Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Mar 1.
Published in final edited form as: Methods Mol Biol. 2021;2254:323–338. doi: 10.1007/978-1-0716-1158-6_20

Genome-scale perturbation of lncRNA expression using CRISPR interference

S John Liu 1,2, Max A Horlbeck 3,4,5,6, Jonathan S Weissman 3,4,5,6, Daniel A Lim 1,2,7
PMCID: PMC7917014  NIHMSID: NIHMS1669522  PMID: 33326085

Abstract

CRISPR-mediated interference (CRISPRi), a robust and specific system for programmably repressing transcription, provides a versatile tool for systematically characterizing the function of long non-coding RNAs (lncRNAs). When used with highly parallel, lentiviral pooled screening approaches, CRISPRi enables the targeted knockdown of tens of thousands of lncRNA-expressing loci in a single screen. Here we describe the use of CRISPRi to target lncRNA loci in a pooled screen, using cell growth and proliferation as an example of a phenotypic readout. Considerations for custom lncRNA-targeting libraries, alternative phenotypic readouts, and orthogonal validation approaches are also discussed.

Keywords: CRISPR, CRISPRi, lncRNA, screen

1. Introduction

Long non-coding RNAs (lncRNAs) are a broadly defined class of genes that are transcribed into RNA molecules longer than 200 nucleotides that do not encode proteins. The human genome produces tens of thousands of distinct lncRNA transcripts, and it is now clear that certain lncRNAs have important biological functions. Due to the large number of annotated lncRNAs whose biological significance is not yet known, systematic genome-scale approaches for testing lncRNA function are especially important for efficient characterization of these genes. Large-scale interrogation of lncRNAs has been performed previously using RNA interference [1, 2], CRISPR/Cas9 deletion of lncRNA loci, [3], CRISPR/Cas9 disruption of lncRNA splice acceptor and donor sites [4], and CRISPRi repression of lncRNA transcription [5]. Given that lncRNA genes can function via diverse (i.e., cis and/or trans) mechanisms [6], it is important to consider the molecular mechanisms by which the screening method interrogates lncRNA function [7, 8].

In CRISPRi, a catalytically inactive Cas9 protein is fused with a transcriptional repressor domain such as the KRAB repressor domain (dCas9-KRAB), and such dCas9 fusion proteins can be targeted to essentially any region of the genome by the expression of single guide RNAs (sgRNAs). sgRNA-mediated recruitment of dCas9-KRAB silences transcription through steric hindrance of RNA polymerase elongation and deposition of the heterochromatin mark H3K9me3 [9, 10]. CRISPRi exhibits maximal activity when targeted to between −50 and +300 bp relative to the transcription start site (TSS) of the target lncRNA, which minimizes disruption of neighboring cis regulatory elements and other genes [11]. This narrow targeting window makes precise TSS identification and optimized single guide RNA (sgRNA) design an important consideration in designing screening libraries [12–14]. CRISPRi can be engineered to be inducible/reversible [15], and when dCas9 is fused to transcriptional activation domains, the system can also be used to achieve targeted overexpression of lncRNAs [16, 17]. Because the function of lncRNAs is generally not expected to be disrupted by small insertions and deletions mediated by targeting catalytically active CRISPR/Cas9 to their loci [18, 19], by blocking lncRNA transcription at the level of the genome, CRISPRi is particularly well-suited for screening lncRNA gene function. In addition, CRISPRi is not susceptible to artifacts related to genomic copy number variation, whereas Cas9 nuclease activity at amplified loci can lead to non-specific cell death [20–22].

Here, we present a protocol for the application of CRISPRi to test the function of thousands of lncRNAs in a pooled screen format, using cellular growth and proliferation as a phenotypic readout. We describe CRISPRi cell line generation and usage for the glioblastoma cell line U87, but the protocol is applicable to other cell types [5]. The use of custom sgRNA libraries is discussed (see note below), but for simplicity we present the screen using the publicly available Human CRISPRi Non-Coding Libraries (CRiNCL). Variations of the protocols below can also be found online at weissmanlab.ucsf.edu (see Note 1).

2. Materials

2.1. Generation of CRISPRi cell line

  1. U87-MG cell line (ATCC #HTB-14)

  2. 293T cells (ATCC #CRL-11268)

  3. DMEM (Gibco #11965–092)

  4. FBS (Gibco # 26140079)

  5. PBS (Gibco # 20012027)

  6. 0.25% Trypsin-EDTA (Gibco #25200056)

  7. dCas9-KRAB expression vector - UCOE-SFFV-dCas9-BFP-KRAB (Addgene: 85969), or SFFV-dCas9-BFP-KRAB (Addgene: 46911), pHR-EF1a-dCas9-HA-BFP-KRAB-NLS (Addgene: 102244)

  8. Lentivirus packaging plasmids - pMD2.G (Addgene: 12259), pCMV-dR8.91 (Trono Lab)

  9. TransIT-LT1 Transfection Reagent (Mirus #2300)

  10. ViralBoost Reagent (Alstem #VB100)

  11. 0.45 um membrane filter (Sigma # HVHP02500)

  12. 10 mL Syringes (BD # 309604)

  13. Access to a FACS instrument.

2.2. Pooled sgRNA library preparation and virus production

  1. CRiNCL sublibraries for U87 cells (Common: 86538, Cancer Common: 86539, U87 & HEK293T: 86547, U87 unique: 86542)

  2. MegaX DH10B cells (Thermo-Fisher C640003).

  3. SOC Outgrowth Media (NEB B9020S)

  4. LB Agar Plates, Carbenicillin-100 (Teknova #L1010)

  5. Carbenicillin (Sigma #C1613)

  6. NucleoBond Xtra Maxi Plus (Machery Nagel # 740416.10)

  7. Access to Bio-Rad GenePulse II or comparable electroporator

  8. Access to an Illumina sequencer

2.3. Expansion and maintenance of growth screen

  1. Large format tissue culture treated plates (Corning # CLS430599)

  2. Polybrene Infection Agent (Sigma # TR-1003-G)

  3. Puromycin (Sigma # P9620)

  4. DMSO (Sigma #D8418)

  5. Cryogenic vials 2 mL (Corning #430659)

2.4. Processing of genomic DNA for Illumina sequencing of sgRNA barcodes

  1. NucleoSpin Blood XL (Machery Nagel #740950.10)

  2. SbfI-HF (NEB #R3642L)

  3. Sub-Cell 192 Cell gel electrophoresis unit and power supply (or equivalent; Bio-Rad #1704508)

  4. UV-Transparent Gel Tray 25 × 20 cm (Bio-Rad #1704523)

  5. Large format gel comb (Bio-Rad #1704531)

  6. Agarose (Bio-Rad #1613102)

  7. TAE buffer 50X (ThermoFisher #B49)

  8. 1kb Plus DNA Ladder (ThermoFisher #10787018)

  9. Gel Loading Dye, Purple 6X (NEB #B7024S)

  10. NucleoSpin Gel and PCR Clean-up (Machery Nagel #740609.250)

  11. NaOAc, 3M (ThermoFisher #AM9740)

  12. Phusion High-Fidelity DNA Polymerase (NEB # M0530L)

  13. SPRIselect magnetic beads (Beckman Coulter #B23318)

  14. DynaMag-2 magnetic rack (Thermo Fisher #12321D)

  15. Qubit dsDNA HS Assay Kit (Thermo Fisher #Q32854)

  16. Access to a Qubit Fluorometer

  17. Access to a Bioanalyzer or Tapestation (Agilent)

2.5. Analysis of screen sequencing data

  1. Access to a Linux or Mac workstation with Python 2.7 and the following Python libraries installed: NumPy, SciPy, Pandas, Matplotlib, BioPython. iPython and Jupyter Notebook recommended for interactive plotting functions.

3. Methods

3.1. Generation of CRISPRi cell line

The stable and efficient expression of dCas9-KRAB is critical for the success of the screen and subsequent follow up experiments. We have found that for CRISPRi, a polyclonal population of cells expressing dCas9-KRAB is suitable as long as >95% of the cells are expressing the chimeric protein.

  1. Expand U87 cells in DMEM with 10% FBS.

  2. Obtain and prepare > 10 μg of the dCas9-KRAB expression vector containing the ubiquitous chromatin opening element (UCOE): UCOE-SFFV-dCas9-BFP-KRAB using standard plasmid preparation methods. Different dCas9-KRAB constructs can also be used, such as SFFV-dCas9-BFP-KRAB or pHR-EF1a-dCas9-HA-BFP-KRAB-NLS. Also prepare lentivirus packaging plasmids pCMV-dR8.91 and pMD2.G.

  3. Plate 6 × 10^6 293T cells in a 10cm plate with 10 mL of DMEM, 10% FBS the day before transfection.

  4. In a 1.5 mL tube, mix 1500 μL serum free DMEM with 45 μL Mirus TransIT LT1 and incubate for 5 minutes at room temperature.

  5. In separate 1.5 mL tube, mix 8 μg of pCMV-dR8.91, 1 μg of pMD2.G, and 9 μg of UCOE-SFFV-dCas9-BFP-KRAB.

  6. Mix the DMEM-Mirus mixture into the plasmid mixture and vortex.

  7. Incubate for 30 minutes at room temperature.

  8. Add mixture onto 10 cm plate of 293T cells in a dropwise fashion.

  9. Add 24 μL of ViralBoost Reagent into 10 cm plate of 293T cells.

  10. Allow virus production for 72 hours.

  11. 48 hours following transfection of lentivirus plasmids, seed 2 × 10^6 U87 cells onto a 10 cm plate.

  12. At 72 hours following 293T cell transfection, filter the virus-containing supernatant through a 0.45 um filter.

  13. Add 6 mL of filtered virus onto the U87 cells and allow 48 hours for virus infection. Note: amount of virus containing media used for infection may need to be altered. We generally aim for ~20–40% infection rate.

  14. Expand infected U87 cells 2–3 additional days, at which point the cells are FACS sorted as follows : identify the BFP positive population and sort for the top ~30% of cells in this BFP positive population. Re-analyze the sorted population to confirm > 95% BFP positive. If cells are under 95% pure, expand sorted population for another 2–4 days and resort.

  15. Expand U87 dCas9-KRAB cell line and freeze down aliquots.

  16. Verify effective expression of dCas9-KRAB (see Note 2, 3). Note that BFP expression levels can diminish over time although the cell line may retain robust CRISPRi activity.

3.2. Pooled sgRNA library preparation and virus production

The CRISPRi Non-Coding Library (CRiNCL) is subdivided into 13 libraries according to cell type-specific expression of lncRNAs (Addgene 86538, 86539, 86540, 86541, 86542, 86543, 86544, 86545, 86546, 86547, 86548, 86549, 86550). For targeting lncRNAs expressed in U87 cells, the Common, Cancer Common, U87 & HEK293T, and U87 unique sublibraries will be used. Custom sgRNA libraries may also be used (see Note 4).

  1. Obtain CRiNCL sublibraries corresponding to U87 from Addgene (Common: 86538, Cancer Common: 86539, U87 & HEK293T: 86547, U87 unique: 86542). Reconstitute the complete library by preparing a mixture of these sublibraries proportionally to the number of sgRNAs contained in each sublibrary. There are 58,452 total sgRNAs in this reconstituted library.

  2. To amplify the library for use, first add 100 ng of complete library mixture to 50 μL of MegaX DH10B cells.

  3. Electroporate bacteria/library mixture using the Bio-Rad GenePulse II or comparable electroporator using the recommended settings: 2.0kV, 200 ohms, 25uF, in a 0.1 cm chilled cuvette. Add 1 mL of SOC media, shake at 37C for 1.5 – 2 hours.

  4. Using 5 μL of the bacteria suspension, prepare serial dilutions and plate on LB + carbenicillin plates.

  5. Add the remaining suspension to 500 mL of LB + carbenicillin (100 μg/mL working concentration) and shake overnight at 37 C.

  6. Harvest bacteria using (multiple) Maxiprep columns, if transformation efficiency was above 1000 colonies per sgRNA.

  7. Recommended: confirm the sgRNA composition of the prepared library using illumina sequencing by amplifying 100 ng of the amplified library using PCR primers 5’: aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacCTTGTAgcacaaaaggaaact caccct, 3’: CAAGCAGAAGACGGCATACGAGATCGACTCGGTGCCACTTTTTC. Sequence the amplicons using standard illumina sequencing protocols with the sequencing primers 5’: GTGTGTTTTGAGACTATAAGTATCCCTTGGAGAACCACCTTGTTG, 3’: CCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGT

  8. To begin sgRNA library virus production, seed 3× 15 cm plates containing 8.5 × 10^6 293T cells in 31 mL medium (DMEM, 10% FBS) for each plate.

  9. Transfect the 293T cells the following day: in a 15 mL tube mix 3900 μL DMEM with 144 μL Mirus TransIT LT1and incubate for 5 minutes at room temperature.

  10. In a separate tube, mix the following plasmids: 24 μg of pCMV-dR8.91, 3 μg of pMD2.G, and 24 μg of the amplified, pooled sgRNA library.

  11. Mix the plasmid tube with the media + Mirus tube and incubate for 20 minutes at room temperature.

  12. Pipette 1355 μL of transfection mixture onto each 15 cm plate of 293T cells in a dropwise fashion.

  13. Allow virus production to continue for 72 hours before harvesting and filtering.

  14. Filter a total of 90 mL of supernatant through 0.4 um filter and infect cells for screening immediately.

3.3. Expansion and maintenance of growth screen

We generally perform pooled growth screens in biological duplicates in parallel or with replicates performed in a staggered fashion. The number of cells that should be maintained per replicate during the screen should be at least ~1000x coverage per sgRNA in the screening library. For the U87 screen using CRiNCL, this equates to two replicates of 68 million cells, assuming that 85% of the population contains sgRNA after a brief period of selection (empirically determined). Time between sgRNA library lentivirus infection and the first time point for cell harvest (T0) should be minimized in order to capture sgRNAs with strong negative selection phenotypes, as these may otherwise quickly drop out of the screen.

  1. The day before pooled lentivirus infection, seed 2 replicates of 12× 15 cm plates, each with 4.75 × 10^6 U87 cells stably expressing dCas9-KRAB and 25 mL of DMEM, 10% FBS media. Expect >90 million cells per replicate the following day at time of infection. Also seed a single well of a 12 well plate with 100,000 U87 dCas9-KRAB cells as an uninfected control.

  2. The following day (Day 0), add 3.5 mL of freshly prepared pooled lentivirus (see above) onto each 15 cm plate of U87 cells. Add polybrene to a final concentration of 4 μg/mL into each plate as well. Leave at 37 C overnight.

  3. Day 1: change the media of the infected U87 cells to 25 mL of DMEM, 10% FBS.

  4. Day 2: Monitor cells for confluence. If the cells are nearing confluence, passage the cells such that each replicate is seeded sparsely enough to grow in monolayer, but will still attain at least 68 million cells by day 5, the first time point of the screen. In our lab we perform the following for each replicate: 6 mL PBS wash to each plate, 4 mL 0.25% Trypsin-EDTA for 3 minutes at 37 C, quench with 8 mL DMEM, 10% FBS. Triturate on plate and pool the dissociated cell suspensions into a 250 mL polystyrene bottle. Mix the bottle well. Count the cells using a manual hemocytometer.

  5. Seed 68 million U87 cells evenly across 12× 15 cm plates and add puromycin to a final concentration of 0.75 μg/mL. Also seed 100,000 infected cells onto each of two wells of a 12 well plate for monitoring of infection rate. One well should have puromycin at the same concentration of the main screen and other should be grown without puromycin.

  6. Day 3: Perform flow cytometry of the uninfected, infected without puromycin, and infected with puromycin cell populations and split them 1 to 3. Continue to monitor the percentage of BFP positive population in these small-scale samples, as they reflect the BFP% in the large screen. Note: BFP expression from the sgRNA expression vector should be much brighter than the BFP signal from dCas9-BFP-KRAB, and therefore sgRNA infected cells should be readily distinguishable on flow cytometry.

  7. Change media to puromycin-containing media to a final concentration of 0.75 μg/mL.

  8. Day 4: Split and expand the U87 cells undergoing the screen by performing the following: 6 mL PBS wash to each plate, 4 mL 0.25% Trypsin-EDTA for 3 minutes at 37 C, quench with 8 mL DMEM, 10% FBS. Triturate on plate and pool the dissociated cell suspensions into a 250 mL polystyrene bottle. Mix the bottle well. Count the cells using a manual hemocytometer.

  9. For each replicate screen, collect 136 million cells of cells in suspension, which is equal to double the minimum number of cells needed to be maintained during the screen, and plate evenly across 12× 15 cm plates in regular DMEM, 10% FBS, without puromycin.

  10. Perform flow cytometry on a small aliquot of the reconstituted pool of cells undergoing screening. If < 80% of cells are sgRNA and BFP positive, add puromycin to the plates at a final concentration of 0.75 μg/mL and continue puromycin selection for one more day. If > 80% of cells are sgRNA and BFP positive, do not add puromycin to the plates. Instead, allow cells to grow in normal media for one more day.

  11. Day 5 (T0). After one day of recovery growth without drug selection, passage the cells as follows: 6 mL PBS wash to each plate, 4 mL 0.25% Trypsin-EDTA for 3 minutes at 37 C, quench with 8 mL DMEM, 10% FBS. Triturate on plate and pool the dissociated cell suspensions into a 250 mL polystyrene bottle. Count using a manual hemocytometer and record cell numbers for determination of doubling rate. Fill these values into the “cell_doubling_measurements.xlsx” spreadsheet included in the ScreenProcessing pipeline (see Analysis protocol, below).

  12. Prepare aliquots of 68 million cells (equivalent to (size of sgRNA library × 1000)/(Proportion of BFP positive cells)) and centrifuge them at 1000 rpm for 5 minutes. Resuspend each aliquot in 2 mL of freezing media (90% FBS, 10% DMSO) and transfer them to a cryovial for liquid nitrogen storage. Each aliquot can be subsequently harvested for genomic DNA or thawed for a repeat screen.

  13. For each replicate, seed 68 million live cells across 12× 15 cm plates and allow growth for 48 hours.

  14. A small aliquot of the remaining cells can be analyzed for population purity using flow cytometry.

  15. Day 6 – 17: Continue to passage cells every 2 days, maintaining a minimum cell count of 68 million cells per replicate (approximately 1:4 passage ratios for U87). Freeze down aliquots of 68 million cells after cells have undergone 5 and 10 cell doublings following T0 (Day 11 and Day 17, respectively, for U87 cells in this protocol). These will be used as intermediate and final time points for screen data analysis.

3.4. Processing of genomic DNA for Illumina sequencing of sgRNA barcodes

LncRNA knockdown phenotypes in this growth-based screen are reflected in relative enrichment or depletion of sgRNA barcodes in a population of cells at the end of the screen compared to the beginning. Such changes are monitored by targeted sequencing of the integrated sgRNA barcodes following genomic DNA isolation. This protocol uses a restriction digest and large gel extraction to enrich input DNA for the sgRNA cassette, as we previously used for our large-scale screens [5]. However, for small input DNA quantities (e.g. 200μg) the digest and gel may be entirely omitted, and all DNA may be directly used in the PCR amplification step (e.g. 200× 100μL reactions with 1μg input DNA each for 200μg total). Alternatively, recently developed high-capacity polymerases such as NEBNext Ultra II Q5 may allow for ten-fold increases in input DNA concentration (10 μg per 100μL reaction) and thus make omitting the digest and gel steps practical for all screens.

  1. Isolate genomic DNA from aliquots of frozen cells at T0 and also at intermediate and end time points using the Machery Nagel NucleoSpin Blood XL as follows. Each column of the XL kit can process ~100 million cells, which exceeds the number of cells grown per replicate of U87 cells at each time point.

  2. Thaw cryovials of cells in a 37°C water bath and transfer suspension to 10 mL of PBS in a 15 mL conical tube, then centrifuge at 1300 rpm for 5 minutes.

  3. Follow the Machery Nagel manufacturer’s protocol using the following amounts of reagents: Proteinase K 500 μL, BQ1 10 mL, 100% ethanol 10 mL.

  4. Elute genomic DNA twice with 800 μL EB, preheated to 70 C and incubated on the column for 5 minutes at room temperature before centrifuge. Repeat with another 800 μL EB to maximize yield. Expect ~1 mg of genomic DNA per sample in 1.2 – 1.5 mL of EB.

  5. Next we enzymatically fragment and size select the genomic DNA to reduce the amount of input for sgRNA library PCR. Enzymatic digestion may be avoided if input cells are relatively low (15 million or fewer; e.g. < 200 μg genomic DNA). To the entire volume of purified genomic DNA, add NEB 10x Cutsmart buffer to a final concentration of 1x and add 400 U of SbfI-HF per mg of genomic DNA. Incubate at 37 C overnight.

  6. Prepare a large TAE 0.8% agarose gel (400 mL worth of TAE) and use a gel loading comb that can accommodate 1.2 – 1.5 mL of DNA digest per well.

  7. Load each DNA digest sample with final concentration of 1X loading dye. Also run a 1kb plus ladder. Gel electrophoresis should be performed at ~120V for 60–90 minutes.

  8. Gel excise the sample between 700 bp and 350 bp, using the ladder as a guide. The DNA fragments that contain sgRNAs may not be evident on the gel, since the vast majority of the fragmented DNA visible on the gel corresponds to genomic DNA, so cutting based on an accurate ladder is critical.

  9. Perform gel purification using the Machery Nagel NucleoSpin Gel and PCR Clean-up kit as follows: weigh the excised gel and add 2X volume of NTI. Dissolve the agarose gel in a 56 C water bath for 10 minutes, then add 1/100th volume of 3M NaOAc, pH 5.3. Load the entire volume of dissolved gel into a single DNA binding column (maximum 100 million cells worth of DNA fragments per column) attached to a vacuum apparatus. Wash column with 700 μL Buffer NT3 and dry the membrane according to the manufacturer’s recommendations. Elute in 20 μL of EB, preheated to 70 C and incubated on column for 5 minutes before centrifugation. Repeat elution with another 20 μL of preheated EB.

  10. PCR amplify the sgRNA cassettes using custom illumina primers with unique indices for each sample. A combination of illumina “Set A” and “Set B” indices should be used to maximize sequencing diversity. For instance, two replicate screens each with T0 and T12 samples should be indexed as follows:
    1. Rep 1 T0: 5’ Index 12 + Common 3’
    2. Rep 1 T12: Common 5’ + 3’ Index 6
    3. Rep 2 T0: 5’ Index 14 + Common 3’
    4. Rep 2 T12: Common 5’ + 3’ Index 10

    Primer sequences are as follows:

    5’ Truseq index 12: aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacCTTGTAgcacaaaaggaaact caccct

    5’ Truseq index 14: aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacAGTTCCgcacaaaaggaaact caccct

    5’ Truseq index 3: aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacTTAGGCgcacaaaaggaaact caccct

    3’ Truseq index 6: aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacGCCAATcgactcggtgccactttttc

    3’ Truseq index 10: aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacTAGCTTcgactcggtgccactttttc

    3’ Truseq index 1: aatgatacggcgaccaccgagatctacacgatcggaagagcacacgtctgaactccagtcacATCACGcgactcggtgccactttttc

    Common 3’ Primer: CAAGCAGAAGACGGCATACGAGATCGACTCGGTGCCACTTTTTC

    Common 5’ Primer: CAAGCAGAAGACGGCATACGAGATGCACAAAAGGAAACTCACCCT

  11. Using the primer configuration listed above, amplify the entirety of the purified DNA in multiple 100 μL reactions of 500 ng template each using Phusion DNA polymerase. Expect to setup many PCR reactions:
    1. Extracted genomic DNA, 500 ng
    2. 5x Phusion HF buffer, 20 μL
    3. DMSO, 3 μL
    4. Index Primer 100 uM, 0.4 μL
    5. Common Primer 100 uM, 0.4 μL
    6. dNTP 10 mM, 2 μL
    7. Phusion DNA Polymerase, 1 μL
  12. PCR protocol:
    1. 98 C, 30 seconds
    2. 23 cycles:
      1. 98 C, 30 seconds
      2. 56 C, 15 seconds
      3. 72 C, 15 seconds
    3. 72 C, 10 minutes
    4. 4 C hold

  13. Pool all PCR products into a 15 mL tube, mix well, and proceed with double sided SPRI DNA purification using 300 μL of mixed PCR product in a 1.7 mL centrifuge tube. The enriched sgRNA cassette PCR product is 274 bp. The amount of PCR product to be purified can be varied as long as the volumetric ratio of SPRI beads to initial DNA solution remains constant throughout the procedure.

  14. Add 195 μL SPRI beads (0.65X), mix by pipetting up and down, and incubate for 10 minutes at room temperature.

  15. Place 1.7 mL tube containing DNA and SPRI beads onto a magnetic rack (ie. DynaMag-2 Magnet, Life Technologies) for 5 minutes at room temperature.

  16. Transfer supernatant to a new 1.7 mL tube. DO NOT DISCARD SUPERNATANT.

  17. Add 300 μL SPRI beads (1X), mix by pipetting up and down, and incubate for 10 minutes at room temperature.

  18. Place 1.7 mL tube containing DNA and SPRI beads onto a magnetic rack for 5 minutes at room temperature.

  19. Remove supernatant. DO NOT DISTURB BEADS.

  20. With the tube on the magnetic rack, add 1 mL 80% EtOH (freshly prepared), incubate for 2 minutes at room temperature, then remove all EtOH. Repeat once for a total of 2 EtOH washes.

  21. With the tube on the magnetic rack, air dry the beads for 5–15 minutes.

  22. Remove tube from magnetic rack and resuspend beads in 20 μL EB and mix well.

  23. Incubate off the magnetic rack for 1 minute at room temperature.

  24. Place tube back on magnetic rack and transfer 19.5 μL of EB containing purified DNA product into a new tube.

  25. Quantify DNA concentration on a Qubit Fluorometer using the high sensitivity dsDNA assay kit. Dilute sample to 0.4 ng/μL for sequencing.

  26. Run diluted sample on a Bioanalyzer or Tapestation using a high sensitivity DNA assay kit. The purified DNA product should be 274 bp.

  27. Submit to a core sequencing facility for sequencing on an Illumina HiSeq 2500 or 4000 using the single end 50 protocol, index length of 1×6 bp. A PhiX spike in may be required to increase diversity of the sequencing reads. Alternatively, pool with unrelated sequencing libraries to maximize diversity. Custom sequencing primers required for sequencing are as follows:

    5’ Sequencing Primer: GTGTGTTTTGAGACTATAAGTATCCCTTGGAGAACCACCTTGTTG

    3’ Sequencing Primer: CCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGT

3.5. Analysis of screen sequencing data

After demultiplexing screen sequencing reads, sgRNA counts will be quantified separately for each condition. The screen processing pipeline in addition to an example vignette are freely available on Github: https://github.com/mhorlbeck/ScreenProcessing. Briefly, raw sequencing reads are aligned and sgRNA library counts are generated. sgRNA phenotype scores are then generated based on comparisons between initial and intermediate/end time points of the screen. Gene/lncRNA-level scores are generated and are tested for statistical significance.

  1. Ensure that Python 2.7 and necessary dependencies for Screen Processing are installed (iPython, numpy, scipy, pandas, matplotlib, biopython).

  2. Download entire directory containing Screen Processing analysis suite from https://github.com/mhorlbeck/ScreenProcessing. See the tutorial and consider running the scripts on the demo files first.

  3. Initiate the sgRNA quantification script “fastqgz_to_counts.py” by running in the command line “run fastqgz_to_counts.py” along with the requested input parameters (“run fastqgz_to_counts.py -h” prints a help message describing the optional and required inputs).

  4. To calculate sgRNA-level, transcript-level, and gene-level phenotypes, run “process_experiments.py” by editing the corresponding configuration file with the correct sgRNA library, sample ID’s, and doubling time in days.

  5. Finally, run “screen_analysis.py” to generate publication-quality plots of screen results.

  6. Screen hits for validation or follow-up can be selected in several ways, including p-value, absolute value of phenotype, or “discriminant score” cut-offs. Select a cut-off that includes few negative control genes, genes comprised of randomly sampled non-targeting sgRNAs and labeled “pseudo” in the gene table output from process_experiments script. Hits should be further examined to ensure multiple independent sgRNAs contribute to the gene-level phenotype and the TSS of the lncRNA gene does not closely neighbor other gene TSSs (see Note 5). Orthogonal validation using non-CRISPR interference methods is also encouraged (see Note 6). Additional phenotypes may also be investigated in future screens (see Note 7).

4. Notes

  1. Additional protocols for generation and validation of CRISPRi/a cell lines and screening methods can be found at weissmanlab.ucsf.edu.

  2. Upon generation of the CRISPRi cell line, it is strongly recommended to confirm efficient CRISPRi activity by targeting positive control genes using established sgRNA sequences [5, 9, 11] before proceeding to infection of the large scale lentivirus sgRNA library. Common methods for doing so include infecting cells with individual sgRNAs targeting essential genes and observing depletion of infected cells or with sgRNAs targeting non-essential genes and measuring RNA knockdown by RT-qPCR. Example sgRNAs and qPCR primers are available at weissmanlab.ucsf.edu.

  3. LncRNA knockdown using individual sgRNAs that show pronounced phenotypes in the screen may also be cloned into a lentivirus expression vector, and cells stably expressing dCas9-KRAB infected with these vectors (fluorescently labeled) may be monitored using flow cytometry in an internally-controlled growth assay.

  4. Custom sgRNA libraries targeting lncRNA transcription start sites may be generated by selecting sgRNAs targeting a set of lncRNA libraries of interest from existing libraries such as the CRiNCL library and then synthesizing them (see step 4 below). If a set of lncRNAs are not targeted by existing libraries, sgRNAs may be designed as follows:
    1. Identify lncRNA transcripts of interest using established transcriptome references such as Ensembl, GENCODE, or other custom annotations. Expression levels or other biological features of lncRNAs may be used to prioritize genes for inclusion.
    2. Extract the transcription start sites of these transcripts and where applicable and compare them to the FANTOM cap analysis of gene expression (CAGE)-based TSS annotations as previously described [5, 11].
    3. 10 candidate sgRNAs per lncRNA TSS are then generated within −25 bp and +500 bp relative to the TSS according to the hCRISPRi-v2.1 algorithm described in [12] and are prioritized based on predicted off-target scores, restriction digest sites, lack of redundancy.
    4. The final set of sgRNAs targeting lncRNAs and also negative control sgRNAs (weighted by the per-base nucleotide frequencies of the targeting sgRNAs in the library) are then designed with flanking cloning and PCR sites described in [11], synthesized by Agilent Technologies or equivalent service, and cloned into the appropriate vector as described above.

  5. We have observed CRISPRi activity at up to 1kb away from the targeted locus. A reasonable initial filter for screen hits would be to exclude any gene for which the sgRNAs targeting the gene TSS are within 1kb of an essential gene TSS as defined by a database (e.g. DepMap). Alternately, excluding any lncRNA for which the TSS is within 5kb of any other gene TSS would be a reasonable strict filter to yield fewer genes for follow-up. In either case, hits should be validated as below.

  6. Orthogonal validation approaches such as antisense oligonucleotides (ASO) are invaluable for further characterization of lncRNAs of interest, since they utilize RNAse-H based degradation of targeted lncRNAs without altering the genomic DNA or epigenome, and they also represent a compelling mode of targeting lncRNAs for therapeutic applications [5, 8, 23]. We use locked nucleic acid (LNA) Gapmers (Qiagen) for validation and further studies of lncRNA transcript function. Other emerging approaches of direct RNA perturbation such as the Cas13 RNA-guided, RNA-targeting nuclease [24, 25] also represent promising methods that are orthogonal to DNA-targeting CRISPR/(d)Cas9 approaches. Critically, validation methods should be chosen such that they are completely orthogonal with respect to how lncRNA function is perturbed (e.g. DNA sequence modification, transcription modulation, or RNA degredation) and the potential artefacts associated with the method [7].

  7. As with all pooled screening approaches, cell growth represents just one possible phenotypic readout. As has been done for protein coding genes, lncRNAs involved in drug sensitivity/resistance [11, 26, 27], synthetic lethality [28], cellular differentiation [5, 15], among other phenotypes, can be dissected using similar principles as those outlined here.

References

  • 1.Guttman M, Donaghey J, Carey BW, Garber M, Grenier JK, Munson G, Young G, Lucas AB, Ach R, Bruhn L, Yang X, Amit I, Meissner A, Regev A, Rinn JL, Root DE, Lander ES (2011) lincRNAs act in the circuitry controlling pluripotency and differentiation. Nature 477:295–300. doi: 10.1038/nature10398 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Lin N, Chang K-Y, Li Z, Gates K, Rana ZA, Dang J, Zhang D, Han T, Yang C-S, Cunningham TJ, Head SR, Duester G, Dong PDS, Rana TM (2014) An evolutionarily conserved long noncoding RNA TUNA controls pluripotency and neural lineage commitment. Molecular Cell 53:1005–1019. doi: 10.1016/j.molcel.2014.01.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zhu S, Li W, Liu J, Chen C-H, Liao Q, Xu P, Xu H, Xiao T, Cao Z, Peng J, Yuan P, Brown M, Liu XS, Wei W (2016) Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nat Biotechnol 34:1279–1286. doi: 10.1038/nbt.3715 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Liu Y, Cao Z, Wang Y, Guo Y, Xu P, Yuan P, Liu Z, He Y, Wei W (2018) Genome-wide screening for functional long noncoding RNAs in human cells by Cas9 targeting of splice sites. Nat Biotechnol 1656:175–1210. doi: 10.1038/nbt.4283 [DOI] [PubMed] [Google Scholar]
  • 5.Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, He D, Attenello FJ, Villalta JE, Cho MY, Chen Y, Mandegar MA, Olvera MP, Gilbert LA, Conklin BR, Chang HY, Weissman JS, Lim DA (2017) CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355:eaah7111. doi: 10.1126/science.aah7111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kopp F, Mendell JT (2018) Functional Classification and Experimental Dissection of Long Noncoding RNAs. Cell 172:393–407. doi: 10.1016/j.cell.2018.01.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bassett AR, Akhtar A, Barlow DP, Bird AP, Brockdorff N, Duboule D, Ephrussi A, Ferguson-Smith AC, Gingeras TR, Haerty W, Higgs DR, Miska EA, Ponting CP (2014) Considerations when investigating lncRNA function in vivo. eLife 3:e03058. doi: 10.7554/eLife.03058 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Liu SJ, Lim DA (2018) Modulating the expression of long non‐coding RNAs for functional studies. EMBO reports e46955–11. doi: 10.15252/embr.201846955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS (2013) CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154:442–451. doi: 10.1016/j.cell.2013.06.044 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA (2013) Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152:1173–1183. doi: 10.1016/j.cell.2013.02.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS (2014) Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell 159:647–661. doi: 10.1016/j.cell.2014.09.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Horlbeck MA, Gilbert LA, Villalta JE, Adamson B, Pak RA, Chen Y, Fields AP, Park CY, Corn JE, Kampmann M, Weissman JS (2016) Compact and highly active next-generation libraries for CRISPR-mediated gene repression and activation. eLife 5:914. doi: 10.7554/eLife.19760 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Horlbeck MA, Witkowsky LB, Guglielmi B, Replogle JM, Gilbert LA, Villalta JE, Torigoe SE, Tjian R, Weissman JS (2016) Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife 5:2767. doi: 10.7554/eLife.12677 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Radzisheuskaya A, Shlyueva D, Müller I, Helin K (2016) Optimizing sgRNA position markedly improves the efficiency of CRISPR/dCas9-mediated transcriptional repression. Nucleic Acids Res 44:e141–e141. doi: 10.1093/nar/gkw583 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mandegar MA, Huebsch N, Frolov EB, Shin E, Truong A, Olvera MP, Chan AH, Miyaoka Y, Holmes K, Spencer CI, Judge LM, Gordon DE, Eskildsen TV, Villalta JE, Horlbeck MA, Gilbert LA, Krogan NJ, Sheikh SP, Weissman JS, Qi LS, So P-L, Conklin BR (2016) CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Cell Stem Cell 18:541–553. doi: 10.1016/j.stem.2016.01.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Boettcher M, Tian R, Blau JA, Markegard E, Wagner RT, Wu D, Mo X, Biton A, Zaitlen N, Fu H, McCormick F, Kampmann M, McManus MT (2018) Dual gene activation and knockout screen reveals directional dependencies in genetic networks. Nat Biotechnol 36:170–178. doi: 10.1038/nbt.4062 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Cho SW, Xu J, Sun R, Mumbach MR, Carter AC, Chen YG, Yost KE, Kim J, He J, Nevins SA, Chin S-F, Caldas C, Liu SJ, Horlbeck MA, Lim DA, Weissman JS, Curtis C, Chang HY (2018) Promoter of lncRNA Gene PVT1 Is a Tumor-Suppressor DNA Boundary Element. Cell 173:1398–1412.e22. doi: 10.1016/j.cell.2018.03.068 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ho T-T, Zhou N, Huang J, Koirala P, Xu M, Fung R, Wu F, Mo Y-Y (2015) Targeting non-coding RNAs with the CRISPR/Cas9 system in human cell lines. Nucleic Acids Res 43:e17–e17. doi: 10.1093/nar/gku1198 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Goyal A, Myacheva K, Gross M, Klingenberg M, Duran Arqué B, Diederichs S (2017) Challenges of CRISPR/Cas9 applications for long non-coding RNA genes. Nucleic Acids Res 45:e12. doi: 10.1093/nar/gkw883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wang T, Birsoy K, Hughes NW, Krupczak KM, Post Y, Wei JJ, Lander ES, Sabatini DM (2015) Identification and characterization of essential genes in the human genome. Science 350:1096–1101. doi: 10.1126/science.aac7041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Aguirre AJ, Meyers RM, Weir BA, Vazquez F, Zhang C-Z, Ben-David U, Cook A, Ha G, Harrington WF, Doshi MB, Kost-Alimova M, Gill S, Xu H, Ali LD, Jiang G, Pantel S, Lee Y, Goodale A, Cherniack AD, Oh C, Kryukov G, Cowley GS, Garraway LA, Stegmaier K, Roberts CW, Golub TR, Meyerson M, Root DE, Tsherniak A, Hahn WC (2016) Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov 6:914–929. doi: 10.1158/2159-8290.CD-16-0154 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Munoz DM, Cassiani PJ, Li L, Billy E, Korn JM, Jones MD, Golji J, Ruddy DA, Yu K, McAllister G, DeWeck A, Abramowski D, Wan J, Shirley MD, Neshat SY, Rakiec D, de Beaumont R, Weber O, Kauffmann A, McDonald ER, Keen N, Hofmann F, Sellers WR, Schmelzle T, Stegmeier F, Schlabach MR (2016) CRISPR Screens Provide a Comprehensive Assessment of Cancer Vulnerabilities but Generate False-Positive Hits for Highly Amplified Genomic Regions. Cancer Discov 6:900–913. doi: 10.1158/2159-8290.CD-16-0178 [DOI] [PubMed] [Google Scholar]
  • 23.Meng L, Ward AJ, Chun S, Bennett CF, Beaudet AL, Rigo F (2015) Towards a therapy for Angelman syndrome by targeting a long non-coding RNA. Nature 518:409–412. doi: 10.1038/nature13975 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yan WX, Chong S, Zhang H, Makarova KS, Koonin EV, Cheng DR, Scott DA (2018) Cas13d Is a Compact RNA-Targeting Type VI CRISPR Effector Positively Modulated by a WYL-Domain-Containing Accessory Protein. Molecular Cell 70:327–339.e5. doi: 10.1016/j.molcel.2018.02.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Konermann S, Lotfy P, Brideau NJ, Oki J, Shokhirev MN, Hsu PD (2018) Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors. Cell 173:665–676.e14. doi: 10.1016/j.cell.2018.02.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F (2015) Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature 517:583–588. doi: 10.1038/nature14136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jost M, Chen Y, Gilbert LA, Horlbeck MA, Krenning L, Menchon G, Rai A, Cho MY, Stern JJ, Prota AE, Kampmann M, Akhmanova A, Steinmetz MO, Tanenbaum ME, Weissman JS (2017) Combined CRISPRi/a-Based Chemical Genetic Screens Reveal that Rigosertib Is a Microtubule-Destabilizing Agent. Molecular Cell 68:210–223.e6. doi: 10.1016/j.molcel.2017.09.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Horlbeck MA, Xu A, Wang M, Bennett NK, Park CY, Bogdanoff D, Adamson B, Chow ED, Kampmann M, Peterson TR, Nakamura K, Fischbach MA, Weissman JS, Gilbert LA (2018) Mapping the Genetic Landscape of Human Cells. Cell 174:953–967.e22. doi: 10.1016/j.cell.2018.06.010 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES