity Profiling and Structures of Inhibitor-Bound SARS-CoV-2-PLpro Protease Provides a Framework for Anti-COVID-19 Drug Design. Sci Adv 2020, No. October, 1–13. 10.1101/2020.04.29.068890. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (10).Freitas BT; Durie IA; Murray J; Longo JE; Miller HC; Crich D; Hogan RJ; Tripp RA; Pegan SD Characterization and Noncovalent Inhibition of the Deubiquitinase and DeISGylase Activity of SARS-CoV-2 Papain-like Protease. ACS Infect Dis 2020. 10.1021/acsinfecdis.0c00168. [DOI] [PubMed] [Google Scholar]
- (11).Ratia K; Pegan S; Takayama J; Sleeman K; Coughlin M; Baliji S; Chaudhuri R; Fu W; Prabhakar BS; Johnson ME; Baker SC; Ghosh AK; Mesecar AD A Noncovalent Class of Papain-like Protease/Deubiquitinase Inhibitors Blocks SARS Virus Replication. Proc Natl Acad Sci U S A 2008, 105 (42), 16119–16124. 10.1073/pnas.0805240105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (12).Lin MH; Moses DC; Hsieh CH; Cheng SC; Chen YH; Sun CY; Chou CY Disulfiram Can Inhibit MERS and SARS Coronavirus Papain-like Proteases via Different Modes. Antiviral Res 2018, 150, 155–163. 10.1016/j.antiviral.2017.12.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (13).Steinmann E; Pietschmann T Hepatitis C Virus: From Molecular Virology to Antiviral Therapy; 2013; Vol. 369. 10.1007/978-3-642-27340-7. [DOI] [Google Scholar]
- (14).Chen S; Hu T; Zhang J; Chen J; Chen K; Ding J; Jiang H; Shen X Mutation of Gly-11 on the Dimer Interface Results in the Complete Crystallographic Dimer Dissociation of Severe Acute Respiratory Syndrome Coronavirus 3C-like Protease. J Biol Chem 2008, 283 (1), 554–564. 10.1074/jbc.M705240200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (15).Hsu M-F; Kuo C-J; Chang K-T; Chang H-C; Chou C-C; Ko T-P; Shr H-L; Chang G-G; Wang AH-J; Liang P-H Mechanism of the Maturation Process of SARS-CoV 3CL Protease. J Biol Chem 2005, 280 (35), 31257–31266. 10.1074/jbc.M502577200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (16).Steinkühler C; Biasiol G; Brunetti M; Urbani A; Koch U; Cortese R; Pessi A; De Francesco R Product Inhibition of the Hepatitis C Virus NS3 Protease. Biochemistry 1998, 37 (25), 8899–8905. 10.1021/bi980313v. [DOI] [PubMed] [Google Scholar]
- (17).Tomlinson SM; Watowich SJ Substrate Inhibition Kinetic Model for West Nile Virus NS2B-NS3 Protease. Biochemistry 2008, 47 (45), 11763–11770. 10.1021/bi801034f. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (18).Chen S; Jonas F; Shen C; Higenfeld R Liberation of SARS-CoV Main Protease from the Viral Polyprotein: N-Terminal Autocleavage Does Not Depend on the Mature Dimerization Mode. Protein Cell 2010, 1 (1), 59–74. 10.1007/s13238-010-0011-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (19).Hoffmann M; Mösbauer K; Hofmann-Winkler H; Kaul A; Kleine-Weber H; Krüger N; Gassen NC; Müller MA; Drosten C; Pöhlmann S Chloroquine Does Not Inhibit Infection of Human Lung Cells with SARS-CoV-2. Nature 2020, 585 (7826), 588–590. 10.1038/s41586-020-2575-3. [DOI] [PubMed] [Google Scholar]
- (20).Dinnon KH; Leist SR; Schäfer A; Edwards CE; Martinez DR; Montgomery SA; West A; Yount BL; Hou YJ; Adams LE; Gully KL; Brown AJ; Huang E; Bryant MD; Choong IC; Glenn JS; Gralinski LE; Sheahan TP; Baric RS A Mouse-Adapted Model of SARS-CoV-2 to Test COVID-19 Countermeasures. Nature 2020, 586 (October). 10.1038/s41586-020-2708-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (21).Ou X; Liu Y; Lei X; Li P; Mi D; Ren L; Guo L; Guo R; Chen T; Hu J; Xiang Z; Mu Z; Chen X; Chen J; Hu K; Jin Q; Wang J; Qian Z Characterization of Spike Glycoprotein of SARS-CoV-2 on Virus Entry and Its Immune Cross-Reactivity with SARS-CoV. Nat Commun 2020, 11 (1). 10.1038/s41467-020-15562-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (22).Hoffmann M; Kleine-Weber H; Schroeder S; Krüger N; Herrler T; Erichsen S; Schiergens TS; Herrler G; Wu NH; Nitsche A; Müller MA; Drosten C; Pöhlmann S SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181 (2), 271–280.e8. 10.1016/j.cell.2020.02.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (23).Shang J; Wan Y; Luo C; Ye G; Geng Q; Auerbach A; Li F Cell Entry Mechanisms of SARS-CoV-2. Proc Natl Acad Sci U S A 2020, 117 (21), 11727–11734. 10.1073/pnas.2003138117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (24).Lukassen S; Chua RL; Trefzer T; Kahn NC; Schneider MA; Muley T; Winter H; Meister M; Veith C; Boots AW; Hennig BP; Kreuter M; Conrad C; Eils R SARS -CoV-2 Receptor ACE 2 and TMPRSS 2 Are Primarily Expressed in Bronchial Transient Secretory Cells . EMBO J 2020, 39 (10), 1–15. 10.15252/embj.20105114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (25).Zhou Y; Vedantham P; Lu K; Agudelo J; Carrion R; Nunneley JW; Barnard D; Pöhlmann S; McKerrow JH; Renslo AR; Simmons G Protease Inhibitors Targeting Coronavirus and Filovirus Entry. Antiviral Res 2015, 116, 76–84. 10.1016/j.antiviral.2015.01.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (26).Palmer JT; Rasnick D; Klaus JL; Brömme D Vinyl Sulfones as Mechanism-Based Cysteine Protease Inhibitors. J Med Chem 1995, 38 (17), 3193–3196. 10.1021/jm00017a002. [DOI] [PubMed] [Google Scholar]
- (27).Bittmann S COVID 19: Camostat and The Role of Serine Protease Entry Inhibitor TMPRSS2. J Regen Biol Med 2020, 2 (2), 1–2. 10.37191/mapsci-2582-385x-2(2)-020. [DOI] [Google Scholar]
- (28).Gordon DE; Jang GM; Bouhaddou M; Xu J; Obernier K; White KM; O’Meara MJ; Rezelj VV; Guo JZ; Swaney DL; Tummino TA; Hüttenhain R; Kaake RM; Richards AL; Tutuncuoglu B; Foussard H; Batra J; Haas K; Modak M; Kim M; Haas P; Polacco BJ; Braberg H; Fabius JM; Eckhardt M; Soucheray M; Bennett MJ; Cakir M; McGregor MJ; Li Q; Meyer B; Roesch F; Vallet T; Mac Kain A; Miorin L; Moreno E; Naing ZZC; Zhou Y; Peng S; Shi Y; Zhang Z; Shen W; Kirby IT; Melnyk JE; Chorba JS; Lou K; Dai SA; Barrio-Hernandez I; Memon D; Hernandez-Armenta C; Lyu J; Mathy CJP; Perica T; Pilla KB; Ganesan SJ; Saltzberg DJ; Rakesh R; Liu X; Rosenthal SB; Calviello L; Venkataramanan S; Liboy-Lugo J; Lin Y; Huang XP; Liu YF; Wankowicz SA; Bohn M; Safari M; Ugur FS; Koh C; Savar NS; Tran QD; Shengjuler D; Fletcher SJ; O’Neal MC; Cai Y; Chang JCJ; Broadhurst DJ; Klippsten S; Sharp PP; Wenzell NA; Kuzuoglu-Ozturk D; Wang HY; Trenker R; Young JM; Cavero DA; Hiatt J; Roth TL; Rathore U; Subramanian A; Noack J; Hubert M; Stroud RM; Frankel AD; Rosenberg OS; Verba KA; Agard DA; Ott M; Emerman M; Jura N; von Zastrow M; Verdin E; Ashworth A; Schwartz O; D’Enfert C; Mukherjee S; Jacobson M; Malik HS; Fujimori DG; Ideker T; Craik CS; Floor SN; Fraser JS; Gross JD; Sali A; Roth BL; Ruggero D; Taunton J; Kortemme T; Beltrao P; Vignuzzi M; García-Sastre A; Shokat KM; Shoichet BK; Krogan NJ A SARS-CoV-2 Protein Interaction Map Reveals Targets for Drug Repurposing. Nature 2020, 583 (7816), 459–468. 10.1038/s41586-020-2286-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (29).Backus KM; Correia BE; Lum KM; Forli S; Horning BD; González-Páez GE; Chatterjee S; Lanning BR; Teijaro JR; Olson AJ; Wolan DW; Cravatt BF Proteome-Wide Covalent Ligand Discovery in Native Biological Systems. Nature 2016, 534 (7608), 570–574. 10.1038/nature18002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (30).Arastu-Kapur S; Ponder EL; Fonović UP; Yeoh S; Yuan F; Fonović M; Grainger M; Phillips CI; Powers JC; Bogyo M Identification of Proteases That Regulate Erythrocyte Rupture by the Malaria Parasite Plasmodium Falciparum. Nat Chem Biol 2008, 4 (3), 203–213. 10.1038/nchembio.70. [DOI] [PubMed] [Google Scholar]
- (31).Lee TW; Cherney MM; Huitema C; Liu J; James KE; Powers JC; Eltis LD; James MNG Crystal Structures of the Main Peptidase from the SARS Coronavirus Inhibited by a Substrate-like Aza-Peptide Epoxide. J Mol Biol 2005. 10.1016/j.jmb.2005.09.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (32).Ma C; Hu Y; Townsend JA; Lagarias PI; Marty MT; Kolocouris A; Wang J Ebselen, Disulfiram, Carmofur, PX-12, Tideglusib, and Shikonin Are Nonspecific Promiscuous SARS-CoV-2 Main Protease Inhibitors. ACS Pharmacol Transl Sci 2020. 10.1021/acsptsci.0c00130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (33).Zhu Y; Chidekel A; Shaffer TH Cultured Human Airway Epithelial Cells (Calu-3): A Model of Human Respiratory Function, Structure, and Inflammatory Responses. Crit Care Res Pract 2010, 2010, 1–8. 10.1155/2010/394578. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (34).Hamilton KO; Backstrom G; Yazdanian MA; Audus KL P-Glycoprotein Efflux Pump Expression and Activity in Calu-3 Cells. J Pharm Sci 2001, 90 (5), 647–658. . [DOI] [PubMed] [Google Scholar]
- (35).Bestle D; Heindl MR; Limburg H; van Lam van T; Pilgram O; Moulton H; Stein DA; Hardes K; Eickmann M; Dolnik O; Rohde C; Klenk HD; Garten W; Steinmetzer T; Böttcher-Friebertshôuser E TMPRSS2 and Furin Are Both Essential for Proteolytic Activation of SARS-CoV-2 in Human Airway Cells. Life Sci Alliance 2020, 3 (9), 1–14. 10.26508/LSA.202000786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (36).Mellott Drake M., 1 Tseng Chien-Te, 3 Drelich Aleksandra, 3 Fajtová Pavla, 4, 5 Chenna Bala C., 1 Kostomiris Demetrios H.1, Hsu Jason, 3 Zhu Jiyun, 1 Taylor Zane W., 2, 9 Tat Vivian, 3 Katzfuss Ardala, 1 Li Linfeng, 1 Giardini Miriam A., 4 Skinn Danielle. A Cysteine Protease Inhibitor Blocks SARS-CoV-2 Infection of Human and Monkey Cells. bioRxiv 2020, 20 (4). [DOI] [PMC free article] [PubMed] [Google Scholar]
- (37).Edgington-Mitchell LE; Bogyo M; Verdoes M Live Cell Imaging and Profiling of Cysteine Cathepsin Activity Using a Quenched Activity-Based Probe. Methods Mol Biol 2017, 1491, 145–159. 10.1007/978-1-4939-6439-0_11. [DOI] [PubMed] [Google Scholar]
- (38).Withana NP; Saito T; Ma X; Garland M; Liu C; Kosuge H; Amsallem M; Verdoes M; Ofori LO; Fischbein M; Arakawa M; Cheng Z; McConnell MV; Bogyo M Dual-Modality Activity-Based Probes as Molecular Imaging Agents for Vascular Inflammation. J Nucl Med 2016, 57 (10), 1583–1590. 10.2967/jnumed.115.171553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (39).Van Der Linden WA; Schulze CJ; Herbert AS; Krause TB; Wirchnianski AA; Dye JM; Chandran K; Bogyo M Cysteine Cathepsin Inhibitors as Anti-Ebola Agents. ACS Infect Dis 2016, 2 (3), 173–179. 10.1021/acsinfecdis.5b00130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (40).Verdoes M; Bender KO; Segal E; Van Der Linden WA; Syed S; Withana NP; Sanman LE; Bogyo M Improved Quenched Fluorescent Probe for Imaging of Cysteine Cathepsin Activity. J Am Chem Soc 2013. 10.1021/ja4056068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (41).Telpoukhovskaia MA; Liu K; Sayed FA; Etchegaray JI; Xie M; Zhan L; Li Y; Zhou Y; Le D; Bahr BA; Bogyo M; Ding S; Gan L Discovery of Small Molecules That Normalize the Transcriptome and Enhance Cysteine Cathepsin Activity in Progranulin-Deficient Microglia. Sci Rep 2020, 10 (1), 1–12. 10.1038/s41598-020-70534-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (42).Westberg M; Su Y; Zou X; Ning L; Hurst B; Tarbet B; Lin MZ Rational Design of a New Class of Protease Inhibitors for the Potential Treatment of Coronavirus Diseases. bioRxiv 2020, 2020.09.15.275891. 10.1101/2020.09.15.275891. [DOI] [Google Scholar]
- (43).Ma C; Sacco MD; Hurst B; Townsend JA; Hu Y; Szeto T; Zhang X; Tarbet B; Marty MT; Chen Y; Wang J Boceprevir, GC-376, and Calpain Inhibitors II, XII Inhibit SARS-CoV-2 Viral Replication by Targeting the Viral Main Protease. Cell Res 2020, 30 (8), 678–692. 10.1038/s41422-020-0356-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (44).Xie X; Muruato AE; Zhang X; Lokugamage KG; Fontes-Garfias CR; Zou J; Liu J; Ren P; Balakrishnan M; Cihlar T; Tseng CTK; Makino S; Menachery VD; Bilello JP; Shi PY A Nanoluciferase SARS-CoV-2 for Rapid Neutralization Testing and Screening of Anti-Infective Drugs for COVID-19. Nat Commun 2020, 11 (1), 1–11. 10.1038/s41467-020-19055-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (45).Xue X; Yang H; Shen W; Zhao Q; Li J; Yang K; Chen C; Jin Y; Bartlam M; Rao Z Production of Authentic SARS-CoV Mpro with Enhanced Activity: Application as a Novel Tag-Cleavage Endopeptidase for Protein Overproduction. J Mol Biol 2007. 10.1016/j.jmb.2006.11.073. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (46).Klein S; Cortese M; Winter S; Wachsmuth-Melm M; Neufeldt C; Cerikan B; Stanifer M; Boulant S; Bartenschlager R; Chlanda P SARS-CoV-2 Structure and Replication Characterized by in Situ Cryo-Electron Tomography. Nat Commun 2020, 1–10. 10.1101/2020.06.23.167064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (47).Ofori LO; Withana NP; Prestwood TR; Verdoes M; Brady JJ; Winslow MM; Sorger J; Bogyo M Design of Protease Activated Optical Contrast Agents That Exploit a Latent Lysosomotropic Effect for Use in Fluorescence-Guided Surgery. ACS Chem Biol 2015, 10 (9), 1977–1988. 10.1021/acschembio.5b00205. [DOI] [PMC free article] [PubMed] [Google Scholar]
- (48).Maly DJ; Leonetti F; Backes BJ; Dauber DS; Harris JL; Craik CS; Ellman JA Expedient Solid-Phase Synthesis of Fluorogenic Protease Substrates Using the 7-Amino-4-Carbamoylmethylcoumarin (ACC) Fluorophore. J Org Chem 2002, 67 (3), 910–915. 10.1021/jo016140o. [DOI] [PubMed] [Google Scholar]
- (49).Bollhagen R; Schmiedberger M; Barlos K; Grell E Chloride Resin. J Chem Soc, Chem Commun 1994, 2559. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data and information necessary to reproduce the results reported in this manuscript are provided. Any additional data that support the findings of this study is available upon reasonable request.
