Skip to main content
NCBI home page
HHS Author Manuscripts logoLink to HHS Author Manuscripts
. Author manuscript; available in PMC: 2021 Feb 26.
Published in final edited form as: Clin Chem. 2014 Dec 11;61(2):412–419. doi: 10.1373/clinchem.2014.231019

Newborn Blood Spot Screening Test Using Multiplexed Real-Time PCR to Simultaneously Screen for Spinal Muscular Atrophy and Severe Combined Immunodeficiency

Jennifer L Taylor 1,†, Francis K Lee 1,†, Golriz Khadem Yazdanpanah 2, John F Staropoli 3, Mei Liu 3, John P Carulli 3, Chao Sun 3, Steven F Dobrowolski 4, W Harry Hannon 2, Robert F Vogt 1,*
PMCID: PMC7906865  NIHMSID: NIHMS920732  PMID: 25502182

Abstract

BACKGROUND

Spinal muscular atrophy (SMA) is a motor neuron disorder caused by the absence of a functional survival of motor neuron 1, telomeric (SMN1) gene. Type I SMA, a lethal disease of infancy, accounts for the majority of cases. Newborn blood spot screening (NBS) to detect severe combined immunodeficiency (SCID) has been implemented in public health laboratories in the last 5 years. SCID detection is based on real-time PCR assays to measure T-cell receptor excision circles (TREC), a byproduct of T-cell development. We modified a multiplexed real-time PCR TREC assay to simultaneously determine the presence or absence of the SMN1 gene from a dried blood spot (DBS) punch in a single reaction well.

METHOD

An SMN1 assay using a locked nucleic acid probe was initially developed with cell culture and umbilical cord blood (UCB) DNA extracts, and then integrated into the TREC assay. DBS punches were placed in 96-well arrays, washed, and amplified directly using reagents specific for TREC, a reference gene [ribonuclease P/MRP 30kDa subunit (RPP30)], and the SMN1 gene. The assay was tested on DBS made from UCB units and from peripheral blood samples of SMA-affected individuals and their family members.

RESULTS

DBS made from SMA-affected individuals showed no SMN1-specific amplification, whereas DBS made from all unaffected carriers and UCB showed SMN1 amplification above a well-defined threshold. TREC and RPP30 content in all DBS were within the age-adjusted expected range.

CONCLUSIONS

SMA caused by the absence of SMN1 can be detected from the same DBS punch used to screen newborns for SCID.

Spinal muscular atrophy (SMA),5 the most common genetic cause of death in infancy (1), is an α-motor neuron disorder caused by insufficient concentrations of the survival of motor neuron (SMN) protein. In about 95% of SMA cases, the reduction in SMN concentrations is due to deletions involving the survival of motor neuron 1, telomeric (SMN1)6 gene (2). The nearly identical survival of motor neuron 2, centromeric (SMN2) gene, a paralog of SMN1, also produces SMN protein, but at much lower concentrations. SMN2 copy numbers vary widely between individuals, ranging from complete absence to 5 or more copies per genome (3). Because some SMN protein is essential for fetal development, all babies born with SMA have at least 1 SMN2 gene. Higher SMN2 copy numbers in SMA patients are associated with later onset and milder disease, including juvenile onset (type III; OMIM 253400) and adult onset (type IV; OMIM 271150). However, the majority of SMA newborns become symptomatic as infants (type I; OMIM 253300) or toddlers (type II; OMIM 253550). Type 1 children will never sit unsupported, often require ventilatory support in the first year of life, and usually die before 2 years of age. Type II children can survive to early adulthood but will never walk. Cognitive abilities are not impaired by SMA and affected children are generally bright and sociable.

Several potential therapies for SMA are in development (1, 4), 2 of which are undergoing clinical trials in symptomatic children with some encouraging results (5, 6). Because of the early onset and rapid progression of infantile SMA, evaluation of these therapies in presymptomatic infants will require prompt detection. Such early detection would be possible in about 95% of SMA cases by screening newborn dried blood spots (DBS) for the homozygous absence of SMN1 sequences around exon 7 (7, 8).

The most recent condition added to the US Recommended Uniform Screening Panel for newborn blood spot screening (NBS) is severe combined immunodeficiency (SCID) (9), a congenital disorder with severe impairment of cellular and humoral immune function due to a profound deficiency in T cells (10). The assay most commonly used for SCID-NBS is real-time PCR to measure T-cell receptor excision circles (TREC), extrachromosomal DNA byproducts of somatic recombination in T cells (10). SCID is the first NBS condition for which DNA analysis is the primary (first-tier) screening method. Since the initial pilot experiences in 2 US state public health laboratories (11, 12), SCID-NBS has expanded to many other state programs (13, 14) and now covers the majority of newborns in the US as well as many newborns globally (15). SCID-NBS prevents infant death through early medical intervention and is highly cost-effective (16, 17).

Because of similarities in methods, we reasoned that both SCID and SMA could be detected in the same real-time PCR reaction-well by modifying existing high-throughput TREC PCR assays to include SMN1 genotyping. The combined assay had to be specific for SMN1 to avoid cross-reactivity with the SMN2 gene. Here we show that homozygous SMN1 absence can be reliably detected from the same DBS punch used to measure TREC at minimal incremental cost.

Materials and Methods

SOURCES OF SAMPLES

DBS and DNA extracts with TREC values in the expected range for typical term newborns were made from residual excluded umbilical cord blood (UCB) units collected at the Duke University Stem Cell Laboratory. SCID-like DBS were prepared from peripheral blood containing no measurable TREC obtained from adults above age 50 years. Before spotting, the blood was depleted of mononuclear cells by layering on Histopaque (Sigma-Aldrich), centrifuging 30 min at 2100g, aspirating the fluid above the buffy coat, and reconstituting to 50% hematocrit with pooled serum. Immortalized B lymphocyte and fibroblast cell lines from patients with SMA (GM 23689, GM 10684, GM 03813, GM 00232, and GM 09677) and carriers (GM 23688, GM 23687, GM 03814, and GM 03815) were obtained from the Coriell Institute for Medical Research. DBS with SMA-affected or -carrier genotypes were made from residual peripheral blood samples obtained with informed consent (3) from 11 SMA-affected individuals (age range, 1–50 years) and from 15 unaffected parents (age range, 25–57 years). DBS were stored in low-permeability zip-lock bags with silica gel desiccant packs (Poly Lam Products) up to one month at room temperature, up to 6 months at 4 °C, and up to 2 years at −20 °C. The CDC laboratory staff was blinded to sample status and had no access to personal identifiers. The study was therefore classified as human subjects research for which the CDC was not engaged.

REAL-TIME PCR ASSAYS

All primers and probes (Table 1) were custom synthesized by Integrated DNA Technologies. Real-time PCR assays were conducted in PCR plates (96-well formats; Agilent Technologies) using a scanning photofluorometric thermal cycler (Stratagene MxPro 3000p). Cycle thresholds were initially determined by inspection of amplification curves and then retained in fixed positions. Quantification cycles (Cq) were reported by instrument software.

Table 1.

PCR primers and probes for the triplex real-time PCR assay to amplify sequences in the δRec-ΨJα signal joint (TREC) and in RPP30 and SMN1.

Target/reagent Sequence Concentration
(nmol/L)a
TREC
 Forward primer 5′-TTT GTA AAG GTG CCC ACT CCT-3′ 800
 Reverse primer 5′-TAT TGC AAC TCG TGA GAA CGG TGA AT-3′ 800
 Probe 5-FAM/CGGTGATGCATAGGCACCT/Iowa Black quencher-3′ 120
RPP30
 Forward primer 5′-TTT GGA CCT GCG AGC G-3′   60
 Reverse primer 5′-GAG CGG CTG TCT CCA CAA GT-3′ 150
 Probe 5′-HEX/TTCTGACCTGAAGGCTCTGCGCG/Iowa Black quencher-3′ 200
SMN1
 Forward primer 5′-GTGGAAAACAAATGTTTTTGAACATT-3′ 900
 Reverse primer 5′-GTAGGGATGTAGATTAACCTTTTATCTAATAGTTT-3′ 900
 LNA probeb 5′-Cy5/CAACTTTTTAACATCT/3IAbRQSp-3′ 100
Open in a new tab
a

Final concentration in PCR reaction.

b

Bases in bold italic font denote LNA nucleotides; the underlined nucleotide indicates the position of the A>G transition in intron 7 that distinguishes SMN1 from SMN2.

TREC QUANTIFICATION IN DBS

The real-time PCR assay was performed in situ on 2-mm discs punched from DBS samples directly into 96-well PCR arrays. After 125 μL wash buffer was added (DNA elution solution, Qiagen) to each well, the PCR array was incubated at room temperature for 15 min on a microtiter plate shaker set at 1200 rpm. The wash buffer was then removed, and 15 μL of the complete real-time PCR master mix (PerfecTa Toughmix, Quanta Biosciences) containing primers and probes (Table 1) was added to each sample well. The PCR plate was sealed with optical film and processed using the following amplification conditions: 45 °C for 3 min and 95 °C for 20 min, followed by 45 cycles of 95 °C for 15s and 60 °C for 1 min. A reagent blank and a blank filter paper punch (no-template control) were included in the analytical runs.

SMN1 ANALYSIS IN DNA EXTRACTS

DNA was extracted from cell lines or UCB samples using the Qiagen QlAamp® Mini DNA kit according to the manufacturer’s protocol. DNA extracts were analyzed immediately or stored at −20 °C for up to 6 months. Extracts from tissue culture cells contained 3–50 ng/μL DNA and extracts from UCB contained 100–150 ng/uL DNA. Real-time PCR was conducted in 20-μL reaction volumes containing 5 μL of the DNA extract, a commercial real-time PCR premix (PerfecTa, Toughmix, Quanta), the SMN1 forward primer and reverse primer, the SMN1 locked nucleic acid (LNA) probe overlying the A>G transition at position 100 of intron 7 to distinguish SMN1 from SMN2, and the RPP30 forward primer, reverse primer, and probe (Table 1). Primers and probe sequences for SMN1 were designed using Primer Express (Life Technologies) and confirmed for in silico specificity. Probe modification with LNA bases was designed with software from IDT Biophysics. To determine the optimal annealing temperature, reactions were carried out in a Bio-Rad Laboratories CFX96 real-time PCR instrument with the following amplification conditions: 45 °C for 3 min and 95 °C for 10 min, followed by 45 cycles of melting at 95 °C for 15 s and annealing/extension between 60 °C and 67 °C for 1 min.

Results

SMN1 ASSAY DEVELOPMENT

Prototype assays were initially explored using extracted DNA from cell lines of patients with SMA, cell lines of SMA carriers, and UCB samples. We first used a temperature gradient to determine the optimal PCR annealing temperature for maximal specificity to discriminate SMN1 and SMN2 amplification. The results (Fig. 1) showed increasing discrimination between the patients and unaffected controls with increased annealing temperature. At 65 °C, no SMN1 amplicon was detected by the LNA probe in patients with SMA, whereas healthy individuals and carriers showed clear amplification. This annealing temperature of 65 °C provided the highest analytical specificity and was chosen for all subsequent experiments.

Fig. 1.

Fig. 1

Open in a new tab

Seven temperatures (60 °C to 67 °C) were tested to determine the appropriate annealing temperature for the SMN1 gene; results are shown for 4 selected temperatures. The dashed grey horizontal line denotes the fluorescence threshold for positive results and Cq determination. RFU, relative fluorescence units.

The working parameters for a duplex assay that included SMN1 and a genomic sequence of RPP30 as an internal control reference for PCR amplification were then optimized. This duplex assay was applied to DNA extracts prepared from commercially available cell lines from 5 SMA patients and 4 parental carriers as well as cellular DNA from 5 UCB samples. Results (Fig. 2) demonstrated a 100% concordance with the clinical status of the donors. No amplification was seen with DNA extracted from any of the SMA patient cell lines, indicating no detectable cross-reactivity with SMN2. In contrast, DNA extracted from cell lines from the unaffected carriers and UCB produced robust amplification, with Cq values ranging from 18 to 25 cycles. RPP30 in all samples showed amplification in the expected Cq range.

Fig. 2.

Fig. 2

Open in a new tab

PCR amplification curves from DNA extracts of 5 randomly selected umbilical cord blood samples (normal controls), 6 cell lines from SMA parental carriers, and 5 cell lines from SMA patients with homozygous SMN1 deletion. dRn, Δ normalized reporter.

Having established the working conditions for the SMN1 assay, we incorporated it into the in situ DBS assay for TREC with the annealing temperature raised to 65 °C. Reference DBS samples from a SCID-like positive control with no TREC, a positive control from an SMA infant with no SMN1, and a normal control from a UCB sample showed clear discrimination between the amplification patterns of the corresponding targets (Figs. 3). Varying the SMN primer concentration from 50 nmol/L to 900 nmol/L exerted no effect on the other multiplexed targets (TREC and RPP30; see Fig. 1 in Data Supplement that accompanies the online version of this article at http://www.clinchem.org/content/vol61/issue2). Therefore primer limitation was not necessary, and the maximum primer concentration (900 nmol/L) in the range tested was used for both forward and reverse SMN1 primers in all subsequent experiments.

Fig. 3. Triplex TREC-SMN1-RPP30 DBS real-time PCR amplification curves.

Fig. 3

Open in a new tab

DNA targets were amplified on each DBS punch without DNA extraction. RPP30 (present in all samples); SMN1 (absent in SMA infant); TREC (absent in SCID-positive control). dRn, Δ normalized reporter; FAM, 6-carboxyfluorescein; HEX, β-hexosaminidase; Cy5, cyanine 5.

To determine whether the inclusion of the SMN1 target and the higher (65 °C) annealing temperature would alter the TREC assay, we first compared results on DNA extracts (see online Supplemental Fig. 2). The TREC Cq values were highly correlated (r2 = 0.87) and showed no significant difference between the original duplex (TREC and RPP30 at 60 °C annealing temperature) and the modified triplex assay (P > 0.14 by paired t-test). Next we tested 150 DBS made from UCB with both the original duplex assay and the modified triplex assay. All samples showed the typical amplification curves expected for TREC, SMN1, and RPP30. TREC Cq values obtained by the in situ DBS triplex assay showed a slight decrease (mean 0.4 Cq) compared to those from the duplex assay but were consistent with the overall ranges for term newborns reported by public health newborn screening programs (11–14). The Cq values for SMN1 showed a near-gaussian distribution (Fig. 4A). Cq values for SMN1 and RPP30 (Fig. 4B) were significantly correlated (r2 = 0.66, Sy/x = 0.47, P < 0.01), suggesting that the variation between samples was due mostly to differences in leukocyte content and thus in the total amount of genomic DNA.

Fig. 4.

Fig. 4

Open in a new tab

(A) Distribution of SMN1 Cq results on dried blood spots made from 150 umbilical cord blood samples analyzed at the CDC laboratory. (B) Correlation between Cq results for SMN1 and RRP30 (r = 0.66, P < 0.01).

VALIDATION IN CLINICAL SAMPLES

The clinical validity of the TREC-RPP30-SMN1 triplex assay was examined in a double-blind testing of DBS made from 26 blood samples from SMA patients and their carrier parents. This sample set was analyzed independently at the 2 collaborating laboratories (CDC and Biogen Idec) using the triplex in situ DBS method. The SMN1 categorical genotypes obtained by both laboratories were identical and showed 100% concordance with the clinical status of the patient (Table 2). All samples showed typical amplification of the internal reference control RPP30, and the TREC Cq values were within the expected range for the age of the donor. Reagent blank and blank filter paper punches (no template controls) showed no amplification for any of the 3 targets.

Table 2.

Results of blinded testing of DBS samples prepared from peripheral blood samples of 11 SMA patients and 15 parental carriers by the multiplex TREC-SMN1-RPP30 DBS real-time PCR assay.

SMA status SMA type Age, years SMN1 resulta SMN1, Cqb RPP30, Cqb TREC, Cqb
Patient III   4 Absent No Cq 23.8 30.2
Patient III   2 Absent No Cq 24.2 31.7
Patient II 50 Absent No Cq 25.1 34.6
Patient III   3 Absent No Cq 23.5 29.6
Patient II   1 Absent No Cq 24.5 30.0
Patient II 22 Absent No Cq 23.7 30.4
Patient III 13 Absent No Cq 23.2 31.3
Patient III   3 Absent No Cq 23.2 29.5
Patient II   1 Absent No Cq 21.6 28.7
Patient III   4 Absent No Cq 22.6 28.5
Patient III   2 Absent No Cq 22.5 29.1
Carrierc NAd 45 Present 24.2 23.3 34.3
Carrier NA 33 Present 26.9 25.0 34.3
Carrier NA 34 Present 25.6 24.8 33.9
Carrier NA 29 Present 25.0 23.8 34.0
Carrier NA 32 Present 24.2 23.2 34.4
Carrier NA 43 Present 23.3 22.2 34.8
Carrier NA 43 Present 22.7 21.9 33.0
Carrier NA 41 Present 23.0 22.4 35.0
Carrier NA 57 Present 25.5 24.9 34.4
Carrier NA 48 Present 22.7 22.3 35.3
Carrier NA 48 Present 22.5 22.8 34.4
Carrier NA 44 Present 25.8 25.1 36.7
Carrier NA 35 Present 21.1 21.1 31.3
Carrier NA 33 Present 22.6 22.6 No Cq
Carrier NA 25 Present 21.8 22.0 31.8
Open in a new tab
a

Concordant categorical results from CDC and Biogen-Idec laboratories.

b

Cq results from CDC laboratory.

c

Unaffected parent of SMA patient.

d

NA, not applicable.

Discussion

The early onset and precipitous clinical course of infantile SMA make it a prime target for early detection through NBS (7). Compared with other conditions currently recommended for NBS in the US (18), SMA has a high birth prevalence, ranking just below the top 3 of 29 NBS primary target conditions presently on the Recommended Uniform Screening Panel (congenital hypothyroidism, cystic fibrosis, and hemoglobinopathy). As with SCID, early detection of SMA is likely to provide the best opportunity for effective treatment. With multiple therapeutics currently in clinical trials, and more in development (1, 3, 19, 20), NBS laboratories are in an ideal position to facilitate presymptomatic intervention that could maximize the benefits of potential therapies.

Over the last 2 decades, the complex biology and natural history of SMA have been largely delineated (2). Although several factors influence pathogenesis, about 95% of diagnosed SMA cases are caused by the homozygous absence of a functional SMN1 gene through either deletion or gene conversion. Various approaches to detecting the SMN1 null genotype have been developed, and some have been validated in DBS samples, including real-time PCR (8), high-resolution melting (21), and microbead suspension arrays (22).

Two major considerations determined our approach to developing an NBS assay for SMA. First, it would be preferable to use an assay platform that is well established in public health newborn screening. Although genotype-based sickle cell disease screening had been performed previously (23), until recently none of the primary screening assays used in public health NBS programs used molecular DNA methods. The incorporation of a DNA-based assay has been prompted by the recommended inclusion of SCID-NBS, which is based on measuring TREC (24). The preferred platform for measuring TREC is real-time PCR, and this technology is now routinely used in screening the majority of newborns in the US for SCID. Second, it would be advantageous to multiplex the SMN1 assay with an existing routine NBS assay, thereby assuring its robustness and minimizing the incremental cost for detecting SMA. We therefore explored the possibility that SMN1 genotyping could be multiplexed with the TREC assay developed at CDC, which is used to characterize DBS reference materials for global distribution to participants in the CDC Newborn Screening Quality Assurance Program (25).

The main challenge in developing a PCR assay for SMN1 gene absence is caused by the near identity of the SMN1 and SMN2 gene sequences. Conventional real-time PCR probes to any targeted SMN1 sequence could cross-react with the corresponding SMN2 sequence and produce false amplification signals when the SMN1 sequence is absent, as in an affected SMA sample. Other investigators have previously reported successful reduction of cross-reacting fluorescent signals by using unlabeled SMN2 probes as a blocker, in combination with a labeled SMN1 probe with a minor grove binder group at the 3′ end. We opted for an alternative approach to achieve the required analytical specificity by increasing the stringency of probe hybridization using a novel LNA probe. LNA oligonucleotides increase assay specificity through restriction of the ribose conformation in the oligonucleotide backbone, allowing the use of higher annealing temperatures. These shorter probes are known to improve the ability to discern single-nucleotide polymorphisms (26), such as those that distinguish SMN1 from SMN2. LNA probes therefore simultaneously increase both the specificity and sensitivity of the assay.

Another important concern in multiplexing PCR is the potential for different amplicons to compete for PCR reagents. Since TREC is present in a much lower concentration than SMN1, the effect of competition would be a decreased amplification for TREC. A serial dilution series for the SMN1 primers was analyzed to explore this possibility and showed no effect on the other multiplexed targets (TREC and RPP30). However, with DNA extracts of normal UCB samples and carrier cell lines, higher primer concentrations did increase the plateau fluorescence for SMN1, increasing visual discrimination from the baseline fluorescence of SMN1-absent SMA patients.

In addition to familiar instrumentation and multiplexing capability, another factor in developing an approach to SMA-NBS was the high prevalence of SMA carriers. In our assay, both normal and carrier SMN1 genotypes showed robust SMN1 amplification, and the difference in Cq was not sufficiently precise for reliable carrier identification. In contrast, all of the homozygous SMN1-negative samples failed to cross the cycle threshold, and they were clearly discriminated from samples with one or more SMN1 copies.

The determination of SMN2 copy number is an essential second-tier assay for following up screen-positive samples. It is the most informative prognostic marker and will guide selection criteria for clinical trials. SMN2 copy number may be determined by real-time qPCR (27) as well as other methods (28). Ideally, public health NBS laboratories could perform a single second-tier assay that would both confirm the absence of SMN1 and quantify the SMN2 copy number, thereby identifying newborns at high risk for infantile onset. Preliminary studies in our laboratories suggest that digital droplet PCR (29) will also be a useful platform for independent confirmation and characterization of SMA screen-positive samples.

The rapid and increasingly widespread implementation of SCID-NBS has ushered real-time PCR technology into the repertoire of NBS laboratories. Since its inception in 2008, SCID-NBS has been implemented in 25 US public health NBS programs, collectively identifying SCID at twice the previously estimated birth prevalence and achieving high survival rates in treated infants (11). This experience strongly suggests that SMA-NBS will be technically feasible and cost-efficient.

In conclusion, we developed a multiplexed real-time PCR assay to simultaneously measure TREC and screen for the absence of SMN1 in a single reaction-well. The addition of SMN1 genotyping to the TREC assay does not require new equipment or any changes in sample processing or the overall testing procedure. The additional reagent and supply costs beyond those of the current TREC assay are limited to the SMN1 primers and probe, which amount to less than 5 cents per test. The assay allows clear identification of the SMN1 null genotype without quantifying copy number, thereby avoiding carrier detection. NBS programs screening for SCID will require evidence of effective presymptomatic intervention in newborns with SMA before combining the 2 tests into routine screening. However, as soon as an effective therapy becomes available, SMA-NBS could be readily implemented alone or in combination with TREC measurements by public health programs already using real-time PCR to screen for SCID.

Supplementary Material

Suppl Fig 1
Suppl Fig 2

Acknowledgments

Research Funding: CDC Foundation through an agreement with Biogen-Idec; G.K. Yazdanpanah, Biogen Idec through the CDC Foundation.

Role of Sponsor: The funding organizations played a role in the design of study, choice of enrolled patients, review and interpretation of data, and preparation and final approval of manuscript.

Footnotes

Disclaimer: The findings and conclusions in this study are those of the authors and do not necessarily represent the views of the US Department of Health and Human Services, or the US Centers for Disease Control and Prevention. Use of trade names and commercial sources is for identification only and does not constitute endorsement by the US Department of Health and Human Services, or the US Centers for Disease Control and Prevention.

5

Nonstandard abbreviations: SMA, spinal muscular atrophy; SMN, survival of motor neuron; DBS, dried blood spot; NBS, newborn blood spot screening; SCID, severe combined immunodeficiency; TREC, T-cell receptor excision circles; UCB, umbilical cord blood; Cq, quantification cycle value; LNA, locked nuclei acids.

6

Human genes: SMN1, survival of motor neuron 1, telomeric; SMN2, survival of motor neuron 2, centromeric; RPP30, ribonuclease P/MRP 30kDa subunit.

Author Contributions: All authors confirmed they have contributed to the intellectual content of this paper and have met the following 3 requirements: (a) significant contributions to the conception and design, acquisition of data, or analysis and interpretation of data; (b) drafting or revising the article for intellectual content; and (c) final approval of the published article.

Authors’ Disclosures or Potential Conflicts of Interest: Upon manuscript submission, all authors completed the author disclosure form. Disclosures and/or potential conflicts of interest:

Employment or Leadership: J.F. Staropoli, Biogen Idec; J.P. Carulli, Biogen Idec; H. Hannon, Clinical and Laboratory Standards Institute.

Consultant or Advisory Role: None declared.

Stock Ownership: J.F. Staropoli, Biogen Idec; J.P. Carulli, Biogen Idec.

Honoraria: None declared.

Expert Testimony: None declared.

Patents: None declared.

Other Remuneration: H. Hannon, CDC Foundation, Travel SMA Meeting, DC.

References

  • 1.Arnold WD, Burghes AH. Spinal muscular atrophy: development and implementation of potential treatments. Ann Neurol. 2013;74:348–62. doi: 10.1002/ana.23995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Tiziano FD, Melki J, Simard LR. Solving the puzzle of spinal muscular atrophy: what are the missing pieces? Am J Med Genet A. 2013;161A:2836–45. doi: 10.1002/ajmg.a.36251. [DOI] [PubMed] [Google Scholar]
  • 3.Crawford TO, Paushkin SV, Kobayashi DT, Forrest SJ, Joyce CL, Finkel RS, et al. Evaluation of SMN protein, transcript, and copy number in the Biomarkers for Spinal Muscular Atrophy (BforSMA) clinical study. PLoS One. 2012;7:e33572. doi: 10.1371/journal.pone.0033572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Porensky PN, Burghes AH. Antisense oligonucleotides for the treatment of spinal muscular atrophy. Hum Gene Ther. 2013;24:489–98. doi: 10.1089/hum.2012.225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Isis pharmaceuticals. Severe and rare. http://www.isispharm.com/Pipeline/Therapeutic-Areas/SevereandRare.htm#ISIS-SMNRx (Accessed December 2014)
  • 6.Trophos. Trophos announces top-line results of pivotal trial of olesoxime in spinal muscular atrophy. http://www.trophos.com/news/pr20140310.htm (Accessed December 2014)
  • 7.Prior TW. Spinal muscular atrophy: a time for screening. Curr Opin Pediatr. 2010;22:696–702. doi: 10.1097/MOP.0b013e32833f3046. [DOI] [PubMed] [Google Scholar]
  • 8.Pyatt RE, Prior TW. A feasibility study for the newborn screening of spinal muscular atrophy. Genet Med. 2006;8:428–37. doi: 10.1097/01.gim.0000227970.60450.b2. [DOI] [PubMed] [Google Scholar]
  • 9.Buckley RH. The long quest for neonatal screening for severe combined immunodeficiency. J Allergy Clin Immunol. 2012;129:597–604. doi: 10.1016/j.jaci.2011.12.964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.CLSI. Newborn blood spot screening for severe combined immunodeficiency by measurement of T-cell receptor excision circles; draft guideline. Wayne (PA): CLSI; 2013. CLSI document I/NBS06-A [1-56238-871-1 (print); 1-56238-872-X (electronic) [Google Scholar]
  • 11.Baker MW, Grossman WJ, Laessig RH, Hoffman GL, Brokopp CD, Kurtycz DF, et al. Development of a routine newborn screening protocol for severe combined immunodeficiency. J Allergy Clin Immunol. 2009;124:522–7. doi: 10.1016/j.jaci.2009.04.007. [DOI] [PubMed] [Google Scholar]
  • 12.Gerstel-Thompson JL, Wilkey JF, Baptiste JC, Navas JS, Pai SY, Pass KA, et al. High-throughput multiplexed T-cell-receptor excision circle quantitative PCR assay with internal controls for detection of severe combined immunodeficiency in population-based newborn screening. Clin Chem. 2010;56:1466–74. doi: 10.1373/clinchem.2010.144915. [DOI] [PubMed] [Google Scholar]
  • 13.Kwan A, Church JA, Cowan MJ, Agarwal R, Kapoor N, Kohn DB, et al. Newborn screening for severe combined immunodeficiency and T-cell lymphopenia in California: results of the first 2 years. J Allergy Clin Immunol. 2013;132:140–50. doi: 10.1016/j.jaci.2013.04.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Vogel BH, Bonagura V, Weinberg GA, Ballow M, Isabelle J, DiAntonio L, et al. Newborn screening for SCID in New York State: experience from the first two years. J Clin Immunol. 2014;34:289–303. doi: 10.1007/s10875-014-0006-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Modell V, Knaus M, Modell F, Roifman C, Orange J, Notarangelo LD. Global overview of primary immunodeficiencies: a report from Jeffrey Modell Centers worldwide focused on diagnosis, treatment, and discovery. Immunol Res. 2014;60:132–44. doi: 10.1007/s12026-014-8498-z. [DOI] [PubMed] [Google Scholar]
  • 16.Chan K, Davis J, Pai SY, Bonilla FA, Puck JM, Apkon M. A Markov model to analyze cost-effectiveness of screening for severe combined immunodeficiency (SCID) Mol Genet Metab. 2011;104:383–9. doi: 10.1016/j.ymgme.2011.07.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Modell V, Knaus M, Modell F. An analysis and decision tool to measure cost benefit of newborn screening for severe combined immunodeficiency (SCID) and related T-cell lymphopenia. Immunol Res. 2014;60:145–52. doi: 10.1007/s12026-014-8485-4. [DOI] [PubMed] [Google Scholar]
  • 18.US Department of Health and Human Services. Discretionary Advisory Committee on Heritable Disorders in Newborns and Children. recommended uniform screening panel. doi: 10.1038/gim.2013.98. http://www.hrsa.gov/advisorycommittees/mchbadvisory/heritabledisorders/recommendedpanel/index.html (Accessed December 2014) [DOI] [PubMed]
  • 19.Benkhelifa-Ziyyat S, Besse A, Roda M, Duque S, Astord S, Carcenac R, et al. Intramuscular scAAV9-SMN injection mediates widespread gene delivery to the spinal cord and decreases disease severity in SMA mice. Mol Ther. 2013;21:282–90. doi: 10.1038/mt.2012.261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Nikolai A, Naryshkin NA, Weetall M, Dakka A, Narasimhan J, Zhao X, Feng Z, et al. SMN2 splicing modifiers improve motor function and longevity in mice with spinal muscular atrophy. Science. 2014;345:688–93. doi: 10.1126/science.1250127. [DOI] [PubMed] [Google Scholar]
  • 21.Dobrowolski SF, Pham HT, Downes FP, Prior TW, Naylor EW, Swoboda KJ. Newborn screening for spinal muscular atrophy by calibrated short-amplicon melt profiling. Clin Chem. 2012;58:1033–9. doi: 10.1373/clinchem.2012.183038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pyatt RE, Mihal DC, Prior TW. Assessment of liquid microbead arrays for the screening of newborns for spinal muscular atrophy. Clin Chem. 2007;53:1879–85. doi: 10.1373/clinchem.2007.092312. [DOI] [PubMed] [Google Scholar]
  • 23.Lin Z, Suzow JG, Fontaine JM, Naylor EW. A high throughput beta-globin genotyping method by multiplexed melting temperature analysis. Mol Genet Metab. 2004;81:237–43. doi: 10.1016/j.ymgme.2003.12.007. [DOI] [PubMed] [Google Scholar]
  • 24.Chan K, Puck J. Development of population-based newborn screening for severe combined immunodeficiency. J Allergy Clin Immunol. 2005;115:391–8. doi: 10.1016/j.jaci.2004.10.012. [DOI] [PubMed] [Google Scholar]
  • 25.De Jesus VR, Mei JV, Bell CJ, Hannon WH. Improving and assuring newborn screening laboratory quality worldwide: thirty-year experience at the Centers for Disease Control and Prevention. Semin Perinatol. 2010;34:125–33. doi: 10.1053/j.semperi.2009.12.003. [DOI] [PubMed] [Google Scholar]
  • 26.Vester B, Wengle J. LNA (locked nucleic acid): high-affinity targeting of complementary RNA and DNA. Biochemistry. 2004;43:13233–41. doi: 10.1021/bi0485732. [DOI] [PubMed] [Google Scholar]
  • 27.Anhuf D, Eggermann T, Rudnik-Schoneborn S, Zerres K. Determination of SMN1 and SMN2 copy number using TaqMan technology. Hum Mutat. 2003;22:74–8. doi: 10.1002/humu.10221. [DOI] [PubMed] [Google Scholar]
  • 28.McAndrew PE, Parsons DW, Simard LR, Rochette C, Ray PN, Mendell JR, Prior TW, Burghes AM. Identification of proximal spinal muscular atrophy carriers and patients by analysis of SMNT and SMNC gene copy number. Am J Hum Genet. 1997;60:1411–22. doi: 10.1086/515465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.McDermott GP, Do D, Litterst CM, Maar D, Hindson CM, Steenblock ER, et al. Multiplexed target detection using DNA-binding dye chemistry in droplet digital PCR. Anal Chem. 2013;85:11619–27. doi: 10.1021/ac403061n. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Suppl Fig 1
NIHMS920732-supplement-Suppl_Fig_1.tif (72.2KB, tif)
Suppl Fig 2
NIHMS920732-supplement-Suppl_Fig_2.tif (47.8KB, tif)

RESOURCES