Abstract
Campylobacter jejuni is one of the most common causes of foodborne diseases worldwide. There are few reports on Campylobacter strains isolated from Latin-American countries. Here, 140 C. jejuni strains isolated from cloacal and transport boxes swabs, water from chiller tanks, and broiler carcasses of five poultry companies in Southern Brazil were identified using phenotypic and genotypic methods. Polymerase chain reaction (PCR) was used to analyze eight C. jejuni virulence markers: flaA, cadF, and invasion-associated (iam) genes, cdtABC operon (associated with the cytolethal distending toxin), and plasmidial virB11 and wlaN genes were present in 78.5%, 77.8%, 0%, 74.2%, 22.1%, and 10.7% of samples, respectively. There were 25 different virulence profiles: 1 (cdtA, cdtB, cdtC, flaA, and cadF), 2 (cdtA, cdtB, cdtC, flaA, cadF, and virB11), and 3 (cdtA, cdtB, cdtC, flaA, cadF, and wlaN) were the most common (> 60% of strains). We provide insight into factors related to the occurrence of this pathogen and their epidemiology.
Subject terms: Bacterial pathogenesis, Infectious-disease epidemiology
Introduction
Campylobacter spp. are widespread in nature and are commensal organisms, present in the gut of many birds and domestic animals. However, campylobacteriosis is a globally distributed disease that has a significant impact on public health1–3. Currently, there are 17 species and six subspecies assigned to the genus Campylobacter, of which the most frequently reported to cause human diseases are C. jejuni (subspecies jejuni) and C. coli3. Infections by C. jejuni are one of the most common causes of foodborne diarrheal illness in humans1–3. Other clinical presentations of Campylobacter infection include meningitis, septicemia, localized extraintestinal infections, reactive arthritis or Reiter’s syndrome4,5, and immune-reactive complications, such as Guillain–Barré Syndrome (GBS), and its variant, Miller Fisher Syndrome (MFS)6,7.
Campylobacter can enter the food chain of humans in different ways, and poultry products are considered the most important source of C. jejuni infection in humans2,8,9. The development of the poultry industry, due to the improvements obtained in the genetics of birds, and also in the nutrition and management systems, enables a large-scale poultry production. However, high density and confinement systems favor the introduction and spread of pathogens. Human infection may occur by consumption of raw or undercooked poultry, or by cross-contamination with C. jejuni from these products2,10–12. The slaughter stages that are considered critical contamination points are scalding, plucking, evisceration, washing, and chilling12.
Despite its public health importance, virulence factors and mechanisms of C. jejuni pathogenesis remain poorly studied in Latin-American countries13, especially regarding their occurrence among poultry companies and the different sources of isolation throughout the slaughtering process. The majority of virulence factors are associated with motility, chemotaxis, adhesion and colonization of intestinal epithelial cells, invasion and translocation capabilities, production of toxins and secreted proteins, and other mechanisms essential for bacterial survival14,15. Other pathogenic mechanisms, such as the production of enterotoxins and cytotoxins, and the ability to adhere and invade epithelial cells, have been proposed to play a role in enteritis16,17. The cytolethal distending toxin (CDT) holotoxin consists of three subunits encoded by the genes cdtA, cdtB, and cdtC, which are genetically arranged as an operon18,19. The expression of all three cdt genes is required for maximum toxin activity20. The cdtA and cdtC gene products are two subunits responsible for toxin binding to the cell membrane and for the delivery of the cdtB gene product (CdtB), which is the enzymatically active subunit14.
Campylobacter exhibits bipolar flagella composed of a hook–basal body complex, which is composed of several different proteins, and the extracellular filament structural components, which are composed of a major flagellin protein, FlaA (coded by flaA), and a minor flagellin protein, FlaB (coded by flaB)14. The flaA gene seems to be highly conserved among Campylobacter isolates, and its transcription level is usually higher than that of flaB11,21. Thus, flagella are crucial for the attachment to intestinal epithelial cells and are involved not only in motility and chemotaxis, but also in the secretion of virulence proteins, autoagglutination, microcolony formation, and avoidance of the innate immune response22. The cadF (Campylobacter adhesion to fibronectin F) gene encodes an adhesion and fibronectin-binding protein involved in the process of invasion, influencing the microfilament organization in host cells14,23. Another virulence gene linked to Campylobacter invasiveness is the invasion-associated marker (iam) gene24. It has been suggested that the pVir plasmid, which encodes for proteins of a type IV secretion system, and the mutation of the plasmid virB11 gene results in a reduced adherence and invasion potential in vitro, as well as in less severe symptoms in vivo25. The wlaN gene is presumably involved in the expression of ganglioside mimics in Guillain–Barré Syndrome and may encode β-1,3-galactosyltransferases with identical enzymatic activities26,27.
Considering that Campylobacter may be transferred from animals to humans, and that poultry is its main reservoir2,8, it is important to know the genetic profile of circulating strains in broiler populations and whether all Campylobacter isolates obtained from different companies and sources of isolation have the same virulence potential. In addition, many aspects concerning epidemiology, public health significance, and risk assessment studies are recent and still poorly known in Brazil, and there are no Brazilian legal standards established regarding Campylobacter presence or counts in food products. The purpose of this study was to determine whether eight genes previously identified as coding pathogenic markers in Campylobacter were present in the 140 samples obtained from several broiler sources and collected from five poultry companies using polymerase chain reaction (PCR).
Results
Out of a total of 140 screened samples, all of them were confirmed as having Campylobacter jejuni species. This method is based on the detection of 16S rRNA and mapA genes. The occurrence of the virulence factor genes flaA, cadF, iam, virB11, wlaN, and the gene cluster cdtABC was analyzed, and the virulence profiles that were observed are described in Table 1. Distribution of C. jejuni strains has shown 25 different virulence profiles. Profiles 1 (cdtA, cdtB, cdtC, flaA, and cadF), 2 (cdtA, cdtB, cdtC, flaA, cadF, and virB11), and 3 (cdtA, cdtB, cdtC, flaA, cadF, and wlaN) were the most common, representing 30% (42/140), 20% (28/140), and 10.7% (15/140) of the strains, respectively. Together, these three profiles represented more than 60% of the strains. The distribution of profiles according to the poultry company is described in Table 1. For companies A, D, and E, the most common profile was 1, corresponding to 36%, 37.5%, and 80% of the strains, respectively. For company B, profile 2 was the most common (33%), and for company C, profiles 3 (26.4%) and 1 (24.5%) were the most common.
Table 1.
Distribution of virulence profile among Campylobacter jejuni strains.
Profile number | Virulence profile | Distribution | Distribution according to the poultry company % (n) | |||||
---|---|---|---|---|---|---|---|---|
n = 140 | % | A (n = 25) | B (n = 15) | C (n = 53) | D (n = 42) | E (n = 5) | ||
1 | cdtA, cdtB, cdtC, flaA, cadF | 42 | 30,0 | 36 (9) | 6.7 (1) | 24.5 (13) | 35.7 (15) | 80 (4) |
2 | cdtA, cdtB, cdtC, flaA, cadF, virB11 | 28 | 20,0 | 16 (4) | 33 (5) | 11.3 (6) | 30.9 (13) | 0 |
3 | cdtA, cdtB, cdtC, flaA, cadF, wlaN | 15 | 10,7 | 0 | 0 | 26.4 (14) | 0 | 20 (1) |
4 | cdtA, cdtB, cdtC, cadF | 9 | 6,4 | 4 (1) | 0 | 1.9 (1) | 9.5 (4) | 0 |
5 | cdtA, cdtB, cdtC, flaA | 6 | 4,3 | 4 (1) | 0 | 5.7 (3) | 9.5 (4) | 0 |
6 | cdtA, cdtB, cdtC | 5 | 3,6 | 0 | 6.7 (1) | 7.5 (4) | 2.4 (1) | 0 |
7 | cdtA, cdtC, flaA, cadF | 4 | 2,9 | 16 (4) | 0 | 7.5 (4) | 0 | 0 |
8 | cdtB, cdtC | 4 | 2,9 | 0 | 0 | 3.8 (2) | 0 | 0 |
9 | cdtA, cdtC | 3 | 2,1 | 0 | 6.7 (1) | 0 | 0 | 0 |
10 | cdtA, cdtC, cadF | 3 | 2,1 | 0 | 6.7 (1) | 0 | 4.8 (2) | 0 |
11 | flaA | 3 | 2,1 | 4 (1) | 6.7 (1) | 1.9 (1) | 0 | 0 |
12 | cdtA, flaA, cadF | 2 | 1,4 | 4 (1) | 6.7 (1) | 0 | 0 | 0 |
13 | cdtB, cdtC, flaA | 2 | 1,4 | 4 (1) | 0 | 1.9 (1) | 0 | 0 |
14 | cdtC, flaA | 2 | 1,4 | 0 | 0 | 1.9 (1) | 2.4 (1) | 0 |
15 | cdtC | 2 | 1,4 | 0 | 6.7 (1) | 0 | 2.4 (1) | 0 |
16 | flaA, cadF | 1 | 0,7 | 0 | 0 | 0 | 2.4 (1) | 0 |
17 | cdtC, flaA, cadF | 1 | 0,7 | 4 (1) | 0 | 0 | 0 | 0 |
18 | cdtA, cdtC, flaA, cadF, virB11 | 1 | 0,7 | 0 | 6.7 (1) | 0 | 0 | 0 |
19 | cadF, virB11 | 1 | 0,7 | 0 | 6.7 (1) | 0 | 0 | 0 |
20 | flaA, cadF, virB11 | 1 | 0,7 | 0 | 6.7 (1) | 0 | 0 | 0 |
21 | cdtB, cdtC, cadF | 1 | 0,7 | 0 | 0 | 1.9 (1) | 0 | 0 |
22 | cdtA, flaA | 1 | 0,7 | 0 | 0 | 1.9 (1) | 0 | 0 |
23 | cdtA | 1 | 0,7 | 4 (1) | 0 | 0 | 0 | 0 |
24 | cdtB | 1 | 0,7 | 0 | 0 | 1.9 (1) | 0 | 0 |
25 | No virulence genes detected | 1 | 0,7 | 4 (1) | 0 | 0 | 0 | 0 |
The results showed that only one strain did not present any virulence markers. A total of 61.4% (86/140) of C. jejuni strains possessed five or six virulence determinants, 24.3% (34/140) presented three or four virulence-associated genes and the presence of one or two genes was detected in 13.6% (19/140) of isolates. No strain had more than six virulence markers.
The cytotoxin-encoding cluster cdtABC was detected in 74.3% (104/140) of the isolates. The frequency rates found for cdtA, cdtB, and cdtC were 85% (119/140), 80% (112/140), and 92.1% (129/140), respectively. The flaA and cadF genes were found in 78.6% (110/140) and 77.9% (109/140) of the strains, respectively. The virB11 and wlaN genes were significantly (p = 0.0001) less frequent, and were detected in 22.1% (31/140) and 10.7% (15/140) of strains, respectively. Moreover, iam was not detected in any of the investigated strains.
The PCR detection results of eight virulence-associated genes are described in Tables 2 and 3, according to the source and company from which they were isolated. The comparison among isolation sources has shown no significant differences, regardless the virulence gene (Table 2). Significant differences in gene frequency among the isolation companies were observed for virB11 between companies B and C (p = 0.0013); in addition, cdtB were significantly less common in company B (p = 0.002) (Table 3).
Table 2.
Distribution of virulence markers among Campylobacter jejuni strains, according to the source of isolation.
Source of isolation | Frequency (%) of positive of strains (n/N) | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
flaA | cadF | cdtA | cdtB | cdtC | cdtABC | iam | virB11 | wlaN | ||
Cloacal swab (n = 5) | 80 (4/5)a | 80 (4/5)a | 80 (4/5)a | 100 (5/5)a | 100 (5/5)a | 60 (3/5)a | 0 | 40 (2/5)a | 0 | |
Swab of broiler transportation cage (n = 3) | 66.7 (2/3)a | 100 (3/3)a | 100 (3/3)a | 66.7 (2/3)a | 100 (3/3)a | 66.7 (2/3)a | 0 | 0 | 33.3 (1/3)a | |
Broiler carcasses through slaughter process (n = 115) | Scalding (n = 3) | 66.7 (2/3)a | 33.3 (1/3)a | 66.7 (2/3)a | 33.3 (1/3)a | 33.3 (1/3)a | 33.3 (1/3)a | 0 | 0 | 0 |
Plucking (n = 9) | 100 (9/9)a | 100 (9/9)a | 100 (9/9)a | 100 (9/9)a | 100 (9/9)a | 100 (9/9)a | 0 | 33.3 (3/9)a | 33.3 (3/9)a | |
Evisceration (n = 7) | 85.7 (6/7)a | 71.4 (5/7)a | 85.7 (6/7)a | 85.7 (6/7)a | 85.7 (6/7)a | 85.7 (6/7)a | 0 | 28.6 (2/7)a | 0 | |
Spray-washing (n = 7) | 71.4 (5/7)a | 57.1 (4/7)a | 71.4 (5/7)a | 85.7 (6/7)a | 100 (7/7)a | 71.4 (5/7)a | 0 | 0 | 28.6 (2/7)a | |
Cooled carcasses (n = 49) | 77.6 (38/49)a | 79.6 (39/49)a | 83.7 (41/49)a | 75.5 (37/49)a | 89.8 (44/49)a | 69.4 (34/49)a | 0 | 16.3 (8/49)a | 12.2 (6/49)a | |
Cooled cuts (n = 40) | 80 (32/40)a | 80 (32/40)a | 92.5 (37/40)a | 87.5 (35/40)a | 97.5 (39/40)a | 87.5 (35/40)a | 0 | 32.5 (13/40)a | 0 | |
Chiller tank processing water (n = 17) | 70.6 (12/17)a | 70.6 (12/17)a | 70.5 (12/17)a | 70.6 (12/17)a | 88.2 (15/17)a | 52.9 (9/17)a | 0 | 17.6 (3/17)a | 17.6 (3/17)a |
Different letters in the same column indicate significant differences (p < 0.005) among source of isolation (Fisher’s exact test; adjusted p-value).
Table 3.
Distribution of virulence markers among Campylobacter jejuni strains, according to the poultry company.
Poultry company | Frequency (%) of positive of strains (n/N) | ||||||||
---|---|---|---|---|---|---|---|---|---|
flaA | cadF | cdtA | cdtB | cdtC | cdtABC | iam | virB11 | wlaN | |
A (n = 25) | 92 (23/25)a | 84 (21/25)a | 80 (20/25)a | 60 (15/25)a | 88 (22/25)a | 56 (14/25)a | 0 | 16 (4/25)a,b | 0 |
B (n = 15) | 66.7 (10/15)a | 73.3 (11/15)a | 73.3 (11/15)a | 46.7 (7/15)b | 73.3 (11/15)a | 46.7 (7/15)a | 0 | 53.3 (8/15)b | 0 |
C (n = 53) | 71.7 (38/53)a | 71.7 (38/53)a | 83 (44/53)a | 90.6 (48/53)a | 94.3 (50/53)a | 77.4 (41/53)a | 0 | 11.3 (6/53)a | 26.4 (14/53)a |
D (n = 42) | 81 (34/42)a | 81 (34/42)a | 92.9 (39/42)a | 88.1 (37/42)a | 97.6 (41/42)a | 88.1 (37/42)a | 0 | 31 (13/42)a,b | 0 |
E (n = 5) | 100 (5/5)a | 100 (5/5)a | 100 (5/5)a | 100 (5/5)a | 100 (5/5)a | 100 (5/5)a | 0 | 0 | 20 (1/5)a |
Different letters in the same column indicate significant differences (p < 0.010) among poultry companies (Fisher’s exact test; adjusted p-value).
Discussion
The purpose of this study was to determine the presence of C. jejuni virulence markers as indicators of the potential role of these strains in the pathogenesis of human diseases. An understanding of the epidemiology of all foodborne zoonotic agents is essential for the implementation of control strategies and interventions28. Phylogenetic studies have demonstrated a large heterogeneity among isolates of the same species, with the absence of clones, indicating a high level of diversity of circulating genotypes29. Previous studies have demonstrated the increased pathogenic potential of Campylobacter jejuni isolates from Brazilian poultry during the last decade30. In the present study, the identification and frequency of this pathogen throughout the slaughter line revealed potential virulence-associated markers, emphasizing the zoonotic risk of avian-derived Campylobacter strains.
Similar to previous reports31, the flaA gene presented a high frequency (78.6%) in this study. The bacterial flagellum and the virulence-associated injectisome are complex and structurally related to nanomachines that bacteria use for locomotion or the translocation of virulence factors into eukaryotic host cells32. It has been suggested that Campylobacter can survive under strong acid-shock conditions, and this is linked with the increased transcription of a subset of flagellar biosynthetic genes and stress responses, as well as the downregulation of genes involved in cell division and metabolism33. The flagellum not only has a distinct function in bacterial motility and cell binding, but also acts as a type III secretion system (T3SS)9,34. Flagellin is a potent activator of a broad range of host cell types involved in innate and adaptive immunity35. Rizal et al.17 examined the presence of the flaA factor in C. jejuni and C. coli derived from chicken and human isolates and obtained a 100% prevalence. Other authors have examined the presence of factors in C. jejuni and C. coli derived from humans, poultry meat, broiler, and bovine feces and obtained similar results24. Datta et al.27 also determined this factor in a group of 111 C. jejuni strains isolated from different sources and found that all of them were positive. Previous reports in Brazil have indicated that flaA is present in approximately 80% of Campylobacter spp. isolates from human and poultry samples30,36.
Another virulence gene examined in this study was cadF, one of the markers determining the adherence of Campylobacter. This gene was present in 77.9% of the isolates analyzed, similarly to previously reported results37–39. Previous reports in Japan, Australia, India, Poland, and Brazil have indicated that cadF is present in almost all C. jejuni isolates from poultry samples17,24,27,30,35. This gene encodes an adhesion factor used by C. jejuni to attach and, eventually, invade mammalian cells by binding to fibronectin, a component of the extracellular matrix34,35. Investigations reported that ΔcadF mutant strains were not able to colonize the gut of chickens40. Monteville et al.23 verified that the adhesion and transmigration of ΔcadF mutant strain to human INT-407 cells was reduced by 50%, when compared to a wild-type strain. Thus, the cadF gene, which appears to be essential for chicken gut colonization, may presumably have a similar role in the pathogenesis of human infection41. This gene is also an important mediator of material and information transfers between cells and their environment, and between compartments within cells. These surface-exposed proteins are conserved in C. jejuni strains and are also highly immunogenic in chicks42.
A bacterial toxin, CDT, may potentially play a role in disease development. This cytotoxin arrests eukaryotic cells to the G2 phase of the cell cycle, preventing them from entering mitosis, and leading to cell death. The toxin was named according to the morphological changes associated with its cytoplasmic distension action and its function is well documented8,43. In the present study, 74.3% of the C. jejuni strains carried the cdt complex. Datta et al.27 detected a 100% frequency of these genes in their studied samples, which included chicken feces, cattle feces, and human clinical samples. Rozynek et al.41 found a 100% prevalence in isolates from broiler carcasses. More than 76% of samples isolated from different sources were positive for cdtA, cdtB, and cdtC24. Previous studies have demonstrated extremely high rates of occurrence of this complex in C. jejuni isolated from several sources, including humans and poultry35,44. In Brazil, there are few studies on CDT in C. jejuni. Carvalho et al.45 stated that only 36.4% of C. jejuni samples from Brazilian broiler carcasses contained the CDT complex. In contrast, Melo et al.30 showed that almost all Campylobacter strains presented the cdt complex.
A significant percentage of C. jejuni carries the virB11 gene localized on the pVir plasmid. The pVir plasmid encodes several genes that are homologous to a type IV secretion system and contributes to the ability of Campylobacter jejuni subsp. jejuni 81–176 to invade INT–407 cells in vitro, a marker that was correlated with virulence in a diarrheal disease ferret model25,46. Moreover, other studies showed both an association47 and a lack of association48 between the pVir plasmid and bloody diarrhea in C. jejuni enteritis. We found this gene in 22.1% of C. jejuni isolates. The occurrence of virB11 varies among studies. In 2008, Wieczorek and Osek24 detected this gene in 18.5% of strains. Ten years later, the same authors found this gene in less than 5% of strains35. A small percentage of this marker in poultry samples has also been reported by other authors27,41. The reasons underlying this significant variation are still unknown.
The iam gene is a genetic marker that is preferentially associated with adherence and invasion of HEp–2 cells in vitro49. There is a good correlation between the clinical presentation of diarrhea and the isolation of Campylobacter strains that adhere to and invade HEp–2 cells. However, the involvement and function of the iam marker in the process of campylobacteriosis have not been precisely explained17,50. In this study, the iam sequence was not detected in any of the investigated isolates. Rozynek et al.41 detected this gene in 53.8% of C. jejuni samples isolated from chickens. The presence of this molecular marker is not restricted to C. jejuni, but is also present in C. coli and C. lari. Wieczorek and Osek24 showed the presence of this gene in 66% of the investigated strains. It was found that the marker was predominant in C. coli (82.9% of the isolates were positive), whereas only 46.7% of C. jejuni strains possessed this gene. The variable occurrence depends not only on the origin, but also on the isolated Campylobacter species. The fact that in some invasive strains the gene was not identified using PCR supports the existence of important polymorphisms and high heterogeneity in the iam locus or suggests that other genetic markers of invasion may occur in different loci45. The genetic characterization of C. jejuni through whole-genome sequencing (WGS) would probably result in the detection of this marker. Previous studies have detected iam in 99% of Campylobacter strains, showing that WGS has a high discriminatory power for this genus51.
The wlaN gene is involved in variations of the lipooligosaccharide structure, facilitating the avoidance of C. jejuni in the host immune system. Our results showed that this marker was present in 10.7% of the tested C. jejuni strains. According to the investigation by Datta et al.27, this gene was present in 4.7% of isolates from broiler feces and in 23.8% of poultry meat isolates. The presence of the gene can vary depending on the geographic area and on the high rate of polymorphisms within C. jejuni strains. Koga et al.50 reported that the genetic polymorphism of C. jejuni determines the reactivity of autoantibodies and the clinical presentation of the Guillain–Barré syndrome, possibly through the modification of the host molecule mimic. Importantly, these positive isolates may have a higher pathogenic potential, and therefore, a higher capacity to induce autoimmune disease in their hosts. A previous study showed a correlation between an increased capacity of cell invasion (in vitro and in vivo), and the presence of the wlaN gene, since 80% of the strains that lack this gene presented a lower or a total lack of invasiveness52.
Table 4 summarizes the occurrence of virulence markers among species (human, poultry, swine, and cattle). The relative frequencies of virulence genes observed in C. jejuni strains in the present study were similar or slightly lower than those observed in other species. These results indicate that strains isolated from poultry sources are potential carriers of virulence genes to humans.
Table 4.
Relative Frequencies (%) of virulence markers in Campylobacter jejuni strains isolated from several sources found in other publications compared to the results of this current study.
Virulence markers | Source of isolation | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Human | Cattle | Swine | Poultry | |||||||||
31 | 57 | 46 | 58 | 46 | 58 | 59 | 59 | 31a | 46 | 30b | This study | |
cdtA | 100 | 90 | – | – | – | – | 100 | 100 | 96.2 | – | – | 85 |
cdtB | 100 | 90 | 100 | 96.1 | 100 | 96.7 | 100 | 100 | 98.1 | 100 | – | 80 |
cdtC | 100 | 90 | – | – | – | – | 100 | 80 | 96.8 | – | – | 92.1 |
cdtABC | – | 88.7 | – | – | – | – | 86.7 | 80 | – | – | 97.7 | 74.3 |
cadF | 100 | 97.9 | – | 98 | – | 81.4 | 100 | 100 | 98.7 | – | 97.7 | 77.9 |
flaA | 100 | – | – | – | – | – | 100 | 100 | 98.7 | – | 84.1 | 78.6 |
virB11 | 4.5 | – | 3.6 | 2 | 0 | 16.7 | 6.7 | 0 | 0 | 7.3 | – | 22.1 |
wlaN | 17.4 | – | – | – | – | – | – | 12.5 | – | – | 10.7 | |
iam | 15.5 | 4 | – | 98 | – | 81.4 | – | 8.9 | – | – | 0 |
aResults for strains isolated from poultry carcasses only.
bResults for strains isolated between 2015 and 2016 only.
It is important to note that the genetic characterization of C. jejuni, which is based on the molecular detection of genes, corresponds to a qualitative analysis. Thus, it is not possible to establish a linear relationship between the presence of the genes and in vivo virulence. However, molecular tools for virulence marker detection are essential to determine the genetic virulence profile of the strains circulating in poultry establishments and, thus, to determine specific control measures to mitigate the risks of dissemination. It is noteworthy that this study did not perform a temporal analysis of the data, and it is not known if the relative differences are stable over time or are restricted to the time of sample collection.
Brazil has an important position in the global trade market of chicken meat. However, unlike the European Union and United States, there is no specific legislation in the country for the analysis of Campylobacter. Moreover, campylobacteriosis is still underreported, and epidemiological and molecular studies on the diversity and virulence of C. jejuni are still few in the country29,53. Our results reinforce the urgent need for specific legislation adoption to prevent the spread of potentially pathogenic strains through the consumption of poultry products.
In conclusion, the present study revealed that eight potential pathogenicity genes of C. jejuni circulate in slaughter lines, among other poultry sources in Southern Brazil. The frequency of C. jejuni virulence markers, their relationship with clinical severity in humans, and the expression of virulence factors should be further investigated. The results provide more insight into factors related to the occurrence of this pathogen and in the understanding of their epidemiology.
Methods
Bacterial strains and growth conditions
This research was carried out in federally inspected slaughterhouses from five companies (A, B, C, D, and E) in Southern Brazil. A total of 20 visits were made to the processing plants. All selected establishments were representative of slaughterhouses located in the region; broilers were processed for production, with an average of 250,000 birds slaughtered per day, each having a standard live weight of 2.0 kg (4.4 lb). The processing line was operated under standard commercial conditions. In total, 980 samples were collected from swabs (cloacal and transportation boxes), water from the chiller tank, and carcasses throughout the slaughter line, as previously described by Borges et al.53. The samples were stored in isothermal ice boxes and taken to the laboratory for identification.
Buffered peptone water (BPW) (400 mL, 0.1%) was previously added to each carcass and manually shaken in a vigorous way for 1 min. An aliquot (1 mL) of each sample (swabs, water, and carcasses) was homogenized in Bolton broth (9 mL) supplemented with antimicrobials (cefoperazone 20 mg/L, vancomycin 20 mg/L, trimethoprim 20 mg/L, cycloheximide 50 mg/L; SR0183, Oxoid) and incubated under microaerophilic conditions using a gas tank with a mixture (10% CO2, 5% O2, and 85% N2) for 48 h at a temperature of 41.5 °C. After incubation, the suspension (100 µL) was spread onto an acetate mem deoxycholate agar (brane having 0.65-µm pores and placed on the surface of a modified charcoal cefoperazone mCCDA) plate with selective supplements (cefoperazone, 32 mg/L; amphotericin B, 10 mg/L; SR0155, Oxoid) for 30 min. The direct application of membrane filters to the surface of the plating media has been used to exclude unwanted microflora for the selective isolation of Campylobacter54. Due to its reduced pores, this membrane promotes the filtration of the suspension and provides a reduction of the bacterial contamination. The plate was incubated under microaerophilic conditions at 41.5 °C for 48 h. Campylobacter spp. suspected colonies (grayish, often with a metallic sheen, flat, and moist, with a tendency to spread)31 were examined for cell morphology by using phase-contrast microscopy. Subsequently, the isolates were purified using blood agar (BA) plates supplemented with 5% commercial sterile defibrinated sheep blood (Laborclin). Single colonies were picked and streaked onto BA plates, and preliminarily characterized based on their catalase reaction ability to hydrolyze hippurate and indoxyl acetate. The colonies were collected and suspended in ultrapure water (1 mL), transferred to a microtube, and frozen at − 20 °C. Isolates were stored in glycerol 15% at -80 °C. The species were determined using PCR55.
DNA extraction
The template DNA for PCR was extracted using an adapted protocol described by Borsoi et al.56. Bacterial culture (1 mL) was boiled at 95 °C for 10 min. After centrifugation at 8000×g for 2 min, the supernatants were stored at − 20 °C and used as template DNA. The isolates were confirmed by using PCR based on the detection of the 16S rRNA and mapA genes55.
PCR primer design and amplification
The confirmed Campylobacter jejuni isolates were screened for the presence of eight pathogenic genes: flaA, cadF, iam, virB, wlaN, cdtA, cdtB, and cdtC. The primers, PCR conditions, and the length of the products generated in this study are listed in Table 5. The PCR conditions were adapted from previous studies. All PCR amplifications were performed in a mixture (25 µL) consisting of 10 × PCR Buffer [3 µL; 200 mM Tris–HCl (pH 8.4), 500 mM KCl], Taq thermostable DNA polymerase (0.3 µL, 5 U/µL), MgCl2 (1.2 µL, 25 mM), dNTPs (2.5 µL, 2.5 mM), extracted template DNA (2 µL) and each of the primers (0.5 µL each, 10 pmol/L). Sterile Milli-Q water was added in sufficient quantity to achieve a volume of 25 µL. All amplification reactions were performed in a thermal cycler. The cycles were performed as described in Table 2. For the visualization of the PCR products, 10 µL aliquots were subjected to electrophoresis in a 2% agarose gel in Tris–acetylated EDTA (TAE) buffer. DNA bands were stained with ethidium bromide for 2 h at 100 V, viewed under an ultraviolet transilluminator, and photographed. The size of the PCR amplicons was compared to that of the 100 bp DNA ladder.
Table 5.
List of primers and PCR conditions used in this study.
Target gene | Primers | Sequence (5′ → 3′ʼ) | PCR conditions | Product (bp) | Reference |
---|---|---|---|---|---|
16S-rRNA |
MD16S1 MD16S2 |
ATCTAATGGCTTAACCATTAAAC GGACGGTAACTAGTTTAGTATT |
95 °C/10 min, 35 cycles: 95 °C/30 s, 59 °C/90 s, 72 °C/1 min, and 72 °C/10 min | 857 | Campylobacter genus identification55,60 |
mapA |
MDmapA1 MDmapA2 |
CTATTTTATTTTTGAGTGCTTGTG GCTTTATTTGCCATTTGTTTTATTA |
589 | C. jejuni species identification55 | |
flaA |
flaAF flaAR |
GGATTTCGTATTAACACAAATGGTGC CTGTAGTAATCTTA AACATTTTG |
94 °C/5 min, 30 cycles: 94 °C/1 min, 48 °C/1 min, 72 °C/1 min, and 72 °C/5 min | 1700 | http://campynet.vetinst.dk/Fla.htm |
cadF |
F2B R1B |
TGGAGGGTAATTTAGATATG CTAATACCTAAAGTTGAAAC |
94 °C/5 min, 30 cycles: 94 °C/1 min, 54 °C/1 min, 72 °C/1 min, and 72 °C/5 min | 400 | 33 |
iam |
IAMF IAMR |
GCGCAAAATATTATCACCC TTCACGACTACTATGCGG |
94 °C/5 min, 30 cycles: 94 °C/1 min, 55 °C/1 min, 72 °C/1 min, and 72 °C/5 min | 518 | 49 |
virB11 |
virBF virBR |
GAACAGGAAGTGGAAAAACTAGC TTCCGCATTGGGCTATATG |
95 °C/5 min, 35 cycles: 95 °C/30 s, 53.5 °C/30 s, 72 °C/30 s, and 72 °C/5 min | 708 | 25 |
wlaN |
wlaN-DL39 Cj1139cF |
TTAAGAGCAAGATATGAAGGTG TGCTGGGTATACAAAGGTTGTG |
95 °C/10 min, 25 cycles: 95 °C/30 s, 60 °C/30 s, 72 °C/1 min, and 72 °C/5 min | 434 | 54 |
cdtA |
cdtAF cdtAR |
CCTTGTGATGCAAGCAATC ACACTCCATTTGCTTTCTG |
94 °C/5 min, 30 cycles: 94 °C/1 min, 49 °C/30 s, 72 °C/1 min, and 72 °C/5 min | 370 | 60 |
cdtB |
cdtBF cdtBR |
CAGAAAGCAAATGGAGTGTT AGCTAAAAGCGGTGGAGTAT |
94 °C/5 min, 30 cycles: 94 °C/1 min, 51 °C/30 s, 72 °C/1 min, and 72 °C/5 min | 620 | 27 |
cdtC |
cdtCF cdtCR |
CGATGAGTTAAAACAAAAAGATA TTGGCATTATAGAAAATACAGTT |
94 °C/5 min, 30 cycles: 94 °C/1 min, 47 °C/30 s, 72 °C/1 min, and 72 °C/5 min | 182 | 27 |
Statistical analysis
The obtained data were subjected to statistical analysis using the PASW Statistics software (IBM, Hong Kong). Descriptive statistics (frequency distribution) was used to determine the presence of the virulence genes according to the source and the poultry company from which the sample was isolated. Chi-square (χ2) and Fisher’s exact tests were used to compare the frequencies of virulence-associated genes among each other and among sources and companies from which samples were isolated. Statistical significance was defined at a p < 0.05, and Bonferroni correction was applied to adjust confidence intervals for multiple hypothesis testing. Adjusted p-values are indicated at each Table.
Acknowledgements
This research was supported by Coordination for the Improvement of Higher Education Personnel (CAPES) through the concession of a Ph.D. scholarship to the first author (Grant No. 5772/10-9). The authors also wish to acknowledge the Brazilian National Council for Scientific and Technological Development (CNPq) for its financial support through the concession of research Grants Numbers 578124/2008-4, 303086/2013-0 and 476092/2013-2.
Author contributions
Y.M.S.A., V.P.N., M.J.P.G., C.T.P.S. and H.L.S.M. conceived and designed the experiments. Y.M.S.A., G.P. and M.J.P.G. performed the experiments. Y.M.S.A., L.B.R., L.R.S., K.A.B. and T.Q.F. analyzed the data. Y.M.S.A., K.A.B. and T.Q.F. wrote and prepared the manuscript text. All authors (Y.M.S.A., G.P., L.B.R., L.R.S., K.A.B., T.Q.F., H.L.S.M., C.T.P.S., M.J.P.G. and V.P.N.) critically reviewed and approved the manuscript.
Data availability
The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Marcos José Pereira Gomes is deceased.
References
- 1.European Food Safety Authority, European Centre for Disease Prevention and Control The European union one health 2018 zoonoses report. EFSA J. 2019;17:1–276. doi: 10.2903/j.efsa.2019.5926. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Centers for Diseases Control and Prevention. Campylobacter (Campylobacteriosis). 2019. US Department of Health and Human Services, CDC, Atlanta, Georgia. https://www.cdc.gov/campylobacter/faq.html. Accessed 1 Feb 2019.
- 3.World Health Organization. Campylobacter. WHO, Geneva. http://www.who.int/news-room/fact-sheets/detail/campylobacter. Accessed 1 Feb 2019.
- 4.Rees JH, Soudain SE, Gregson NA, Hughes RA. Campylobacter jejuni infection and Guillain–Barré syndrome. N. Engl. J. Med. 1995;333:1374–1379. doi: 10.1056/NEJM199511233332102. [DOI] [PubMed] [Google Scholar]
- 5.Porter CK, Choi D, Riddle MS. Pathogen-specific risk of reactive arthritis from bacterial causes of foodborne illness. J. Rheumatol. 2013;40:712–714. doi: 10.3899/jrheum.121254. [DOI] [PubMed] [Google Scholar]
- 6.van den Berg B, et al. Guillain–Barre syndrome: pathogenesis, diagnosis, treatment and prognosis. Nat. Rev. Neurol. 2014;10:469–482. doi: 10.1038/nrneurol.2014.121. [DOI] [PubMed] [Google Scholar]
- 7.Wakerley BR, Uncini A, Yuki N. Guillain-Barré and Miller Fisher syndromes: new diagnostic classification. Nat. Rev. Neurol. 2014;10:537–544. doi: 10.1038/nrneurol.2014.138. [DOI] [PubMed] [Google Scholar]
- 8.Park SF. The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. Int. J. Food Microbiol. 2002;74:177–188. doi: 10.1016/S0168-1605(01)00678-X. [DOI] [PubMed] [Google Scholar]
- 9.Backert S, Hofreuter D. Molecular methods to investigate adhesion, transmigration, invasion and intracellular survival of the foodborne pathogen Campylobacter jejuni. J. Microbiol. Methods. 2013;95:8–23. doi: 10.1016/j.mimet.2013.06.031. [DOI] [PubMed] [Google Scholar]
- 10.Berrang ME, Buhr RJ, Cason JA, Dickens JA. Broiler carcass contamination with Campylobacter from feces during defeathering. J. Food Prot. 2001;64:2063–2066. doi: 10.4315/0362-028X-64.12.2063. [DOI] [PubMed] [Google Scholar]
- 11.Hermans D, et al. Colonization factors of Campylobacter jejuni in the chicken gut. Vet. Res. 2011;42:10–1186. doi: 10.1186/1297-9716-42-82. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.European Food Safety Authority Analysis of the baseline survey on the prevalence of Campylobacter in broiler batches and of Campylobacter and Salmonella on broiler carcasses in the EU, 2008. Part A. EFSA J. 2010;8:1503–1602. [Google Scholar]
- 13.Levican A, Ramos-Tapia I, Briceño I, Guerra F, Mena B, Varela C, Porte L. Genomic analysis of chilean strains of Campylobacter jejuni from human faeces. Biomed. Res. Int. 2019;8:1–12. doi: 10.1155/2019/1902732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Bolton DC. Campylobacter virulence and survival factors. Food Microbiol. 2015;48:99–108. doi: 10.1016/j.fm.2014.11.017. [DOI] [PubMed] [Google Scholar]
- 15.Biswas D, Townsend HG, Potter A, Allan BJ. Genes coding for virulence determinants of Campylobacter jejuni in human clinical and cattle isolates from Alberta, Canada, and their potential role in colonization of poultry. Int. Microbiol. 2011;14:25–32. doi: 10.2436/20.1501.01.132. [DOI] [PubMed] [Google Scholar]
- 16.Crushell E, Harty S, Sharif F, Bourke B. Enteric Campylobacter: purging its secrets? Pediatr. Res. 2004;55:3–12. doi: 10.1203/01.PDR.0000099794.06260.71. [DOI] [PubMed] [Google Scholar]
- 17.Rizal A, Kumar A, Vidyarthi AS. Prevalence of pathogenic genes in Campylobacter jejuni isolated from poultry and human. Int. J. Food Saf. 2010;12:29–34. [Google Scholar]
- 18.Asakura M, et al. Comparative analysis of cytolethal distending toxin (cdt) genes among Campylobacter jejuni, C. coli and C. fetus strains. Microb. Path. 2007;42:174–183. doi: 10.1016/j.micpath.2007.01.005. [DOI] [PubMed] [Google Scholar]
- 19.Pickett CL, et al. Prevalence of cytolethal distending toxin production in Campylobacter jejuni and relatedness of Campylobacter sp. cdtB gene. Infect. Immun. 1996;64:2070–2078. doi: 10.1128/IAI.64.6.2070-2078.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Martinez I, et al. Detection of cdtA, cdtB, and cdtC genes in Campylobacter jejuni by multiplex PCR. Int. J. Med. Microbiol. 2006;296:45–48. doi: 10.1016/j.ijmm.2005.08.003. [DOI] [PubMed] [Google Scholar]
- 21.Guerry P, Logan SM, Thornton S, Trust TJ. Genomic organization and expression of Campylobacter flagellin genes. J. Bacteriol. 1990;172:1853–1860. doi: 10.1128/JB.172.4.1853-1860.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Guerry P. Campylobacter flagella: not just for motility. Trends Microbiol. 2007;15:456–461. doi: 10.1016/j.tim.2007.09.006. [DOI] [PubMed] [Google Scholar]
- 23.Monteville MR, Yoon JE, Konkel ME. Maximal adherence and invasion of INT 407 cells by Campylobacter jejuni requires the CadF outer–membrane protein and microfilament reorganization. Microbiology. 2003;149:153–165. doi: 10.1099/mic.0.25820-0. [DOI] [PubMed] [Google Scholar]
- 24.Wieczorek K, Osek J. Identification of virulence genes in Campylobacter jejuni and C. coli isolates by PCR. Bull. Vet. Inst. Pulawy. 2008;52:211–216. [Google Scholar]
- 25.Bacon DJ, et al. Involvement of a plasmid in virulence of Campylobacter jejuni 81–176. Infect. Immun. 2000;68:4384–4390. doi: 10.1128/IAI.68.8.4384-4390.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Linton D, Lawson AJ, Owen RJ, Stanley J. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J. Clin. Microbiol. 1997;35:2568–2572. doi: 10.1128/JCM.35.10.2568-2572.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Datta S, Niwa H, Itoh K. Prevalence of 11 pathogenic genes of Campylobacter jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine faeces. J. Med. Microbiol. 2003;52:345–348. doi: 10.1099/jmm.0.05056-0. [DOI] [PubMed] [Google Scholar]
- 28.Wall PG. Essential veterinary education in food safety, food hygiene and biosecurity: a global perspective. Rev. Sci. Tech. 2009;28:493–501. doi: 10.20506/rst.28.2.1882. [DOI] [PubMed] [Google Scholar]
- 29.Melo RT, et al. Campylobacter jejuni and Campylobacter coli originated from chicken carcasses modulate their transcriptome to translate virulence genes in human cells. Pesq. Vet. Bras. 2019;39:592–599. doi: 10.1590/1678-5150-pvb-6031. [DOI] [Google Scholar]
- 30.Melo RT, et al. Evolution of Campylobacter jejuni of poultry origin in Brazil. Food Microbiol. 2019;82:489–496. doi: 10.1016/j.fm.2019.03.009. [DOI] [PubMed] [Google Scholar]
- 31.Wieczorek K, Wołkowicz T, Osek J. Antimicrobial resistance and virulence-associated traits of Campylobacter jejuni isolated from poultry food chain and humans with diarrhea. Front. Microbiol. 2018;9:1–11. doi: 10.3389/fmicb.2018.01508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Erhardt M, Namba K, Hughes KT. Bacterial nanomachines: The flagellum and type III injectisome. Cold Spring Harb. Perspect. Biol. 2010;2:a000299. doi: 10.1101/cshperspect.a000299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Le MT, et al. Acid–shock of Campylobacter jejuni induces flagellar gene expression and host cell invasion. Eur. J. Microbiol. Immunol. 2012;2:12–19. doi: 10.1556/EuJMI.2.2012.1.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Konkel ME, Kim BJ, Rivera-Amill V, Garvis SG. Identification of proteins required for the internalization of Campylobacter jejuni into cultured mammalian cells. Adv. Exp. Med. Biol. 1999;473:215–224. doi: 10.1007/978-1-4615-4143-1_22. [DOI] [PubMed] [Google Scholar]
- 35.Mizel SB, Bates JT. Flagellin as an adjuvant: Cellular mechanisms and potential. J. Immunol. 2010;185:5677–5682. doi: 10.4049/jimmunol.1002156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Quetz JDS, et al. Campylobacter jejuni infection and virulence-associated genes in children with moderate to severe diarrhea admitted to emergency rooms in northeastern Brazil. J. Med. Microbiol. 2012;61:507–513. doi: 10.1099/jmm.0.040600-0. [DOI] [PubMed] [Google Scholar]
- 37.Konkel ME, et al. Identification of a fibronectin-binding domain within the Campylobacter jejuni CadF protein. Mol. Microbiol. 2005;57:1022–1035. doi: 10.1111/j.1365-2958.2005.04744.x. [DOI] [PubMed] [Google Scholar]
- 38.Chansiripornchai N, Sasipreeyajan J. PCR detection of four virulence-associated genes of Campylobacter jejuni isolates from Thai broilers and their abilities of adhesion to and invasion of INT-407 cells. J. Vet. Med. Sci. 2009;71:839–844. doi: 10.1292/jvms.71.839. [DOI] [PubMed] [Google Scholar]
- 39.Elmal M, Can HY. Antimicrobial susceptibility and virulence-associated genes in Campylobacter isolates from milk and wastewater in Hatay, Turkey. Cienc. Rural. 2019;49:1–8. [Google Scholar]
- 40.Ziprin RL, et al. The absence of cecal colonization of chicks by a mutant of Campylobacter jejuni not expressing bacterial fibronectin–binding protein. Avian Dis. 1999;43:586–589. doi: 10.2307/1592660. [DOI] [PubMed] [Google Scholar]
- 41.Rozynek E, et al. Prevalence of potential virulence markers in Polish Campylobacter jejuni and Campylobacter coli isolates obtained from hospitalized children and from chicken carcasses. J. Med. Microbiol. 2005;54:615–619. doi: 10.1099/jmm.0.45988-0. [DOI] [PubMed] [Google Scholar]
- 42.Shoaf-Sweeney KD, Larson CL, Tang X, Konkel ME. Identification of Campylobacter jejuni proteins recognized by maternal antibodies of chickens. Appl. Environ. Microbiol. 2008;74:6867–6875. doi: 10.1128/AEM.01097-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Biswas D, et al. Effect of cytolethal distending toxin of Campylobacter jejuni on adhesion and internalization in cultured cells and in colonization of the chicken gut. Avian Dis. 2006;50:586–593. doi: 10.1637/7514-020706R1.1. [DOI] [PubMed] [Google Scholar]
- 44.González-Hein G, Huaracán B, García P, Figueroa G. Prevalence of virulence genes in strains of Campylobacter jejuni isolated from human, bovine and broiler. Braz. J. Microbiol. 2013;44:1223–1229. doi: 10.1590/S1517-83822013000400028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Carvalho AF, et al. Detection of cytolethal distending toxin genes in strains of Campylobacter jejuni isolated from broiler carcasses. Arq. Bras. Med. Vet. Zootec. 2010;62:1054–1061. doi: 10.1590/S0102-09352010000500006. [DOI] [Google Scholar]
- 46.Bacon DJ, et al. DNA sequence and mutational analyses of the pVir plasmid of Campylobacter jejuni 81–176. Infect. Immun. 2002;70:6242–6250. doi: 10.1128/IAI.70.11.6242-6250.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Louwen RPL, et al. Lack of association between the presence of the pVir plasmid and bloody diarrhea in Campylobacter jejuni enteritis. J. Clin. Microbiol. 2006;44:1867–1868. doi: 10.1128/JCM.44.5.1867-1868.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Tracz DM, et al. pVir and bloody diarrhea in Campylobacter jejuni enteritis. Emerg. Infect. Dis. 2005;11:839–843. doi: 10.3201/eid1106.041052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Carvalho AC, et al. Molecular characterization of invasive and noninvasive Campylobacter jejuni and Campylobacter coli isolates. J. Clin. Microbiol. 2001;39:1353–1359. doi: 10.1128/JCM.39.4.1353-1359.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Koga M, et al. Campylobacter gene polymorphism as a determinant of clinical features of Guillain-Barré syndrome. Neurol. 2005;65:1376–1381. doi: 10.1212/01.wnl.0000176914.70893.14. [DOI] [PubMed] [Google Scholar]
- 51.Redondo N, Carroll A, McNamara E. Molecular characterization of Campylobacter causing human clinical infection using whole-genome sequencing: Virulence, antimicrobial resistance and phylogeny in Ireland. PLoS ONE. 2019;14:1–11. doi: 10.1371/journal.pone.0219088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Müller J, Schulze F, Müller W, Hänel I. PCR detection of virulence–associated genes in Campylobacter jejuni strains with differential ability to invade Caco–2 cells and to colonize the chick gut. Vet. Microbiol. 2006;113:123–129. doi: 10.1016/j.vetmic.2005.10.029. [DOI] [PubMed] [Google Scholar]
- 53.Borges KA, et al. Detection and quantification of Campylobacter spp. in Brazilian poultry processing plants. J. Infect. Dev. Ctries. 2020;14:109–113. doi: 10.3855/jidc.11973. [DOI] [PubMed] [Google Scholar]
- 54.Chon JW, et al. Efficacy of syringe filtration for the selective isolation of Campylobacter from chicken carcass rinse. J. Food Prot. 2017;80:1050–1053. doi: 10.4315/0362-028X.JFP-16-470. [DOI] [PubMed] [Google Scholar]
- 55.Denis M, et al. Development of a m-PCR assay for simultaneous identification of Campylobacter jejuni and C. coli. Lett. Appl. Microbiol. 1999;29:406–410. doi: 10.1046/j.1472-765X.1999.00658.x. [DOI] [PubMed] [Google Scholar]
- 56.Borsoi A, et al. Inoculation of newly hatched broiler chicks with two Brazilian isolates of Salmonella Heidelberg strains with different virulence gene profiles, antimicrobial resistance, and pulsed field gel electrophoresis patterns to intestinal changes evaluation. Poult. Sci. 2009;88:750–758. doi: 10.3382/ps.2008-00466. [DOI] [PubMed] [Google Scholar]
- 57.Lluque A, et al. Virulence and antimicrobial resistance in Campylobacter spp. from a Peruvian pediatric cohort. Science. 2017;2017:1–8. doi: 10.1155/2017/7848926. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.An JU, et al. Dairy Cattle, a potential reservoir of human Campylobacteriosis: Epidemiological and molecular characterization of Campylobacter jejuni from cattle farms. Front. Microbiol. 2018;9:1–12. doi: 10.3389/fmicb.2018.03136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Bang DD, et al. PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates. J. Appl. Microbiol. 2003;94:1003–1014. doi: 10.1046/j.1365-2672.2003.01926.x. [DOI] [PubMed] [Google Scholar]
- 60.Linton D, et al. Phase variation of a β-1,3 galactosyltransferase involved in generation of the ganglioside GM1-like lipo-oligosaccharide of Campylobacter jejuni. Mol. Microbiol. 2000;37:501–514. doi: 10.1046/j.1365-2958.2000.02020.x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.