Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Apr 1.
Published in final edited form as: Brain Res. 2021 Jan 27;1756:147280. doi: 10.1016/j.brainres.2021.147280

Norepinephrine inhibits migration and invasion of human glioblastoma cell cultures possibly via MMP-11 inhibition

Jing Zhong 1,2, Weiran Shan 1, Zhiyi Zuo 1
PMCID: PMC7904089  NIHMSID: NIHMS1667263  PMID: 33515535

Abstract

Purpose:

Growing evidence has shown that the stress hormones affect tumor progression. Patients with surgery to remove tumor often have increased norepinephrine during the perioperative period. However, the effect of norepinephrine on the progression of glioblastoma has not yet studied. Therefore, the present study aimed at investigating the effects of norepinephrine on the migration and invasion of the human glioblastoma U87 and U251 cell lines and the mechanism for the effects.

Methods:

The U87 and U251 cells were treated with 0, 0.1, 1, 5, 10 or 50 μM norepinephrine. A scratch wound healing assay and a transwell invasion assay were used to investigate cell migration and invasion, respectively. The Human Tumor Metastasis RT2 Profiler PCR Array was used to detect the expression of 84 genes known to be involved in metastasis.

Results:

Following norepinephrine treatment, the ability of the U87 and U251 cells to migrate and invade was significantly decreased. Human Tumor Metastasis RT2 Profiler PCR Array assay showed that matrix metallopeptidase-11 (MMP-11) was decreased following norepinephrine treatment. The β-adrenergic receptor blocker (AR) propranolol blunted the suppressive effect of norepinephrine on the migration and invasion of U251 cells but did not have such an effect on the invasion of U87 cells. MMP-11 silencing inhibited the migration and invasion of U87 and U251 cells. The Cancer Genome Atlas data showed that patients with higher expression of MMP-11 in the glioblastoma tissues had poorer prognosis.

Conclusion:

Our results indicate that norepinephrine inhibits the migration and invasion of human glioblastoma cells. This effect may be mediated by the decrease of MMP-11. β-AR may be a regulatory factor for this effect in U251 cells.

Keywords: stress neurotransmitter, norepinephrine, migration and invasion, human glioblastoma cells

Introduction

Tumor cell migration, a prerequisite for metastasis development, is regulated by signaling substances of the environment including neuroendocrine stress hormones [1]. Perioperative stress leads to an activation of the sympathetic nervous system and release of neuroendocrine stress hormones, such as dopamine, epinephrine and norepinephrine. Evidence suggests that excessive perioperative activation of the sympathetic nervous system, the consequent release of catecholamines in the context of cancer surgery and inflammation may significantly facilitate prometastatic processes [2]. A previous study has shown that it is local invasion and distant metastasis that kill patients rather than excessive cell proliferation per se [3]. However, till now little is known about how the neuroendocrine system in its function as the superordinate regulatory organ of the body modulates the immune system. This is due to the complexity of both organ systems and their multilayer interaction [4].

The neurotransmitter gamma-aminobutyric acid (GABA) is an inhibitory regulator for the migration of SW 480 colon carcinoma cells [5]. GABA reduced the norepinephrine-induced migratory activity of these cells within a three-dimensional collagen matrix to spontaneous migration levels [5]. Walker et al. showed that circulating epinephrine is not required for chronic stress to enhance metastasis, suggesting a possible role for norepinephrine release from sympathetic nerve terminals in this effect [6]. Norepinephrine is of particular interest, since it is not only locally released from sympathetic nerve cells, but is also systemically disseminated after release from the adrenal gland [7]. The growing evidence from laboratory and clinical studies has shown that the stress hormone norepinephrine affects tumor progression in a variety of tumor types [7, 8]. Norepinephrine promotes hepatic stellate cell (HSCs-T6) activation, proliferation and secretion of extracellular matrix in vitro [7]. Strell and colleagues reported that norepinephrine is the most potent physiologic inducer of the migration of breast [9], colon [10], and prostate carcinoma cells [11] in vitro. However, human ES-2 ovarian carcinoma cells have a reduced migratory activity after norepinephrine treatment [12]. This inhibitory effect is possibly mediated by a cAMP-dependent activation of the small GTPase ras-related protein (Rap) 1 via exchange factor directly activated by cAMP (Epac) [12].

Glioblastoma is the most common malignant tumor in the brain [13] and has a recurrence rate of more than 90% [14]. Tumor resection followed by radiotherapy and temozolomide treatment is the current standard therapy for glioma. However, the majority of patients with glioma exhibit tumor progression within two years of diagnosis [15–17]. Glioblastoma is in need of innovative treatment approaches. Up to now, the effect of norepinephrine on the migration and invasion of glioblastoma has not yet been studied. The present study aims at investigating whether norepinephrine affects the migratory and invasive activity of glioblastoma cells and the mechanism for the effect.

Results:

The migratory and invasive ability of the glioblastoma cells was decreased following norepinephrine treatment

Wound Healing Assay was used to assess the migration of U87 and U251 glioblastoma cells. Following a 12-h treatment with 10 or 50 μM and 24-h treatment with 5, 10 or 50 μM norepinephrine, the migration of the U87 cells was significantly decreased compared with that of the control group (P < 0.05) (Fig. 1a). Following a 12-h and 24-h treatment with 5, 10 or 50 μM norepinephrine, the migration of the U251 cells was significantly decreased compared with that of the control group (P < 0.05) (Fig. 1b). Matrigel Invasion Assay was used to assess the invasion of U87 and U251 glioblastoma cells. Following a 24-h treatment with 5, 10 or 50 μM norepinephrine, the invasive ability of the U87 and U251 cells was significantly decreased compared with that of the control group (P < 0.05) (Fig. 1c). A dose-effect curve of norepinephrine on the invasive ability of U87 cells indicates that 10 μM norepinephrine was the concentration to maximize the effects (Fig. 1d).

Fig. 1. Effect of norepinephrine on the migratory and invasive ability of U87 and U251.

Fig. 1.

Open in a new tab

(a, b) Distance to migrate (mm) of U87 (a) and U251 (b) cells following treatment with various concentrations of norepinephrine for 12 h and 24 h. (c) Number of glioblastoma cells that had invaded following treatment with different concentrations of norepinephrine for 24 h. (d) Dose-effect curve of norepinephrine on the invasive ability of U87 cells. *P < 0.05 vs. control group (n = 4).

Nine genes were significantly down-regulated after norepinephrine treatment

The Human Tumor Metastasis RT2 Profiler™ PCR Array that contained probes for 84 key genes involved in human metastasis was used to determine the expression of genes. Nine genes were found to be significantly downregulated in the U251 cell lines with 10 μM norepinephrine treatment for 24 h compared with the untreated control cells as shown in Table 1 (P < 0.05).

Table 1.

Down-regulated tumor metastasis genes after norepinephrine treatment in U251 cells.

Gene Symbol AVG ΔCt (Ct(GOI) - Ave Ct (HKG)) 2^-ΔCt Fold Change T-TEST
Norepinephrine Control Norepinephrine Control Norepinephrine/ control p value
CD82 8.27 7.86 3.2E-03 4.3E-03 0.76 0.03623
CDH11 5.61 5.43 2.0E-02 2.3E-02 0.88 0.00791
CHD4 4.25 3.96 5.3E-02 6.4E-02 0.82 0.02822
FAT1 5.96 5.72 1.6E-02 1.9E-02 0.84 0.03296
MCAM 5.78 5.48 1.8E-02 2.2E-02 0.81 0.02057
MMP11 10.05 9.73 9.4E-04 1.2E-03 0.80 0.03478
SRC 9.41 9.00 1.5E-03 2.0E-03 0.75 0.00558
TCF20 7.12 6.88 7.2E-03 8.5E-03 0.84 0.03476
TSHR 11.46 10.75 3.5E-04 5.8E-04 0.61 0.00945
Open in a new tab

CDH11: Cadherin 11, CHD4: Chromodomain Helicase DNA Binding Protein 4, FAT1: FAT Atypical Cadherin 1, MCAM: Melanoma Cell Adhesion Molecule, MMP11: Matrix Metallopeptidase 11, SRC: SRC Proto-Oncogene (Non-Receptor Tyrosine Kinase), TCF20: Transcription Factor 20, TSHR: Thyroid Stimulating Hormone Receptor.

Norepinephrine inhibited the expression of matrix metallopeptidase-11 (MMP-11) in glioblastoma cells.

Among the nine downregulated genes in the U251 cell lines following norepinephrine treatment, the expression of thyroid stimulating hormone receptor (TSHR), SRC proto-oncogene non-receptor tyrosine kinase (SRC) and MMP-11 was analyzed by qRT-PCR. The mRNA expression of MMP-9 was also investigated. Following 10 μM norepinephrine treatment, the MMP-11 mRNA level was significantly down-regulated (P = 0.00454) in U87 cells (Fig. 2a). However, the MMP-11 mRNA level did not change significantly in U251 cells (P = 0.05672) (Fig. 2b). There was no significant difference in TSHR, SRC and MMP-9 mRNA levels between norepinephrine and control group in both U87 and U251 cells (Figs. 2a and 2b).

Fig. 2. Effect of norepinephrine on the expression of TSHR, SRC, MMP-11 and MMP-9 in U87 and U251 glioblastoma cells.

Fig. 2.

Open in a new tab

(a, b) The expressions of TSHR, SRC, MMP-11 and MMP-9 after treatment with 0 or 10 μM norepinephrine in U87 (a) and U251 (b) cells measured by qRT-PCR. (c, d) Effect of 0, 1, 5, 10 and 50 μM norepinephrine on the expression levels of MMP-11 in U87 cells as measured by Western blotting with representative images in (c) and quantitative data in (d). *P<0.05, **P<0.01 vs. control group (n = 4).

We next investigated the expression levels of MMP-11 following treatment with different concentrations of norepinephrine in U87 cells by Western blotting. The MMP-11 levels were decreased with the increase of norepinephrine concentrations. The MMP-11 levels were significantly decreased after 10 and 50 μM norepinephrine treatment compared with that of the control (P < 0.05) (Figs. 2c and 2d).

MMP-11 knockdown reduced the migratory and invasive ability of the glioblastoma cells.

The effect of MMP-11 on the migratory and invasive ability of the glioblastoma cells was examined in U87 and U251 cells by using MMP-11 siRNA. The efficiency of MMP-11 silencing by its siRNA was shown by Western blotting (Fig. 3a). Following 24-h and 48-h treatment with MMP-11 siRNA, the migratory ability of the U87 cells was significantly decreased compared with that of the non-targeting (NT) siRNA group and the control group (P < 0.05) (Figs. 3b and 3c). Following a 24-h treatment with MMP-11 siRNA, the invasive ability of the U87 and U251 cells was significantly decreased compared with that of the NT siRNA group (P < 0.05) (Figs. 3d and 3e). The migratory and invasive ability of the U87 and U251 cells in the MMP-11 siRNA transfection group did not differ significantly from that in the norepinephrine treatment group (P > 0.05).

Fig. 3. MMP-11 knockdown reduced the migration and invasion of U87 cells.

Fig. 3.

Open in a new tab

(a) U87 cells were transfected with 100 pM NT RNA or 100 pM MMP-11 siRNA. 24 h and 48 h after the transfection, cells were harvested for Western blotting. (b) Representative images of U87 (magnification, x40) following treatment with vehicle, 100 pM NT siRNA, 100 pM MMP-11 siRNA or 10 μM norepinephrine for 24 h and 48 h in Wound Healing Assay. (c) Distance to migrate (mm) of glioblastoma cells. (d) Representative images of U87 and U251 cells (magnification, x200) following treatment with vehicle, 100 pM NT RNA, 100 pM MMP-11 siRNA or 10 μM norepinephrine for 24 h in Matrigel Invasion Assay. (e) Number of U251 and U87 glioblastoma cells that had invaded. *P < 0.05 vs. control group, #P < 0.05 vs. NT siRNA group (n = 4).

β-antagonist propranolol blunted the suppressive effect of norepinephrine on the migration and invasion of glioblastoma cells

The β−1 and β−2 adrenergic receptors (ARs) were verified to be expressed in U251 glioblastoma cells through qRT-PCR (Fig. 4a). The β-AR antagonist propranolol and the β1-AR selective blocker atenolol were used in this study. Following treatment with atenolol plus norepinephrine or norepinephrine only for 24 h, the migratory and invasive ability of the U251 cells were significantly decreased compared with that of the control group (P < 0.05). Following the treatment with propranolol plus norepinephrine, the migratory and invasive ability of the U251 cells were significantly increased compared with that of the norepinephrine only group (P < 0.05). The migratory and invasive ability of the U251 cells did not differ significantly between the propranolol plus norepinephrine group and the control group, and between the atenolol plus norepinephrine group and the norepinephrine group (P > 0.05) (Fig. 4). However, the migratory and invasive ability of the U87 cells did not differ significantly between the propranolol or atenolol plus norepinephrine group and the norepinephrine only group (P > 0.05) (Fig. 4). These results indicated that propranolol but not atenolol blunted the suppressive effect of norepinephrine on the migration and invasion of U251 glioblastoma cells.

Fig. 4. The effect of β-antagonist on the migratory and invasive ability of glioblastoma cells.

Fig. 4.

Open in a new tab

(a) Relative expression of mRNA of β1-AR, β2-AR and GAPDH measured by qRT-PCR in U251 and U87 cells. (b, c) Representative images of U251 or U87 cells following treatment with vehicle, 10 μM propranolol, 10 μM atenolol, 10 μM norepinephrine, 10 μM norepinephrine + 10 μM propranolol or 10 μM norepinephrine + 10 μM atenolol for 12 h and 24 h in Wound Healing Assay (b) (magnification, x4); for 24 h in Matrigel Invasive Assay (c) (magnification, x200). (d) Distance to migrate (mm) of U251 cells. (e) Number of U251 and U87 cells that had invaded. *P < 0.05 vs. control group (n = 4). #P < 0.05 vs. norepinephrine group (n = 4).

MMP-11 overexpression predicted poor prognosis in glioblastoma patients

We used RNA-Seq and corresponding clinical data downloaded from The Cancer Genome Atlas (TCGA) and analyzed the correlations between the prognosis in glioblastoma patients and the expressions of TSHR, SRC, MMP-9, MMP-11 and β ARs. The database was accessed on August 21th and September 5th, 2020. Patients with higher expression of MMP-11 suffered from poorer prognosis compared with patients who had lower expression of MMP-11 (P < 0.05, Fig. 5A). However, the expression of TSHR, SRC, MMP-9 and β ARs was not related to the prognosis of the patients with glioblastoma (Figs. 5B to 5F). These results support our findings from glioblastoma cell cultures: MMP-11 may facilitate the migration and invasion of glioblastoma cells.

Fig. 5. Association of MMP-11 expression and the survival rate of patients with glioblastoma.

Fig. 5.

Open in a new tab

Kaplan–Meier survival curves were presented to show the relationships. (A) Cases with higher matrix metallopeptidase (MMP)-11 expression had a shorter overall survival (OS) (P = 0.029), n = 81. (B-D) The difference in OS between patients with low or high expression of β−1 adrenergic receptor (ADRB1) (B), β−2 adrenergic receptor (ADRB2) (C) and Thyroid Stimulating Hormone Receptor (TSHR) (D), SRC Proto-Oncogene (SRC) (E) or MMP-9 (F).

Discussion:

Cancer cell invasion and metastasis are two features of malignancy [18]. The role of norepinephrine in tumor cell migration and invasion is controversial. Some studies found that norepinephrine induced the adhesion of activated CD8+ T cells [19], promoted the β1-integrin–mediated adhesion of human breast carcinoma cells to vascular endothelium by the induction of a human growth-regulated oncogene αrelease [19] and impaired the cytotoxicity of natural killer cells [20]. However, one study showed that the inhibitory effect of norepinephrine on the migration of ES-2 ovarian carcinoma cells involved a Rap1-dependent pathway[12]. Stock and colleagues have found that the inhibitory effect of norepinephrine on pancreatic cancer cells is due to an imbalanced activation of the two pathways: the activation of a pathway which causes a strong increase of the secondary cell signaling molecule, cAMP, and the activation of phospholipase C gamma and the downstream protein kinase C alpha that is already activated in pancreatic cancer cells and cannot be further activated by norepinephrine [21]. In our study, norepinephrine showed an inhibitory effect on the migration and invasion of glioblastoma cells, indicating that norepinephrine has divergent effects on cancer cells, probably depending on the types of cancer. In this case, perioperative stress leading to an activation of the sympathetic nervous system and release of neuroendocrine stress hormones like norepinephrine may be beneficial in inhibiting the migration and invasion of glioblastoma cells.

Several neurotransmitters (norepinephrine, dopamine and substance P) have been found to directly influence the migratory activity and invasiveness of tumor cells and, thus, do not need the immune system as a mediator [22, 23]. The presence of neurotransmitter receptors in tumor cells, and the propensity of neurotransmitters to aid in the invasion of tumor cells have been shown by a few studies [24]. Spiegel and colleagues have shown a direct influence of dopamine, epinephrine and norepinephrine on human CD34+ progenitor cells, which dynamically express receptors for these neurotransmitters in stress-induced situations [25]. β-AR antagonists were reported to affect the influence of stress hormones. The use of β-AR blockers significantly reduced the risk of death among women with breast cancer [27, 28] and patients with melanoma [29]. The norepinephrine-driven metastasis development of PC-3 human prostate cancer cells in the BALB/c nude mice is also inhibited by β-AR blockers [1]. However, β-AR blockers (both sub-type selective and non-selective) did not show beneficial impact during primary treatment in epithelial ovarian cancer patients [30]. In this study, β1 and β2 ARs were detected in U251 cells. Furthermore, the β-AR antagonist propranolol was found to blunt the suppressive effect of norepinephrine on the migration and invasion of U251 cells. However, this effect did not occur following treatment with atenolol, a β1 antagonist, indicating that β2-ARs may be involved in the effect of norepinephrine on glioblastoma cells. The promigratory effect has been reported to be mediated by the β2-AR in colon [10], breast [9] and prostate [26] carcinoma cells because the failure of the β1-AR antagonist atenolol on this effect. The use of β-AR blockers was suggested for the inhibition of metastasis formation for prostate cancer cells whose migration was increased by norepinephrine [1]. However, organ-specific differences haves to be considered because beta-blockers may have tumor promoting effects in glioblastoma. Wang and colleagues have shown that the expression of CD147 that plays an important role in the invasion and metastasis of glioblastoma cells is up-regulated by norepinephrine via the β-AR - β-arrestin1- extracellular regulated protein kinases (ERK)1/2-specificity protein 1 (Sp1)pathway in U87 cells [31]. The implication of β-AR in this effect is because propranolol blocks the effect of norepinephrine. However, β1 and β2 ARs were not detected in U87 cells in our study and a previous study [32]. Therefore, other receptors/signaling mechanisms may be responsible for the inhibitory effect of propranolol in these cells.

Not only direct effects of the adrenergic signaling on the tumor cells but also indirect effects on cells of the tumor environment might promote metastasis formation [33]. Glioblastoma cells have been found to release chemokines that attract regulatory T Cells (Tregs) to the tumor micro-environment [34] via C-C motif chemokine ligand 2 (CCL2) [35]. Epidermal growth factor receptor promotes glioma progression by regulating -subunit of system xc(−) at the cell surface and GluN2B-containing N-methyl-D-aspartate-sensitive glutamate receptor signaling [36]. The biological processes of cancer cells, such as tumorigenesis, proliferation, angiogenesis, apoptosis and invasion are greatly influenced by the surrounding microenvironment [37]. Catecholamine enhances the production of vascular endothelial growth factor, MMP-2 and MMP-9, and increased tumor angiogenesis and growth in various cancers including ovarian, nasopharyngeal, prostate, colon and pancreatic cancer [27]. MMPs are a family of zinc-dependent endopeptidases with the capacity of remodeling extracellular matrix (ECM) by degrading almost all ECM proteins, which plays essential roles during the invasion and metastasis process of solid malignant tumors. The high invasion of glioblastoma is facilitated by the expression of MMPs [38]. MMP-2 is known to have a role in cancer progression in brain cancer by aiding extracellular matrix degradation [39]. The inhibition of glioma cell invasion by all-trans retinoic acid may be partially associated with its effect of downregulating MMP-2 and MMP-9 expression [40]. MMP-11, also named stromelysin-3, is a member of the stromelysin subgroup belonging to MMPs superfamily, which has been detected in cancer cells, stromal cells and adjacent microenvironment [37]. MMP-11 exerts a dual effect on tumors: MMP-11 promotes cancer development by inhibiting apoptosis and enhances migration and invasion of cancer cells but MMP-11 also suppresses metastasis in animal models [37]. In addition, MMP-11 was found to promote papillary thyroid cell proliferation and invasion [41] and the oral cancer migration [42]. MMP-11 mediates the migration and invasion induced by Gli1 in the human breast cancer cell line MDA-MB-231[43]. The results of a previous study showed that siRNA targeted at MMP-11 significantly impeded mouse hepatocarcinoma cell (Hca-F) proliferation and colony formation in soft agar, as well as increased apoptosis of these cells. This reduction of MMP-11 expression also led to the decreased migration and adhesion of Hca-F cells dramatically both in vitro and in vivo [44]. In this study, we showed that the expression of MMP-11 was declined in both U87 and U251 cells after norepinephrine treatment and that MMP-11 knockdown reduced the migratory and invasive ability of the U87 and U251 cells. Moreover, human TCGA database suggests that MMP-11 overexpression predicts poor prognosis in glioblastoma patients, indicating potential implication of our findings on norepinephrine in humans. Thus, the overexpression of MMP-11 may be a mechanism for the progression of glioblastoma. These results also show us that the decrease of MMP-11 may be the downstream molecular mechanism for norepinephrine to inhibit the migration and invasion of glioblastoma cells. MMP-11 may act as a novel target for the inhibition of glioblastoma cell migration and invasion.

There exists a relationship between β-AR and MMP family. Menon and colleagues have shown that inhibition of MMP-2 inhibits β-ARs-stimulated apoptosis and that MMP-2 interferes with the β1 integrin survival signals and activates c-Jun N-terminal kinase (JNK)-dependent mitochondrial death pathway leading to apoptosis [45]. Jaffré and colleagues have demonstrated that β-AR stimulation leads to MMP-13 transactivation of the protease-activated receptor 1 in both cardiac fibroblasts and cardiomyocytes [46]. In this study, the β-AR blocker propranolol blocked the effect of norepinephrine on the migration and invasion of U251 cells and MMP-11 silencing had an effect similar to that of norepinephrine on the migration and invasion of U251 cells, indicating a possible link between β-AR and MMP-11.

Newburgh and colleagues have reported that the addition of norepinephrine to glioblastoma cell cultures results in an inhibition of uptake of D-[2−(3)H]glucose, D-[1-(14)C]glucose, D-[2-(14)C]glucose and D-[6-(14)C]glucose [47]. Glioblastomas are characterized by the metabolic shift towards aerobic glycolysis, rapid proliferation and acquisition of the migratory and invasive phenotype, which enhance tumor angiogenesis [48, 49]. Glycolysis enzymes were elevated in migrating glioblastoma cells; whereas pentose phosphate pathway enzymes were diminished [50]. It is conceivable that the effects of norepinephrine on cell metabolism including inhibition of glucose uptake may inhibit the migration and invasion of glioblastoma cells, a finding observed in our study. However, it is not clear whether these metabolic effects on glioblastoma cells are downstream of β-AR activation.

Glioblastomas frequently invade supratentorial brain regions that are richly innervated by various projections [51]. Norepinephrine, a common neurotransmitter, is not only locally released from sympathetic nerve termini, but is also systemically disseminated after being released from the adrenal gland [7]. Moreover, epinephrine release from the adrenal gland stimulates vagus nerve signaling to the locus coeruleus, enhancing norepinephrine release in the brain and astrocytic and neuronal metabolism to facilitate glucose utilization [52]. These complex interactions and network would suggest that glioblastoma cells may be exposed to norepinephrine under in vivo conditions, especially during perioperative period when sympathetic tone is high. The cells that many be exposed to norepinephrine are those glioblastoma cells that are in penumbral regions of the tumor, in the blood or in a proximity to the tumor mass. These cells may be the main cells to migrate and invade to other tissues or locations.

Our findings may have therapeutic implications. Appropriate response including sympathetic discharge may be beneficial in reducing the migration and invasion of glioblastoma. More importantly, our findings from glioblastoma cell cultures and human data indicate that MMP-11 may be an important molecular target to improve the outcome of patients with glioblastoma. Effective measures may be developed to inhibit the expression of MMP-11 in glioblastoma cells or neutralize MMP-11 in the tumor areas to reduce the migration and invasion of glioblastoma cells.

Our study has limitations. The receptors mediating the effect of norepinephrine on U87 cells need further study. We could not detect any expression of β-AR in these cells, the β-AR blocker propranolol did not affect the inhibition of norepinephrine on the invasion of U87 cells. These results do not suggest a role of β-AR in the norepinephrine effects on U87 cells. Also, we did not perform in vivo animal experiments and it is not appropriate to extrapolate our findings to in vivo conditions. However, the human TCGA data suggests a detrimental effect of MMP-11 in patients with glioblastoma, which is consistent with our finding that MMP-11 plays a critical role in the migration and invasion of glioblastoma cells. These results suggest that our findings form cell cultures may be applicable under in vivo conditions.

In the present study, we demonstrated that norepinephrine possibly via the reduction of MMP-11 expression inhibited the migration and invasion of the glioblastoma U251 and U87 cells. β-ARs may contribute to the regulation of this effect in U251 cells. Consistent with these findings, overexpression of MMP-11 predicts poorer prognosis in patients with glioblastoma.

Methods and materials:

Wound Healing Assay

Malignant brain tumor cell lines, U251 and U87, obtained from Dr. Abounader’s laboratory (University of Virginia Health System, Charlottesville, USA) were cultured in six-well plates for 12 h and 24 h. Cell migration was measured by using a Wound Healing Assay. A straight scratch was made in individual well with a 200 μL or 50 μL pipette tip. The cell debris was aspirated away and replaced by fresh serum-free medium. U251 and U87 cells were then treated with one or two of the following reagents: different concentrations of norepinephrine (0, 0.1, 1, 5, 10 and 50 μM; Sigma-Aldrich, USA), atenolol (10 μM; Sigma-Aldrich, USA), propranolol (10 μM; Sigma-Aldrich, USA), and kept in the 5% CO2 37°C incubator. The wound healing was assessed at 0, 12 and 24 h after the scratch was made using a light microscope. Three randomly selected points along each wound were marked, and the horizontal distance of migrating cells from the initial wound was measured.

Matrigel Invasion Assay

Cell invasion was assessed by a transwell invasion assay. Corning® BioCoat™ Cell Culture Inserts (24 wells, 8 μm pore size; Corning, MA, USA) was coated with 0.53 mg/mL Corning® collagen Ⅳ (human, Corning, MA, USA), and incubated at room temperature for 1 h according to the instructions. Fetal bovine serum (FBS) (Gibco, USA) 100 μL was then added to the upper chamber of the wells to hydrate the membrane. U251 cells or U87 cells (5 ×105) were suspended in 200 μL FBS free medium and added to the upper chamber of the wells. The lower chamber contained 750 μL of 10% FBS medium for U87 cells or 5% FBS medium for U251 cells. U251 and U87 cells were then treated with one or two of the following reagents: different concentrations of norepinephrine (0, 0.1, 1, 5, 10 and 50 μM), atenolol (10 μM), propranolol (10 μM), and kept in an incubator with 5% CO2 at 37°C for 24 h. Twenty-four hours later, medium in the upper chamber was aspirated and cells on the upper membrane surface were mechanically removed with cotton. The cells that had migrated to the lower side of the collagen Ⅳ–coated membrane were fixed and stained with 0.1% crystal violet (Sigma-Aldrich, USA) for 15 min. Invasive cells were counted in five randomly chosen fields under a microscope at 200 × magnification and the average number of these cells per field was calculated by Image J.

The Human Tumor Metastasis RT2 Profiler™ PCR Array

The Human Tumor Metastasis RT2 Profiler™ PCR Array (QIAGEN, German) contains 84 primer pairs that amplify genes involved in human metastasis. U251 cells were seeded in 6 cm wells for 24 h. Then three wells of them were untreated and three wells were treated with 10 μM norepinephrine. The culture medium was RPMI 1640 with 5% FBS. Cell total RNA was extracted from the cultured cells after 12 h treatment using RNeasy Mini Kit (QIAGEN, German) according to the manufacturer’s instruction. After quantification using a Nanodrop spectrophotometer, 200 μg total RNA was reversed transcribed into cDNA. The housekeeping gene GAPDH was used as the reference to normalize the obtained fold changes of differential genes.

Method for qPCR of Adreb1 and Adreb2

RNA of U251 and U87 cells was extracted by RNeasy Micro kit (catalogue: 74004, QIAGEN, Maryland, USA). Reverse transcription was performed by using 5X All In-One MasterMix (catalogue: G485, Applied Biological Materials, Canada). Quantitative PCR was performed with a CFX Connect real time PCR detection system (Bio-Rad). Primers used for qPCR were the same as previously reported [53, 54].

β1-AR-F: CCG GGAACAGGAACACAC 73bp

β1-AR-R: GAA AGCAAAAGGAAATATGTCTTGA

β2-AR-F: CAGGAAGCCATCAACTGCTA 61bp

β2-AR-R: GGCTTGGTTCGTGAAGAAGT

Gapdh-F: TGCACCACCAACTGCTTAGC 87bp.

Gapdh-R: GGCATGGACTGTGGTCATGAG

For negative control, no cDNA was added to the reaction mix.

Western blotting

The human glioblastoma U251 and U87 cell lines were cultured in 6 cm dish. Cells were treated with 0, 0.1, 1, 5, 10 and 50 μM norepinephrine. Twenty-four hours h later, cells were collected for Western blotting. The housekeeping gene GAPDH was used as the reference to normalize the obtained fold changes of differential genes.

Small interfering RNA (siRNA) transfection

Before transfection, 5×104 U87 cells per well were plated into 24-well plates and grown for 1 day in antibiotic-free medium containing 10% FBS. When the cells were 60 – 80% confluent, they were transfected with a siRNA reagent designed to specifically target matrix metalloproteinase (MMP)-11 (MMP-11 siRNA) or with a non-targeting negative control siRNA (NT siRNA) at a concentration of 100 pM using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions. Transfected cells were grown at 37°C for 24 h and 48 h and cells were harvested for Western blotting. In Wound Healing Assay, a straight scratch was made in individual well with a 200 μL pipette tip 24 h after transfection. In Transwell Invasion Assay, U87 cells (post-transfection or not transfection, 5 ×105 cells) were suspended in 200 μL FBS-free medium and added to the upper chamber of the wells 24 h after transfection and the lower chamber contained 750 μL of 10% FBS medium.

Statistical Analysis

Parametric results in normal distribution are presented as mean ± S.D. (n ≥ 4). The data were analyzed by one-way analysis of variance followed by the Student-Newman-Keuls test if the data were normally distributed or by one-way analysis of variance on ranks followed by the Student-Newman-Keuls test if the data were not normally distributed. Differences were considered significant at P < 0.05 based on two-tailed hypothesis testing. All statistical analyses were performed with SigmaPlot14.0 (Systat Software, Point Richmond, CA).

Highlights:

Growing evidence has shown that the stress hormones affect tumor progression

Norepinephrine inhibits the migration and invasion of human glioblastoma cells

The β adrenergic receptor blocker blunted the suppressive effect of norepinephrine

MMP-11 silencing inhibited the migration and invasion of glioblastoma cells

TCGA data showed patients with higher expression of MMP-11 had poorer prognosis

Acknowledgments

Ziwen Zhong from Zhongshan Hospital, Fudan University helped us in searching The Cancer Genome Atlas (TCGA) database.

Funding: This study was supported by grants (GM098308, RF1AG061047, and AG056995 to Z Zuo) from the National Institutes of Health, Bethesda, MD, the Robert M. Epstein Professorship endowment (to Z Zuo), a grant from the National Natural Science Foundation of China (81971868 to J Zhong) and grants from the Program of Shanghai Academic/Technology Research Leader (20XD1423000 and 2020ZSLC41 to J Zhong).

Footnotes

Conflict of interest: None.

Declarations

Availability of data and materials

The data and materials are available per rules of funding agencies.

Code availability

Not applicable

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References:

  • 1.Daniel P, et al. , 2010. The norepinephrine-driven metastasis development of PC-3 human prostate cancer cells in BALB/c nude mice is inhibited by beta-blockers. International Journal of Cancer Journal International Du Cancer. 118(11), 2744–2749. [DOI] [PubMed] [Google Scholar]
  • 2.Ricon I, et al. , 2019. Perioperative biobehavioral interventions to prevent cancer recurrence through combined inhibition of beta-adrenergic and cyclooxygenase 2 signaling. Cancer. 125(1), 45–56. DOI: 10.1002/cncr.31594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sporn MB, 1996. The war on cancer. Lancet. 347(9012), 1377–81. [DOI] [PubMed] [Google Scholar]
  • 4.Strell C, et al. , 2009. Divergent effects of norepinephrine, dopamine and substance P on the activation, differentiation and effector functions of human cytotoxic T lymphocytes. BMC Immunol. 10, 62 DOI: 10.1186/1471-2172-10-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Joseph J, et al. , 2002. The neurotransmitter gamma-aminobutyric acid is an inhibitory regulator for the migration of SW 480 colon carcinoma cells. Cancer Res. 62(22), 6467–9. [PubMed] [Google Scholar]
  • 6.Walker AK, et al. , 2019. Circulating epinephrine is not required for chronic stress to enhance metastasis. Psychoneuroendocrinology. 99, 191–195. DOI: 10.1016/j.psyneuen.2018.09.012. [DOI] [PubMed] [Google Scholar]
  • 7.Ting-ting LIU, T.-l.D., Yong MA, Wei WEI, 2014. Selective α1B- and α1D-adrenoceptor antagonists suppress noradrenaline-induced activation, proliferation and ECM secretion of rat hepatic stellate cells in vitro. Acta Pharmacologica Sinica 35, 1385–1392. DOI: 10.1038/aps.2014.84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Fitzgerald PJ, 2009. Is norepinephrine an etiological factor in some types of cancer? International Journal of Cancer. 124(2), 257–263. DOI: doi: 10.1002/ijc.24063. [DOI] [PubMed] [Google Scholar]
  • 9.Iv TLD, et al. , 2003. Effects of Neurotransmitters on the Chemokinesis and Chemotaxis of MDA-MB-468 Human Breast Carcinoma Cells. Breast Cancer Research & Treatment. 80(1), 63–70. [DOI] [PubMed] [Google Scholar]
  • 10.Masur K, et al. , 2001. Norepinephrine-induced migration of SW 480 colon carcinoma cells is inhibited by beta-blockers. Cancer Research. 61(7), 2866–9. [PubMed] [Google Scholar]
  • 11.Kerstin L, et al. , 2004. Induction of a metastatogenic tumor cell type by neurotransmitters and its pharmacological inhibition by established drugs. International Journal of Cancer. 112(2), 231–238. [DOI] [PubMed] [Google Scholar]
  • 12.Bastian P, et al. , 2009. The inhibitory effect of norepinephrine on the migration of ES-2 ovarian carcinoma cells involves a Rap1-dependent pathway. Cancer Letters. 274(2), 218–224. [DOI] [PubMed] [Google Scholar]
  • 13.Li PD, et al. , 2014. Evaluation of TAZ expression and its effect on tumor invasion and metastasis in human glioma. Asian Pacific Journal of Tropical Medicine. 7(10), 757–760. [DOI] [PubMed] [Google Scholar]
  • 14.Ostrom QT, et al. , 2015. CBTRUS Statistical Report: Primary Brain and Central Nervous System Tumors Diagnosed in the United States in 2008–2012. Neuro Oncol. 17 Suppl 4, iv1–iv62. DOI: 10.1093/neuonc/nov189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Carsten H, et al. , 2013. Impact of MACC1 on human malignant glioma progression and patients’ unfavorable prognosis. Neuro-oncology. 15(12), 1696–1709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.JIANHENG WU, Q.S., PEIDONG LI, YUEHUI WU, JINGWEI XIE and XINJUN WANG, 2015. ATPase inhibitory factor 1 is a potential prognostic marker for the migration and invasion of glioma. ONCOLOGY LETTERS. 10, 2075–2080. DOI: 10.3892/ol.2015.3548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lynes J, et al. , 2018. Current Options and Future Directions in Immune Therapy for Glioblastoma. Front Oncol. 8, 578 DOI: 10.3389/fonc.2018.00578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Friedl P and Wolf K, 2003. Tumor-cell invasion and migration: Diversity and escape mechanisms. Nature Reviews Cancer. 3(5), 362–374. [DOI] [PubMed] [Google Scholar]
  • 19.Strell C, et al. , 2012. Norepinephrine promotes the β1-integrin-mediated adhesion of MDA-MB-231 cells to vascular endothelium by the induction of a GROα release. Molecular Cancer Research Mcr. 10(2), 197. [DOI] [PubMed] [Google Scholar]
  • 20.Lang K, et al. , 2003. Neurotransmitters regulate the migration and cytotoxicity in natural killer cells. Immunology Letters. 90(2), 165–172. [DOI] [PubMed] [Google Scholar]
  • 21.Stock AM, et al. , 2013. Norepinephrine inhibits the migratory activity of pancreatic cancer cells. Exp Cell Res. 319(12), 1744–58. DOI: 10.1016/j.yexcr.2013.04.015. [DOI] [PubMed] [Google Scholar]
  • 22.Entschladen F, et al. , 2004. Tumour-cell migration, invasion, and metastasis: navigation by neurotransmitters. Lancet Oncol. 5(4), 254–8. DOI: 10.1016/s1470-2045(04)01431-7. [DOI] [PubMed] [Google Scholar]
  • 23.Moreno-Smith M, et al. , 2011. Dopamine blocks stress-mediated ovarian carcinoma growth. Clin Cancer Res. 17(11), 3649–59. DOI: 10.1158/1078-0432.ccr-10-2441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Tilan J and Kitlinska J, 2010. Sympathetic Neurotransmitters and Tumor Angiogenesis-Link between Stress and Cancer Progression. J Oncol. 2010, 539706 DOI: 10.1155/2010/539706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Spiegel A, et al. , 2007. Catecholaminergic neurotransmitters regulate migration and repopulation of immature human CD34+ cells through Wnt signaling. Nat Immunol. 8(10), 1123–31. DOI: 10.1038/ni1509. [DOI] [PubMed] [Google Scholar]
  • 26.Lang K, et al. , 2004. Induction of a metastatogenic tumor cell type by neurotransmitters and its pharmacological inhibition by established drugs. Int J Cancer. 112(2), 231–8. DOI: 10.1002/ijc.20410. [DOI] [PubMed] [Google Scholar]
  • 27.Childers WK, Hollenbeak CS, and Cheriyath P, 2015. β-Blockers Reduce Breast Cancer Recurrence and Breast Cancer Death: A Meta-Analysis. Clinical Breast Cancer. 15(6), 426–431. DOI: 10.1016/j.clbc.2015.07.001. [DOI] [PubMed] [Google Scholar]
  • 28.Melhembertrandt A, et al. , 2011. Beta-Blocker Use Is Associated With Improved Relapse-Free Survival in Patients With Triple-Negative Breast Cancer. Journal of Clinical Oncology Official Journal of the American Society of Clinical Oncology. 29(19), 2645–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wrobel LJ, Gayet-Ageron A, and Le Gal FA, 2020. Effects of Beta-Blockers on Melanoma Microenvironment and Disease Survival in Human. Cancers (Basel). 12(5). DOI: 10.3390/cancers12051094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Cho MA, et al. , 2020. Impact of Angiotensin Receptor Blockers, Beta Blockers, Calcium Channel Blockers and Thiazide Diuretics on Survival of Ovarian Cancer Patients. Cancer Res Treat. 52(2), 645–654. DOI: 10.4143/crt.2019.509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wang P, et al. , 2020. Psychological Stress Up-Regulates CD147 Expression Through Beta-Arrestin1/ERK to Promote Proliferation and Invasiveness of Glioma Cells. Front Oncol. 10, 571181 DOI: 10.3389/fonc.2020.571181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.He JJ, et al. , 2017. Activation of β-adrenergic receptor promotes cellular proliferation in human glioblastoma. Oncol Lett. 14(3), 3846–3852. DOI: 10.3892/ol.2017.6653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sloan EK, et al. , 2011. Sympathetic nervous system induces a metastatic switch in primary breast cancer. Cancer Research. 70(18), 7042–7052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Jordan JT, et al. , 2008. Preferential migration of regulatory T cells mediated by glioma-secreted chemokines can be blocked with chemotherapy. Cancer Immunol Immunother. 57(1), 123–31. DOI: 10.1007/s00262-007-0336-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Chang AL, et al. , 2016. CCL2 Produced by the Glioma Microenvironment Is Essential for the Recruitment of Regulatory T Cells and Myeloid-Derived Suppressor Cells. Cancer Res. 76(19), 5671–5682. DOI: 10.1158/0008-5472.can-16-0144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Suina K, et al. , 2018. Epidermal growth factor receptor promotes glioma progression by regulating xCT and GluN2B-containing N-methyl-d-aspartate-sensitive glutamate receptor signaling. Cancer Sci. 109(12), 3874–3882. DOI: 10.1111/cas.13826. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Zhang X, et al. , 2016. Insights into the distinct roles of MMP-11 in tumor biology and future therapeutics (Review). Int J Oncol. 48(5), 1783–93. DOI: 10.3892/ijo.2016.3400. [DOI] [PubMed] [Google Scholar]
  • 38.Hagemann C, et al. , 2010. Comparative expression pattern of Matrix-Metalloproteinases in human glioblastoma cell-lines and primary cultures. Bmc Research Notes. 3(1), 293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Mouhieddine TH, et al. , 2015. Metformin and Ara-a Effectively Suppress Brain Cancer by Targeting Cancer Stem/Progenitor Cells. Frontiers in Neuroscience. 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Liang C, Yang L, and Guo S, 2015. All-trans retinoic acid inhibits migration, invasion and proliferation, and promotes apoptosis in glioma cells in vitro. Oncology Letters. 9(6), 2833–2838. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Zhang Z, et al. , 2018. MMP-11 promotes papillary thyroid cell proliferation and invasion via the NF-kappaB pathway. J Cell Biochem. DOI: 10.1002/jcb.27500. [DOI] [PubMed] [Google Scholar]
  • 42.Hsin CH, et al. , 2017. MMP-11 promoted the oral cancer migration and Fak/Src activation. Oncotarget. 8(20), 32783–32793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Yeon-Jin K, et al. , 2011. Gli1 enhances migration and invasion via up-regulation of MMP-11 and promotes metastasis in ERα negative breast cancer cell lines. Clinical & Experimental Metastasis. 28(5), 437–449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Jia L, et al. , 2007. siRNA targeted against matrix metalloproteinase 11 inhibits the metastatic capability of murine hepatocarcinoma cell Hca-F to lymph nodes. Int J Biochem Cell Biol. 39(11), 2049–62. DOI: 10.1016/j.biocel.2007.05.023. [DOI] [PubMed] [Google Scholar]
  • 45.Menon B, et al. , 2006. beta-Adrenergic receptor-stimulated apoptosis in adult cardiac myocytes involves MMP-2-mediated disruption of beta1 integrin signaling and mitochondrial pathway. Am J Physiol Cell Physiol. 290(1), C254–61. DOI: 10.1152/ajpcell.00235.2005. [DOI] [PubMed] [Google Scholar]
  • 46.Jaffré F, et al. , 2012. β-adrenergic receptor stimulation transactivates protease-activated receptor 1 via matrix metalloproteinase 13 in cardiac cells. Circulation. 125(24), 2993–3003. DOI: 10.1161/circulationaha.111.066787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Newburgh RW and Rosenberg RN, 1972. Effect of norepinephrine on glucose metabolism in glioblastoma and neuroblastoma cells in cell culture. Proc Natl Acad Sci U S A. 69(7), 1677–80. DOI: 10.1073/pnas.69.7.1677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Shukla A, et al. , 2018. Glycolytic inhibitor 2-Deoxy-d-Glucose activates migration and invasion in glioblastoma cells through modulation of the miR-7–5p/TFF3 signaling pathway. Biochem Biophys Res Commun. 499(4), 829–835. DOI: 10.1016/j.bbrc.2018.04.001. [DOI] [PubMed] [Google Scholar]
  • 49.Basanta D, et al. , 2008. Evolutionary game theory elucidates the role of glycolysis in glioma progression and invasion. Cell Prolif. 41(6), 980–987. DOI: 10.1111/j.1365-2184.2008.00563.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Kathagen-Buhmann A, et al. , 2016. Glycolysis and the pentose phosphate pathway are differentially associated with the dichotomous regulation of glioblastoma cell migration versus proliferation. Neuro Oncol. 18(9), 1219–29. DOI: 10.1093/neuonc/now024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Thompson EG and Sontheimer H, 2019. Acetylcholine Receptor Activation as a Modulator of Glioblastoma Invasion. Cells. 8(10). DOI: 10.3390/cells8101203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Dienel GA and Cruz NF, 2016. Aerobic glycolysis during brain activation: adrenergic regulation and influence of norepinephrine on astrocytic metabolism. J Neurochem. 138(1), 14–52. DOI: 10.1111/jnc.13630. [DOI] [PubMed] [Google Scholar]
  • 53.Rössler J, et al. , 2013. β1-Adrenoceptor mRNA level reveals distinctions between infantile hemangioma and vascular malformations. Pediatr Res. 73(4 Pt 1), 409–13. DOI: 10.1038/pr.2013.16. [DOI] [PubMed] [Google Scholar]
  • 54.Laukens D, et al. , 2010. Evidence for significant overlap between common risk variants for Crohn’s disease and ankylosing spondylitis. PLoS One. 5(11), e13795 DOI: 10.1371/journal.pone.0013795. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES