Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 May 1.
Published in final edited form as: J Cell Physiol. 2020 Oct 20;236(5):3770–3779. doi: 10.1002/jcp.30116

Transient receptor potential vanilloid 4 channel deletion regulates pathological but not developmental retinal angiogenesis

Holly C Cappelli 1,2,#,$, Brianna D Guarino 1,$, Anantha K Kanugula 1, Ravi K Adapala 1,2, Vidushani Perera 1, Matthew A Smith 3,4, Sailaja Paruchuri 5, Charles K Thodeti 1,2,*
PMCID: PMC7920906  NIHMSID: NIHMS1638704  PMID: 33078410

Abstract

Transient receptor potential vanilloid 4 (TRPV4) channels are mechanosensitive ion channels that regulate systemic endothelial cell (EC) functions such as vasodilation, permeability, and angiogenesis. TRPV4 is expressed in retinal ganglion cells, Müller glia, pigment epithelium, microvascular ECs, and modulates cell volume regulation, calcium homeostasis, and survival. TRPV4-mediated physiological or pathological retinal angiogenesis remains poorly understood. Here, we demonstrate that TRPV4 is expressed, functional, and mechanosensitive in retinal ECs. The genetic deletion of TRPV4 did not affect post-natal developmental angiogenesis but increased pathological neovascularization in response to oxygen-induced retinopathy (OIR). Retinal vessels from TRPV4KO mice subjected to OIR exhibited neovascular tufts that projected into the vitreous humor and displayed reduced pericyte coverage compared with WT mice. These results suggest that TRPV4 is a regulator of retinal angiogenesis, its deletion augments pathological retinal angiogenesis, and that TRPV4 could be a novel target for the development of therapies against neovascular ocular diseases.

Keywords: ECM Stiffness, Human Retinal Endothelial Cells, Mechanotransduction, Neovascularization, TRPV4

INTRODUCTION

The growth of new capillaries from existing vessels (i.e. angiogenesis or neovascularization) is critical for the development and function of many tissues, including the retina (Folkman, 2006). Excessive (pathological) angiogenesis contributes to the development of various ocular diseases, such as proliferative diabetic retinopathy (PDR), retinopathy of prematurity (ROP), age-related macular degeneration (AMD), and retinal vein occlusions (Cavallaro et al., 2014; Kusuhara, Fukushima, Ogura, Inoue, & Uemura, 2018; Moran et al., 2016; Selvam, Kumar, & Fruttiger, 2018). Vascular endothelial growth factor (VEGF) and its receptor (VEGFR2) are major mediators of angiogenesis and thus, this pathway is the focus of many studies targeting angiogenesis (Carmeliet & Jain, 2011a, 2011b). Anti-VEGF strategies have demonstrated efficacy in the treatment of various neovascular ocular diseases such as PDR, ROP, and AMD (Cavallaro et al., 2014; Yang, Zhao, & Sun, 2016), although limitations include the development of resistance over time and importantly, no or poor response (Rezzola et al., 2015; S. Yang et al., 2016). Injection-induced complications, such as vitreous hemorrhage, retinal tear formation, tractional retinal detachment, and endophthalmitis, can occur. Therefore, there is an unmet need to develop VEGF-independent therapies to treat neovascular ocular diseases.

Apart from growth factors such as VEGF, mechanical forces are critical regulators of vascular growth. We recently demonstrated that mechanosensitive ion channel, transient receptor potential vanilloid 4 (TRPV4), negatively regulates angiogenesis through modulation of the Rho/Rho kinase pathway (Thoppil et al., 2016). We also found that the absence of TRPV4 enhanced angiogenesis in an extracellular matrix (ECM) stiffness-dependent manner from Matrigel plugs implanted in mice (Cappelli et al., 2019). Further, increased tumor growth was observed in TRPV4KO mice challenged with tumors compared with their WT counterparts, and resulted in tumor vessel malformations of increased diameter, density, and decreased pericyte coverage (Adapala et al., 2016). In the eye, TRPV4 is expressed in retinal endothelial cells (ECs) and has been implicated in the formation of adherens junctions, cell migration, and vascular permeability (Guarino et al., 2020; Monaghan et al., 2015; Phuong et al., 2017). Recently, O’Leary et al demonstrated a role for TRPV1 and TRPV4 in retinal angiogenesis through the use of pharmacological inhibitors (O’Leary et al., 2019). It remains unknown if the genetic deletion of TRPV4 influences physiological/developmental or pathological retinal angiogenesis. In the current study, we demonstrate TRPV4 is functionally expressed, mechanosensitive in retinal endothelial cells and regulates pathological, but not developmental, retinal angiogenesis.

MATERIALS AND METHODS

Cell Culture

Human retinal microvascular endothelial cells (HuRMECs) were purchased from Cell Systems. HuRMECs were cultured on CSC Attachment Factor-, fibronectin-, or gelatin-coated culture dishes in CSC Complete Medium with Serum and Cultureboost-R. HuRMECs were used between passages 3–10.

Calcium Imaging

HuRMECs were cultured on coated MatTek glass bottom dishes. Fluo-4/AM (3 μM) (Invitrogen) was loaded for 20 minutes and washed in calcium media (136 mM NaCl, 4.7 mM KCl, 1.2 mM MgSO4, 1.1 mM CaCl2, 1.2 mM KH2PO4, 5 mM NaHCO3, 5.5 mM glucose, and 20 mM Hepes; pH 7.4). TRPV4 agonist, GSK1016790A (GSK; 1 nM; Sigma Aldrich), was used to stimulate calcium influx. Some culture dishes were incubated for 20 minutes with TRPV4 antagonist, GSK2193874 (GSK2; 50 nM; Tocris) prior to GSK stimulation. Calcium imaging was performed on the Olympus IX80 microscope using Metamorph software; all data was analyzed in Microsoft Excel as previously described (Thodeti et al., 2009). Data are reported as the ratio of normalized Fluo-4 fluorescence intensity (acquired at: excitation-480 nm and emission-514 nm) relative to time 0 (F/F0).

Cyclic Strain

HuRMECs were seeded on fibronectin coated Uniflex 6 well-plates (Flex Cell International) at ~95% confluency. Cells were subjected to uniaxial cyclic strain (10% for 18 hours) in an incubator as previously described (Thodeti et al., 2009). When GSK2 was used, cells were treated for 30 minutes prior to mechanical stretch. Control cells were subjected to identical conditions in the absence of stretch. Cells were stained with Alexa-Fluor 488-Phalloidin (Invitrogen) and cell orientation was calculated using images from at least 5 different fields per condition. Cell angle was measured by tracing the cells using ImageJ software (NIH). The data are reported as the percentage of realigned cells at 90° ± 30° to the direction of the strain.

Immunocytochemistry

Cells were fixed in 4% paraformaldehyde (PFA), washed in phosphate buffered saline (PBS), and permeabilized with 0.25% Triton X-100 in PBS. Cells were blocked in 5% bovine serum albumin (BSA) or serum containing media for 30–60 minutes and incubated for 60 minutes with primary antibodies (vinculin 1:150; Sigma Aldrich). Cells were washed and incubated for 60 minutes with secondary antibodies conjugated to Alexa-Fluor 594 (Invitrogen) and/or Alexa-Fluor 488-Phalloidin. After washes, cells were mounted with hard set mounting medium with DAPI (Vector Lab). Images were captured using the Olympus IX80 Microscope and processed using Image J (NIH).

RT-PCR and qPCR

RNA was isolated from HuRMECs and mouse retina using either RNeasy Mini Kit (Qiagen) or Trizol according to manufacturer’s instructions. Using RevertAid first strand cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA), cDNA was synthesized, and PCR was carried out with GoTaq Green Master Mix (Promega).

qPCR was carried out with the Fast SYBR green master mix (Applied Biosystems) using the Fast-Real-Time PCR system (Applied Biosystems). Real time primers for human GAPDH, TRPV4, mouse TRPV4 and beta actin were purchased from IDT technologies (Coralville, IA, USA): hTRPV4 (F-5’TCACTCTCACCGCCTACTACCA3’, R-5’CCCAGTGAAGAGCGTAATGACC3’) and hGAPDH (F-5’GCTGAGTACGTCGTGGAGTC3’, R-5’ CATGACGAACATGGGGGCAT 3’). mTRPV4 (F-5’CCTGCACATTGCCATCGAAC3’; R-5’ATCCTTGGGCTGGAAGAAGC3’); mBeta-actin: (F-5’TCCTGACCCTGAAGTACCCC3’; R-5’CAGCACAGGGTGCTCCTC3’). Gene expression was analyzed relative to GAPDH/beta-actin values and the ΔΔCT values are expressed as a fold change.

siRNA Knockdown of TRPV4

HuRMECs were transfected with human TRPV4 smartpool siRNAs (50 nM; Dharmacon) and non-target smartpool siRNA (50 nM) in Opti-MEM media (Gibco) using siLentFect Reagent (Bio-Rad). After 24 hours of transfection, media was aspirated and replaced with complete HuRMEC media. Knockdown of TRPV4 channel expression was assessed after 24- and 48-hours using qPCR with specific TRPV4 primers. Once TRPV4 knockdown was confirmed, cells were then used for mechanosensitivity (cell spreading) on varying ECM stiffness.

Cell Spreading on ECM Hydrogels of Varying Stiffness

Collagen coated ECM gels of varying stiffness (0.2, 8, 50 kPa) were procured from Matrigen Life Technologies. Control siRNA and TRPV4 siRNA-treated HuRMECs were seeded on ECM gels of varying stiffness at low density to minimize cell-cell interactions and allowed to spread for 4 hours. Images were acquired using an Olympus IX81 microscope and cell area was measured using ImageJ software (NIH).

Animals

The experimental design(s) with the use of animals was approved by the Internal Animal Care and Use Committee (IACUC) at Northeast Ohio Medical University. All animals in this study were of C57BL/6 background (WT and TRPV4KO mice) fed on a standard diet and water ad libitum and kept under a 12-h light/dark cycle as previously described (Adapala et al., 2011; Adapala et al., 2016). TRPV4KO mice are in the C57BL/6 background and are acquired from Suzuki group (Suzuki et al., J Biol Chem, 2003).

Oxygen-Induced Retinopathy

The mouse model of oxygen-induced retinopathy (OIR) was conducted as previously described (Connor et al., 2009). Briefly, WT and TRPV4KO mouse pups (P7), with nursing mothers, were placed into a hyperoxia chamber containing 75% oxygen for 5 days (until P12) before returning the mice to room air for additional 5 days (until P17). The retinas were collected and processed for immunofluorescence studies.

Retinal Wholemount Preparation and Immunohistochemistry

To visualize the retinal vasculature, whole eyes were fixed in 4% PFA in 2X PBS followed by retinal dissection. Retinas were stored in methanol/PBS at −20°C until staining. Retinas were then covered with 100 μL of Perm/Block solution (PBS + 0.3% Triton X-100 + 0.2% BSA + 5% FBS/goat serum) for 60 minutes. If an unconjugated antibody was used, Perm/Block solution was removed, and retinas were incubated with NG2 (1:50; Millipore) either at room temperature for 4 h or overnight at 4°C on an orbital shaker. The next day, antibody was removed, retinas were washed in PBSTX (PBS + 0.3% Triton X-100). Retinas were then incubated with secondary antibody conjugated to Alexa-Fluor 488 (Invitrogen) and Isolectin GS-IB4 conjugated to Alexa-Fluor 594 (Invitrogen) overnight at 4°C or at room temperature for 4 hours. The next day, the antibody was removed, and retinas were washed in PBSTX followed by mounting with hard set mounting medium with DAPI (Vector Labs). Retinal whole-mount images were obtained by multi-frame acquisitions captured side-by-side with 10% overlap with a 10x/0.3 objective (EC Plan-Neofluar, Zeiss, Jena, Germany) using a Zeiss Axio Imager M2 epifluorescent microscope, digital high resolution camera (ORCA-Flash4.0 V3 Digital CMOS, Hamamatsu, Japan), and motorized Z and X-Y stage (Zeiss, Jena, Germany). Multi-frame tiles were defined to capture the entirety of retina surface. Tiled images were aligned to eliminate overlap using stitching software in Zen Pro (Zeiss; Jena, Germany). Neovascular tufts from 4–5 random areas of superficial layers in P17 WT (n ≥ 7) and TRPV4KO (n≥ 4) retinas were counted manually and presented as number of neovascular tufts, average/field.

In some experiments, retinal vascular integrity was measured by immunostaining with pericyte marker, NG2. For NG2 staining and neovascular tufts, images were acquired on Olympus Fluoview 1000 confocal microscope. To visualize the retina within the entire eye, whole eye tissue was processed and embedded in paraffin and cut using a Leica microtome (Leica Biosystems) at 7–10 μM thickness on coated slides. Prior to staining, sections were deparaffinized in a 60°C oven and rehydrated in xylene and varying percentages of alcohol, then stained for Hematoxylin and Eosin (H&E). Slides were dehydrated in varying percentages of alcohol and xylene followed by mounting with DPX Mountant (Sigma Aldrich). Images were captured using the Olympus BX40 Microscope.

Statistical Analysis

Statistical analyses were carried out using one-way ANOVA or student’s t-test. Significance was set at p ≤ 0.05.

RESULTS

TRPV4 is functionally expressed and mediates mechanosensing in retinal endothelial cells

RT-PCR analysis revealed TRPV4 gene expression in HuRMECs; human umbilical vein ECs (HUVECs) were used as a control (Fig. 1A). Stimulation with TRPV4 selective agonist, GSK, induced calcium influx in HuRMECs, which was significantly attenuated when TRPV4-specific antagonist, GSK2, was administered (Fig. 1B, C, D).

Figure 1. TRPV4 is functionally expressed in HuRMECs.

Figure 1.

Open in a new tab

A) RT-PCR analysis of TRPV4 gene expression in HUVECs and HuRMECs. B) Representative ratio images display relative changes in cytosolic calcium in response to a selective TRPV4 agonist, GSK (1 nM), and antagonist, GSK2 (50 nM), in Fluo-4–loaded cells. C) Representative traces display relative changes in cytosolic calcium in response to GSK and GSK2, in Fluo-4–loaded cells (n = 60). Arrow denotes the time when the cells were stimulated with GSK. D) Quantitative analysis of cytosolic calcium influx induced by GSK and GSK1 + GSK2 in HuRMECs-1 (F/F0 = ratio of normalized Fluo-4 fluorescence intensity relative to time 0). Data presented are from ± SEM from three separate experiments. The significance was calculated by using student’s t test. *Significance was set at p ≤ 0.05. HuRMECs, human retinal microvascular endothelial cells; HUVECs, human umbilical vein endothelial cells; TRPV4, transient receptor potential vanilloid 4.

To determine TRPV4 mechanosensitivity, HuRMECs, were exposed to cyclic strain in the presence and absence of TRPV4 antagonist GSK2. Cyclic strain induced reorientation of HuRMECs perpendicular to the direction of strain; this was significantly attenuated with GSK2 treatment (Fig. 2A, B). Visualization of stress fiber reorientation and focal adhesion redistribution revealed exposure to cyclic strain induced colocalization of focal adhesion protein vinculin at the ends of newly formed stress fibers (Fig. 2C). In contrast, treatment with GSK2 significantly attenuated stress fiber realignment, with predominant cytoplasmic localization of vinculin.

Figure 2. TRPV4 is mechanosensitive in the retinal endothelium.

Figure 2.

Open in a new tab

A) HuRMECs were exposed to cyclic strain for 18 hours, fixed, and stained. Fluorescence images (20X) of Alexa-phalloidin stained (F-actin) HuRMECs showed cell reorientation in the presence or absence of TRPV4 antagonist, GSK2 (50 nM). Scale bar= 10 μm. B) Quantitative analysis of the percentage of cells that aligned perpendicular to the direction of strain. Note that GSK2-treated HuRMECs exhibited a reduced reorientation response. C) Immunofluorescence images (60X) of HuRMECs exposed to cyclic strain and co-stained for phalloidin (green) and vinculin (red) showed focal adhesions (vinculin) recruitment at the ends of stress fibers in control cells, which were absent in GSK2-treated cells. Inset: Zoomed image showing localization of vinculin with stress fibers in focal adhesions. Scale bar= 10 μm. D) HuRMECs spreading on ECM gels of varying stiffness. Control siRNA-treated and TRPV4 siRNA-knocked down HuRMECs were cultured on ECM gels of varying stiffness (0.2, 8 and 50 kPa) and cell spreading was measured as indicative of mechanosensitivity. Note that siRNA knockdown of TRPV4 increased the spreading of HuRMECs at all three stiffnesses compared with Control siRNA, suggesting an aberrant mechanosensitivity in these cells. Data presented are from ± SEM from three separate experiments. Significance was set at p ≤ 0.05. HuRMECs, human retinal microvascular endothelial cells; TRPV4, transient receptor potential vanilloid 4.

To further confirm TRPV4 mechanosensitivity, TRPV4 was knocked down using specific siRNAs against human TRPV4 in HuRMECs (suppl Fig. 1) and were cultured on ECM gels of varying stiffness that mimicked the stiffnesses of the normal and diabetic retina (0.2, 8, and 50 kPa) (To et al., 2013; X. Yang et al., 2016). Cell spreading was measured as an indirect indication for EC mechanosensitivity towards ECM stiffness as previously described (Adapala et al., 2016). As expected, control siRNA treated HuRMECs exhibited enhanced spreading with increasing ECM stiffness (Fig. 2D) with maximum spreading at the high stiffness gels (50 kPa). However, TRPV4-silenced HuRMECs showed increased spreading at all the three stiffnesses (Fig. 2D).

TRPV4 deletion does not alter developmental retinal angiogenesis

To determine the functional significance of TRPV4 in retinal angiogenesis, the retinal vasculature of adult WT and TRPV4KO mice were compared. Deletion of TRPV4 in the mouse retina was confirmed by q-PCR (Fig. 3A). Isolectin GS-IB4 staining revealed that the vasculature in the WT and TRPV4KO adult retinas exhibited a uniform capillary network with no abnormal structures or disruption (Fig. 3B, C). Developmental retinal angiogenesis in WT and TRPV4KO mouse pups was then observed at post-natal early (P5) and late (P7) stages; retinal vascular development was comparable between WT and TRPV4KO mice (Fig. 3D, E). The vessel growth along the vascular front also revealed no difference in the filopodia of the tip cells in WT and TRPV4KO mice (Supp Fig. 2).

Figure 3. TRPV4 deletion does not alter physiological/developmental angiogenesis.

Figure 3.

Open in a new tab

A) Relative TRPV4 expression of WT and TRPV4KO retinas from quantitative RT-PCR analysis. B) Representative isolectin GS-IB4 stained adult retinal wholemounts from WT and TRPV4KO mice. Scale bar= 500 μm. C) Representative confocal images of retinal vasculature from WT and TRPV4KO mice. D) representative isolectin GS-IB4 stained retinal vasculature (4X) and vascular front from WT and TRPV4KO P5 and P7 retinas. Retinal leaflet-Scale bar= 500 μm; Zoomed image- Scale bar= 100 μm. E) Quantification of the percent vascular growth in WT and TRPV4KO P5 (n≥5) and P7 retinas (n≥5). Data was analyzed using One-way ANOVA. Significance was set at p ≤ 0.05. Vascular growth was quantified by measuring the distance between optic nerve to the vascular front with that of distance between optic nerve to the edge of the retina. NS, non-significant; TRPV4, transient receptor potential vanilloid 4; TRPV4KO, transient receptor potential vanilloid 4 knock-out; WT, wild-type.

TRPV4 deletion enhances pathological angiogenesis in response to oxygen-induced retinopathy

To evaluate pathological angiogenesis, WT and TRPV4KO P7 pups were exposed to OIR for 5 days. We measured vaso-obliteration in P12 retinas exposed to retinas and found that vaso-obliteration did not differ between TRPV4KO pups and WT pups (Fig.4). Further, P17 retinal wholemounts stained with isolectin GS-IB4 revealed increased vascular area in retinas from TRPV4KO mice subjected OIR compared with WT (Fig.5). To further examine retinal vascular growth and remodeling, confocal microscopy was used to visualize the complex vascular networks of the superficial, intermediate, and deep retinal layers. Large neovascular tufts were observed in all three layers of TRPV4KO retinas while WT retinas exhibited fewer and less pronounced neovascular tufts (Supp Fig.3). Quantification of neovascular tufts on the superficial retinal layer (Fig.6 A, B) showed higher number of neovascular tufts in OIR retinas from TRPV4KO mice than WT. H&E staining of whole eye tissue of P17 mice also demonstrated that TRPV4KO retinas exhibited neovascular tufts that protruded into vitreous humor compared with WT retinas (Fig. 6C). Interestingly, decreased colocalization of isolectin GS-IB4 and NG2 in the vasculature was observed in the P17 TRPV4KO retinas compared with WT (Fig. 6D).

Figure.4. Absence of TRPV4 did not alter vaso-obliteration by OIR.

Figure.4.

Open in a new tab

WT and TRPV4KO (P7) mice were subjected to OIR. Following 5 days in high oxygen conditions, P12 mice were euthanized and retinas were isolated and stained with isolectin GS-IB4 to visualize retinal vasculature (10X). A) Representative retinal whole mounts from P12 WT and TRPV4KO mice exposed to OIR. Scale bar= 500 μm. B) Avascular areas were quantified (n=4).

Figure 5. TRPV4 deletion enhanced OIR-induced retinal vascularization.

Figure 5.

Open in a new tab

WT and TRPV4KO (P7) mice were subjected to OIR. P12 mice were returned to room air for another 5 days, until P17. P17 retinas were isolated and stained with isolectin GS-IB4 to visualize retinal vasculature (10X). A) Representative whole mounts showing vasculature in P17 OIR retinas. Scale bar= 500 μm. B) Quantification of % of vascular area of P17 retinas from WT and TRPV4KO mice exposed to OIR (n=4–7).

Figure 6. TRPV4 deletion increases neovascular tufts and reduced pericyte coverage in retinas subjected to OIR.

Figure 6.

Open in a new tab

WT and TRPV4KO (P7) mice were subjected to OIR. A) Representative confocal images (20X) revealed abnormal neovascular tufts in the superficial layer of the retinas from TRPV4KO mice subjected to OIR compared with WT. Scale bar= 100 μm. B) Quantification of neovascular tufts (average /field) in P17 retinas from WT and TRPV4KO mice exposed to OIR. C) H&E stained eye tissue (20X) revealed protrusion of neovascular tufts (arrows) into the vitreous humor in P17 retinas from TRPV4KO mice subjected to OIR (n≥2) compared with WT. D) Pericyte coverage was evaluated in P17 retinas from WT and TRPV4KO mice subjected to OIR that were co-stained to visualize vessels (Isolectin GS-IB4; red) and pericytes (NG2; green). Arrows denote areas of mural cell deficient unsupported vessels [n≥3]. Scale bar= 10 μm.

DISCUSSION

In the present study, we demonstrate that TRPV4 is functionally expressed and mechanosensitive in HuRMECs. Our findings also reveal that TRPV4 deletion did not alter retinal vasculature and morphology at the basal level in the adult and developing retina but enhanced pathological angiogenesis in response to OIR.

TRPV4 is a ubiquitously expressed, non-specific cation ion channel with polymodal activation (White et al., 2016). Several studies have explored TRPV4 expression and function in the eye, specifically in the retina (Gilliam & Wensel, 2011; Guarino et al., 2020). In retinal ganglion cells, TRPV4 mediates calcium influx in response to membrane stretch and its role was implicated in calcium-dependent, pro-apoptotic pathways (Ryskamp et al., 2011). In retinal neurons and glia, TRPV4 activity was stimulated by cell swelling and arachidonic acid metabolites (Ryskamp et al., 2014). Also in retinal glia, a synergistic connection was observed between TRPV4 and aquaporin 4 which aided in the regulation of calcium homeostasis, osmosensing, and water transport (Jo et al., 2015). Within the eye, functional expression of TRPV4 has been observed in human corneal ECs in response to pharmacological activators, moderate heat, and hypotonicity (Mergler et al., 2011). In the trabecular meshwork (TM) of the eye, TRPV4 was shown to be a critical mechanosensor, mediating cytoskeletal remodeling to regulate stiffness and outflow in a TRPV4-dependent manner (Ryskamp et al., 2016). Specifically in bovine retinal ECs, TRPV4 expression was downregulated by hyperglycemia and diabetes leading to endothelial dysfunction (Monaghan et al., 2015); this study did not investigate the mechanosensitivity of TRPV4. Other studies specifically investigating retinal ECs have evaluated the effects of pulsatile flow as well as shear stress, but did not identify mechanosensitive-specific mechanisms that mediate the response (Lakshminarayanan, Gardner, & Tarbell, 2000; Walshe et al., 2011). In the present study, we confirmed the functional expression in human retinal ECs and, for the first time, verified that TRPV4 is mechanosensitive in the retinal endothelium in response to cyclic strain or changes in the matrix stiffness.

Emerging evidence has revealed that TRPV4 participates in ocular pathologies, such as glaucoma as well as hyperglycemia and diabetes. Since glaucoma is linked to increased intraocular pressure leading to vision loss, many implications of TRPV4 as a therapeutic target are a result of its ability to sense changes in pressure. In fact, TRPV4-mediated mechanotransduction in the primary cilia of the TM of the eye was found to sense and respond to intraocular pressure (Luo et al., 2014). TRPV4 was also suggested to mediate calcium-dependent dendritic and axonal remodeling during glaucoma (Krizaj et al., 2014). In pigmented and nonpigmented epithelial cell types in the mouse ciliary body, TRPV4 was also found to regulate the response to cell swelling by mediating calcium and cell volume (Jo et al., 2016), confirming the capability of TRPV4 to sense pressure in the eye and as a target for anti-glaucoma treatments. When retinal microvascular ECs were exposed to 72 hours of in vitro hyperglycemia conditions, TRPV4 expression and function was downregulated suggesting a potential role for TRPV4 in diabetes. Reduced TRPV4 expression has been observed in the retinal vasculature of streptozotocin-induced diabetic rats (Monaghan et al., 2015). Although TRPV4 functional expression was investigated in vitro and in vivo in WT mice, these studies did not investigate the role of TRPV4 in physiological/developmental or pathological retinal angiogenesis or the use of TRPV4 null mice.

By employing TRPV4KO mice, we demonstrated that the genetic deletion of TRPV4 did not alter developmental, physiological angiogenesis, as evidenced by comparable vascular growth of post-natal (P5, P7) and adult retinas in WT and TRPV4KO mice. We also demonstrated that P17 retinas from TRPV4KO mice subjected to OIR exhibited a significant increase in vascularization in addition to increased neovascular tufts, compared with WT mice. Previous studies have shown that excessive VEGF production can result in aberrant vasoproliferation (Alon et al., 1995), indicating a correlation between TRPV4 and VEGF signaling. We recently demonstrated that TRPV4 deletion activates VEGFR2 by increasing translocation of VEGFR2 from the Golgi to the plasma membrane leading to its tyrosine phosphorylation at Y1175 (Kanugula et al., 2019). We have also found increased VEGFR2 immunostaining in tumors from TRPV4KO mice. Increased VEGF/VEGFR2 signaling can induce abnormal angiogenesis, characterized by enhanced vascular growth and disruption of vascular integrity, leading to unproductive angiogenesis. Using confocal microscopy to visualize the superficial, intermediate, and deep layers of the neovascularized retina (P17; OIR), we observed abnormal vascular growth (neovascular tufts) throughout all three layers in TRPV4KO mice compared with WT. These vessels also showed reduced pericyte coverage, indicative of vascular instability (Murakami & Simons, 2009).

A recent study demonstrated that TRPV4 inhibition with high concentrations of pharmacological inhibitors increased physiological angiogenesis but decreased neovascularization (pathological angiogenesis) (O’Leary et al., 2019). However, employing TRPV4KO mouse model, we found that OIR enhanced neovascular tufts and vascular area in P17 retinas compared to WT though vaso-obliteration was comparable between WT and TRPV4KO mice suggesting that absence of TRPV4 may have resulted in higher neovascular tufts at P17. Alternatively, TRPV4 absence or reduction was shown to increase proliferation and migration of EC which are critical events in angiogenesis(Adapala et al., 2016; Thoppil et al., 2015). Irrespective of the underlying molecular mechanism, our results demonstrated that TRPV4 deletion increased neovascular tufts in retinas in response to OIR. Our previous in vitro and in vivo studies have revealed that TRPV4 is dispensable for physiological angiogenesis but pathological stress, such as a tumor, induces pathological angiogenesis in the absence of TRPV4 (Adapala et al., 2016; Cappelli et al., 2019; Kanugula et al., 2019; Thoppil et al., 2015; Thoppil et al., 2016); this is further supported by our current findings with ischemia via OIR. Although we demonstrate that TRPV4 deletion exacerbates pathological angiogenesis in the retina, there is a possibility that TRPV4 deletion from cells other than ECs may contribute to this effect but needs to be confirmed using an endothelial specific TRPV4KO mouse.

In the present study, we confirmed that TRPV4 is not only functionally expressed in the retinal endothelium but is also mechanosensitive. The loss of TRPV4 did not affect developmental vascularization of the retina but revealed that the retinas from TRPV4KO mice were more susceptible to oxidative insult, leading to pathological angiogenesis at P17 in a mouse model of OIR. The formation of neovascular tufts and aberrant vascular remodeling throughout the retinal layers further support this conclusion. Assessment of vascular integrity demonstrated that the absence of TRPV4 resulted in poor pericyte coverage in the P17 OIR retina in vivo. Our findings indicate that TRPV4 is required for vascular stability and vessel maturation in the retina, and absence of TRPV4 can exacerbate pathological angiogenesis.

Supplementary Material

Supp info

Grant Support:

This work was supported by National Institutes of Health (R15CA202847, R01HL119705 and R01HL148585; CKT and R01AI144115; SP).

Footnotes

CONFLICT OF INTEREST:

The authors declare no conflict of interest.

DATA AVAILABILITY STATEMENT

The data to support the findings of the present study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Adapala RK, Talasila PK, Bratz IN, Zhang DX, Suzuki M, Meszaros JG, & Thodeti CK (2011). PKCalpha mediates acetylcholine-induced activation of TRPV4-dependent calcium influx in endothelial cells. Am J Physiol Heart Circ Physiol, 301(3), H757–765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Adapala RK, Thoppil RJ, Ghosh K, Cappelli HC, Dudley AC, Paruchuri S, … Thodeti CK (2016). Activation of mechanosensitive ion channel TRPV4 normalizes tumor vasculature and improves cancer therapy. Oncogene, 35(3), 314–322. doi: 10.1038/onc.2015.83 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alon T, Hemo I, Itin A, Pe’er J, Stone J, & Keshet E (1995). Vascular endothelial growth factor acts as a survival factor for newly formed retinal vessels and has implications for retinopathy of prematurity. Nat Med, 1(10), 1024–1028. [DOI] [PubMed] [Google Scholar]
  4. Cappelli HC, Kanugula AK, Adapala RK, Amin V, Sharma P, Midha P, … Thodeti CK (2019). Mechanosensitive TRPV4 channels stabilize VE-cadherin junctions to regulate tumor vascular integrity and metastasis. Cancer Lett, 442, 15–20. doi: 10.1016/j.canlet.2018.07.042 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Carmeliet P, & Jain RK (2011a). Molecular mechanisms and clinical applications of angiogenesis. Nature, 473(7347), 298–307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Carmeliet P, & Jain RK (2011b). Principles and mechanisms of vessel normalization for cancer and other angiogenic diseases. Nat Rev Drug Discov, 10(6), 417–427. [DOI] [PubMed] [Google Scholar]
  7. Cavallaro G, Filippi L, Bagnoli P, La Marca G, Cristofori G, Raffaeli G, … Mosca F (2014). The pathophysiology of retinopathy of prematurity: an update of previous and recent knowledge. Acta Ophthalmol, 92(1), 2–20. doi: 10.1111/aos.12049 [DOI] [PubMed] [Google Scholar]
  8. Connor KM, Krah NM, Dennison RJ, Aderman CM, Chen J, Guerin KI, … Smith LE (2009). Quantification of oxygen-induced retinopathy in the mouse: a model of vessel loss, vessel regrowth and pathological angiogenesis. Nat Protoc, 4(11), 1565–1573. doi: 10.1038/nprot.2009.187 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Folkman J (2006). Angiogenesis. Annu Rev Med, 57, 1–18. [DOI] [PubMed] [Google Scholar]
  10. Gilliam JC, & Wensel TG (2011). TRP channel gene expression in the mouse retina. Vision Res, 51(23–24), 2440–2452. doi: 10.1016/j.visres.2011.10.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Guarino BD, Paruchuri S, & Thodeti CK (2020). The role of TRPV4 channels in ocular function and pathologies. Exp Eye Res, 23;108257. doi: 10.1016/j.exer.2020.108257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Jo AO, Lakk M, Frye AM, Phuong TT, Redmon SN, Roberts R, … Krizaj D (2016). Differential volume regulation and calcium signaling in two ciliary body cell types is subserved by TRPV4 channels. Proc Natl Acad Sci U S A, 113(14), 3885–3890. doi: 10.1073/pnas.1515895113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Jo AO, Ryskamp DA, Phuong TT, Verkman AS, Yarishkin O, MacAulay N, & Krizaj D (2015). TRPV4 and AQP4 Channels Synergistically Regulate Cell Volume and Calcium Homeostasis in Retinal Muller Glia. J Neurosci, 35(39), 13525–13537. doi: 10.1523/JNEUROSCI.1987-15.2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kanugula AK, Adapala RK, Midha P, Cappelli HC, Meszaros JG, Paruchuri S, … Thodeti CK (2019). Novel noncanonical regulation of soluble VEGF/VEGFR2 signaling by mechanosensitive ion channel TRPV4. FASEB J, 33(1), 195–203. doi: 10.1096/fj.201800509R [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Krizaj D, Ryskamp DA, Tian N, Tezel G, Mitchell CH, Slepak VZ, & Shestopalov VI (2014). From mechanosensitivity to inflammatory responses: new players in the pathology of glaucoma. Curr Eye Res, 39(2), 105–119. doi: 10.3109/02713683.2013.836541 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kusuhara S, Fukushima Y, Ogura S, Inoue N, & Uemura A (2018). Pathophysiology of Diabetic Retinopathy: The Old and the New. Diabetes Metab J, 42(5), 364–376. doi: 10.4093/dmj.2018.0182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lakshminarayanan S, Gardner TW, & Tarbell JM (2000). Effect of shear stress on the hydraulic conductivity of cultured bovine retinal microvascular endothelial cell monolayers. Curr Eye Res, 21(6), 944–951. [DOI] [PubMed] [Google Scholar]
  18. Luo N, Conwell MD, Chen X, Kettenhofen CI, Westlake CJ, Cantor LB, … Sun Y (2014). Primary cilia signaling mediates intraocular pressure sensation. Proc Natl Acad Sci U S A, 111(35), 12871–12876. doi: 10.1073/pnas.1323292111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Mergler S, Valtink M, Taetz K, Sahlmuller M, Fels G, Reinach PS, … Pleyer U (2011). Characterization of transient receptor potential vanilloid channel 4 (TRPV4) in human corneal endothelial cells. Exp Eye Res, 93(5), 710–719. doi: 10.1016/j.exer.2011.09.021 [DOI] [PubMed] [Google Scholar]
  20. Monaghan K, McNaughten J, McGahon MK, Kelly C, Kyle D, Yong PH, … Curtis TM (2015). Hyperglycemia and Diabetes Downregulate the Functional Expression of TRPV4 Channels in Retinal Microvascular Endothelium. PLoS One, 10(6), e0128359. doi: 10.1371/journal.pone.0128359 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Moran EP, Wang Z, Chen J, Sapieha P, Smith LE, & Ma JX (2016). Neurovascular cross talk in diabetic retinopathy: Pathophysiological roles and therapeutic implications. Am J Physiol Heart Circ Physiol, 311(3), H738–749. doi: 10.1152/ajpheart.00005.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Murakami M, & Simons M (2009). Regulation of vascular integrity. J Mol Med (Berl), 87(6), 571–582. doi: 10.1007/s00109-009-0463-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. O’Leary C, McGahon MK, Ashraf S, McNaughten J, Friedel T, Cincola P, … Curtis TM (2019). Involvement of TRPV1 and TRPV4 Channels in Retinal Angiogenesis. Invest Ophthalmol Vis Sci, 60(10), 3297–3309. doi: 10.1167/iovs.18-26344 [DOI] [PubMed] [Google Scholar]
  24. Phuong TTT, Redmon SN, Yarishkin O, Winter JM, Li DY, & Krizaj D (2017). Calcium influx through TRPV4 channels modulates the adherens contacts between retinal microvascular endothelial cells. J Physiol, 595(22), 6869–6885. doi: 10.1113/JP275052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Rezzola S, Dal Monte M, Belleri M, Bugatti A, Chiodelli P, Corsini M, … Presta M (2015). Therapeutic Potential of Anti-Angiogenic Multitarget N,O-Sulfated E. Coli K5 Polysaccharide in Diabetic Retinopathy. Diabetes, 64(7), 2581–2592. doi: 10.2337/db14-1378 [DOI] [PubMed] [Google Scholar]
  26. Ryskamp DA, Frye AM, Phuong TT, Yarishkin O, Jo AO, Xu Y, … Krizaj D (2016). TRPV4 regulates calcium homeostasis, cytoskeletal remodeling, conventional outflow and intraocular pressure in the mammalian eye. Sci Rep, 6, 30583. doi: 10.1038/srep30583 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ryskamp DA, Jo AO, Frye AM, Vazquez-Chona F, MacAulay N, Thoreson WB, & Krizaj D (2014). Swelling and eicosanoid metabolites differentially gate TRPV4 channels in retinal neurons and glia. J Neurosci, 34(47), 15689–15700. doi: 10.1523/JNEUROSCI.2540-14.2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Ryskamp DA, Witkovsky P, Barabas P, Huang W, Koehler C, Akimov NP, … Krizaj D (2011). The polymodal ion channel transient receptor potential vanilloid 4 modulates calcium flux, spiking rate, and apoptosis of mouse retinal ganglion cells. J Neurosci, 31(19), 7089–7101. doi: 10.1523/JNEUROSCI.0359-11.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Selvam S, Kumar T, & Fruttiger M (2018). Retinal vasculature development in health and disease. Prog Retin Eye Res, 63, 1–19. doi: 10.1016/j.preteyeres.2017.11.001 [DOI] [PubMed] [Google Scholar]
  30. Thodeti CK, Matthews B, Ravi A, Mammoto A, Ghosh K, Bracha AL, & Ingber DE (2009). TRPV4 channels mediate cyclic strain-induced endothelial cell reorientation through integrin-to-integrin signaling. Circ Res, 104(9), 1123–1130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Thoppil RJ, Adapala RK, Cappelli HC, Kondeti V, Dudley AC, Gary Meszaros J, … Thodeti CK (2015). TRPV4 channel activation selectively inhibits tumor endothelial cell proliferation. Sci Rep, 5, 14257. doi: 10.1038/srep14257 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Thoppil RJ, Cappelli HC, Adapala RK, Kanugula AK, Paruchuri S, & Thodeti CK (2016). TRPV4 channels regulate tumor angiogenesis via modulation of Rho/Rho kinase pathway. Oncotarget, 7(18), 25849–25861. doi: 10.18632/oncotarget.8405 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. To M, Goz A, Camenzind L, Oertle P, Candiello J, Sullivan M, … Halfter W (2013). Diabetes-induced morphological, biomechanical, and compositional changes in ocular basement membranes. Exp Eye Res, 116, 298–307. doi: 10.1016/j.exer.2013.09.011 [DOI] [PubMed] [Google Scholar]
  34. Walshe TE, Connell P, Cryan L, Ferguson G, O’Brien C, & Cahill PA (2011). The role of pulsatile flow in controlling microvascular retinal endothelial and pericyte cell apoptosis and proliferation. Cardiovasc Res, 89(3), 661–670. doi: 10.1093/cvr/cvq341 [DOI] [PubMed] [Google Scholar]
  35. White JP, Cibelli M, Urban L, Nilius B, McGeown JG, & Nagy I (2016). TRPV4: Molecular Conductor of a Diverse Orchestra. Physiol Rev, 96(3), 911–973. doi: 10.1152/physrev.00016.2015 [DOI] [PubMed] [Google Scholar]
  36. Yang S, Zhao J, & Sun X (2016). Resistance to anti-VEGF therapy in neovascular age-related macular degeneration: a comprehensive review. Drug Des Devel Ther, 10, 1857–1867. doi: 10.2147/DDDT.S97653 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yang X, Scott HA, Monickaraj F, Xu J, Ardekani S, Nitta CF, … Ghosh K (2016). Basement membrane stiffening promotes retinal endothelial activation associated with diabetes. FASEB J, 30(2), 601–611. doi: 10.1096/fj.15-277962 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp info
NIHMS1638704-supplement-Supp_info.docx (3.7MB, docx)

RESOURCES