Skip to main content
NCBI home page
Journal of Virology logoLink to Journal of Virology
. 2021 Jan 13;95(3):e01652-20. doi: 10.1128/JVI.01652-20

CD300lf Conditional Knockout Mouse Reveals Strain-Specific Cellular Tropism of Murine Norovirus

Vincent R Graziano a,b, Mia Madel Alfajaro a,b, Cameron O Schmitz a,b, Renata B Filler a,b, Madison S Strine a,b, Jin Wei a,b, Leon L Hsieh c, Megan T Baldridge d, Timothy J Nice e, Sanghyun Lee f, Robert C Orchard g, Craig B Wilen a,b,✉
Editor: Rebecca Ellis Dutchh
PMCID: PMC7925115  PMID: 33177207

Human noroviruses (HuNoVs) are a leading cause of gastroenteritis resulting in up to 200,000 deaths each year. The receptor and cell tropism of HuNoV in immunocompetent humans are unclear.

KEYWORDS: CD300lf, cell tropism, norovirus, viral entry

ABSTRACT

Noroviruses are a leading cause of gastrointestinal infection in humans and mice. Understanding human norovirus (HuNoV) cell tropism has important implications for our understanding of viral pathogenesis. Murine norovirus (MNoV) is extensively used as a surrogate model for HuNoV. We previously identified CD300lf as the receptor for MNoV. Here, we generated a Cd300lf conditional knockout (CD300lfF/F) mouse to elucidate the cell tropism of persistent and nonpersistent strains of murine norovirus. Using this mouse model, we demonstrated that CD300lf expression on intestinal epithelial cells (IECs), and on tuft cells in particular, is essential for transmission of the persistent MNoV strain CR6 (MNoVCR6) in vivo. In contrast, the nonpersistent MNoV strain CW3 (MNoVCW3) does not require CD300lf expression on IECs for infection. However, deletion of CD300lf in myelomonocytic cells (LysM Cre+) partially reduces CW3 viral load in lymphoid and intestinal tissues. Disruption of CD300lf expression on B cells (CD19 Cre), neutrophils (Mrp8 Cre), and dendritic cells (CD11c Cre) did not affect MNoVCW3 viral RNA levels. Finally, we show that the transcription factor STAT1, which is critical for the innate immune response, partially restricts the cell tropism of MNoVCW3 to LysM+ cells. Taken together, these data demonstrate that CD300lf expression on tuft cells is essential for MNoVCR6; that myelomonocytic cells are a major, but not exclusive, target cell of MNoVCW3; and that STAT1 signaling restricts the cellular tropism of MNoVCW3. This study provides the first genetic system for studying the cell type-specific role of CD300lf in norovirus pathogenesis.

IMPORTANCE Human noroviruses (HuNoVs) are a leading cause of gastroenteritis resulting in up to 200,000 deaths each year. The receptor and cell tropism of HuNoV in immunocompetent humans are unclear. We use murine norovirus (MNoV) as a model for HuNoV. We recently identified CD300lf as the sole physiologic receptor for MNoV. Here, we leverage this finding to generate a Cd300lf conditional knockout mouse to decipher the contributions of specific cell types to MNoV infection. We demonstrate that persistent MNoVCR6 requires CD300lf expression on tuft cells. In contrast, multiple CD300lf+ cell types, dominated by myelomonocytic cells, are sufficient for nonpersistent MNoVCW3 infection. CD300lf expression on epithelial cells, B cells, neutrophils, and dendritic cells is not critical for MNoVCW3 infection. Mortality associated with the MNoVCW3 strain in Stat1−/− mice does not require CD300lf expression on LysM+ cells, highlighting that both CD300lf receptor expression and innate immunity regulate MNoV cell tropism in vivo.

INTRODUCTION

Human noroviruses (HuNoVs) represent a leading cause of gastroenteritis and an important cause of childhood mortality worldwide (1, 2). Norovirus, a genus within the family Caliciviridae, include nonenveloped, positive-sense, single-stranded RNA viruses that are transmitted through the fecal-oral route. Noroviruses are segregated into seven genogroups (GI to GVII). Genogroups I, II, and IV contain primarily HuNoVs, while GIII, GV, GVI, and GVII contain bovine NoVs, murine NoVs (MNoV), and feline and canine NoVs (3). A complete understanding of the mechanism underlying the pathogenesis and biology of HuNoV infection is still lacking due to limited HuNoV cell culture systems, heterogeneity among NoV isolates, and a lack of infectious molecular clones (4–8). These knowledge gaps have hindered vaccine and antiviral drug development.

Cell tropism is an important determinant of virus transmission, pathogenesis, and immune evasion. A detailed molecular understanding of the host and viral determinants underlying norovirus cell tropism are critical for vaccine and therapeutic development (6). The cell tropism of noroviruses remains incompletely understood (8–10). HuNoV can replicate in stem cell-derived human intestinal enteroids and human B cell-like cell lines in vitro (8, 11, 12). Limited HuNoV replication was also recently reported in HEK293T cells (12). Our understanding of HuNoV tropism in vivo is largely dependent on samples taken from immunodeficient humans infected with HuNoV or experimentally infected animal models (9, 13–15). HuNoV infection was identified in dendritic cells and B cells of intravenously infected chimpanzees (13), while intestinal epithelial cells (IECs), macrophages, lymphocytes, and dendritic cells have been identified as HuNoV target cells in pig models (14–17). HuNoV-infected intestinal epithelial cells were observed in immunocompromised humans (18). More recently, HuNoV was shown to infect enteroendocrine cells, a rare secretory epithelial cell population that plays a critical role in the gut-brain axis (9). The determinants of cell tropism, including the viral receptor and the specific role of bile salts and glycans, remain unclear for HuNoV (8, 19, 20).

MNoV represents a model for HuNoV and has enabled the identification of important host and viral factors that can regulate NoV replication and pathogenesis in vitro and in vivo (4, 21–23). MNoV can be efficiently propagated in vitro and productively infects mice, thus providing a tractable in vivo system for NoV studies (4, 24). MNoV shares many characteristics with HuNoV, including fecal-oral transmission, capsid structure, intestinal replication, and prolonged shedding after acute infection, reflecting asymptomatic HuNoV infection (4, 24, 25). Infectious molecular clones of MNoV have been described with distinct patterns of pathogenesis. MNoV strain CR6 (MNoVCR6) causes persistent enteric infection which can spread systemically but fails to induce lethality in type I interferon (IFN)-deficient mice (25, 26). In contrast, MNoV strain CW3 (MNoVCW3), an infectious molecular clone derived from MNV-1, causes nonpersistent systemic infection in immunocompetent mice and lethal infection in mice deficient in type I interferon signaling (23, 26, 27). Also, it was recently demonstrated that MNoV strain MNV-1 can cause dose-dependent and mouse strain-dependent diarrhea in neonatal mice (28).

Although genetically similar, minor genetic variants in these MNoV strains confer distinct in vivo phenotypes (25, 26, 29, 30). Viral determinants of infection have been mapped to the viral capsid protein VP1 and the viral nonstructural protein NS1 (25–27, 31). Specific amino acid variants have been identified in VP1 that determine enteric and systemic infection and lethality in mice deficient in type I interferon signaling (26). Variants in NS1 enable MNoVCR6 to antagonize type III interferon and establish persistent enteric infection (25, 32). The host determinants of infection include both the MNoV receptor CD300lf and the innate immune system (21, 23, 27, 29, 32). CD300lf is a type I integral membrane protein that binds phospholipids on dead and dying cells and can induce pro- or anti-inflammatory signals depending on the specific context (33). CD300lf is expressed on tuft cells and diverse hematopoietic cells, including macrophages, dendritic cells, neutrophils, and B cells (30, 33). CD300lf has been implicated in the pathogenesis of multiple sclerosis, inflammatory bowel disease, and depression (34–38).

The cell tropisms of MNoVCW3 and MNoVCR6 are distinct. Our recent discovery of CD300lf as the receptor for MNoV enabled us to determine that radiation-resistant cells are required for MNoVCR6 but not MNoVCW3 infection. This finding led us to identify intestinal tuft cells, the only epithelial cell type that expresses CD300lf as a major target cell of MNoVCR6 (30). Tuft cells are critical regulators of epithelial response to intestinal helminth infection, as they are the primary producers of interleukin-25 (IL-25) (39–41). However, it remains unknown whether tuft cells are essential for MNoVCR6 infection. In contrast, MNoVCW3 does not require tuft cells to establish infection (30, 42). MNV-1 or MNoVCW3 infection has been reported in dendritic cells, macrophages, monocytes, and B cells in vivo (10, 43, 44). In Stat1-deficient mice, MNoVCW3 has been observed in rare epithelial cells consistent with tuft cells (45). While MNoVCW3 does not require tuft cells, we recently showed that CD300lf is essential for infection of diverse MNoV strains, including both MNoVCW3 and MNoVCR6 in vivo (29).

To elucidate the cellular tropism of MNoV in vivo, here, we developed a Cd300lf conditional knockout (CD300lfF/F) mouse to specifically delete CD300lf from putative MNoV target cells. We demonstrate that CD300lf expression on tuft cells is essential for MNoVCR6 but not MNoVCW3 infection and that this tropism depends on the viral NS1 protein. We find that ablation of CD300lf on myelomonocytic (LysM+) cells reduces MNoVCW3 infection in immunocompetent mice. We did not observe any reduction in MNoVCW3 infection with the depletion of CD300lf in epithelial cells, dendritic cells, neutrophils, or B cells. Interestingly, the antiviral effects of CD300lf disruption on LysM+ cells were not observed in Stat1-deficient mice, demonstrating that CD300lf and the innate immune system coordinately regulate MNoV tropism. This suggests CD300lf expression on tuft cells is required for MNoVCR6 infection, multiple cell types are sufficient for MNoVCW3 infection, and innate immunity regulates MNoVCW3 tropism.

RESULTS

CD300lf expression on epithelial cells is required for MNoVCR6 but not MNoVCW3 infection.

To elucidate the cellular tropism of MNoV, we generated a Cd300lf conditional knockout mouse via CRISPR/Cas9. We inserted LoxP sites flanking exon 3 of Cd300lf (CD300lfF/F) which encodes amino acids 129 to 158 in the ectodomain of CD300lf (Fig. 1A). We first crossed this mouse to an epithelial cell-specific Cre mouse (Vil1Cre) to generate mice with epithelial cells deficient in CD300lf. We validated the efficiency of CD300lf deletion in intestinal epithelial cells by flow cytometry (Fig. 1B). CD300lf+ events were significantly enriched in CD300lfF/F Vil1Cre− mice compared with CD300lfF/F Vil1Cre+ littermate control mice (Fig. 1B). We then challenged these mice with 106 plaque forming units (PFUs) of MNoVCR6 and MNoVCW3 perorally (PO); harvested mesenteric lymph node (MLN), spleen, ileum, and colon; and assessed viral genome copies via quantitative real-time PCR (qPCR). At 7 days postinfection (dpi), MNoVCR6 genome copies were significantly reduced in the MLN, ileum, and colon of CD300lfF/F Vil1Cre+ mice compared with Cre− controls (Fig. 1C, E, and F). MNoVCR6 was not detected in the spleens of either Cre− or Cre+ mice, consistent with prior studies in wild-type (WT) mice (29–31). MNoVCR6 was also undetectable in the feces of Vil1Cre+ mice, unlike Cre− controls (Fig. 1G). Interestingly, MNoVCR6 genomes were detected in the MLN, ileum, colon, and feces in a single CD300lfF/F Vil1Cre+ mouse (Fig. 1C to F); whether this finding reflects the emergence of a novel viral variant is unclear.

FIG 1.

FIG 1

Open in a new tab

MNoVCR6, but not MNoVCW3, infection requires CD300lf-expressing epithelial cells. (A) Schematic depicting the Cd300lf gene locus used to cross with specific cell lineage mouse strains. (B) CD300lf expression is ablated on Vil1Cre+ mice as observed via FACS. (C to F) CD300lfF/F Vil1Cre mice were perorally (PO) infected with 106 PFU of MNoVCR6 or MNoVCW3 and sacrificed at 7 days postinfection (dpi). Tissue titers for MLN (C), spleen (D), ileum (E), or colon (F) were analyzed via qPCR for MNoV genome copies and normalized to actin. Fecal pellets (G) collected at 7 dpi were analyzed via qPCR for MNoV genome copies. Mouse experiments were performed using littermate controls with at least two independent repeats analyzed via Mann-Whitney test. Statistical significance annotated as follows: ****, P < 0.0001; ***, P < 0.001; NS, not significant.

In contrast to MNoVCR6, the MNoVCW3 viral genome was detected at similar levels in the MLN and spleen of CD300lfF/F Vil1Cre+ and Vil1Cre− mice (Fig. 1C and D). MNoVCW3 viral genomes were also detected at similar levels in the ileum and colon of CD300lfF/F Vil1Cre− and Cre+ mice (Fig. 1E and F). MNoVCW3 did not robustly shed in the feces of either Cre− or Cre+ mice, which is consistent with prior findings (Fig. 1G) (25, 30). Together, these results suggest that productive infection of IECs is not required for MNoVCW3 infection. Furthermore, these findings suggest that CD300lf expression on epithelial cells is essential for fecal-oral transmission of MNoVCR6 but not MNoVCW3 (30).

CD300lf expression on tuft cells is required for MNoVCR6 and MNoVCW3-NS1-CR6 but not MNoVCW3.

Recently, we showed that MNoVCR6 infects rare IECs called tuft cells (30). To test whether tuft cells were essential for MNoV infection, we crossed CD300lfF/F mice to a double cortin-like kinase 1 (Dclk1) Cre—specific to tuft cells—to ablate CD300lf infection on tuft cells (46). We then infected CD300lfF/F Dclk1Cre− and Cre+ mice with 106 PFU PO of MNoVCR6, MNoVCW3, and chimeric MNoVCW3 expressing the NS1 of MNoVCR6 (MNoVCW3-NS1-CR6). Mice were then sacrificed at 7 dpi for tissue analysis. Consistent with the CD300lfF/F Vil1Cre mice, MNoVCR6 was able to infect CD300lfF/F Dclk1Cre− mice but failed to infect CD300lfF/F Dclk1Cre+ animals, confirming that tuft cells are the exclusive site for MNoVCR6 infection (Fig. 2A to D). Both CD300lfF/F Dclk1Cre− and Cre+ were susceptible to MNoVCW3, suggesting that CD300lf expression on tuft cells is not essential for MNoVCW3 infection (Fig. 2A to D). Interestingly, CD300lf disruption on tuft cells reduced MNoVCW3-NS1-CR6 viral loads in the intestinal tissue but did not have a significant effect on MNoVCW3-NS1-CR6 infection in systemic tissues (Fig. 2A to D). This result is consistent with the NS1 of MNoVCR6 enabling tuft cell tropism and the VP1 of MNoVCW3 promoting systemic infection (21, 25, 26, 32).

FIG 2.

FIG 2

Open in a new tab

CD300lf expression on tuft cells is required for MNoVCR6 but not MNoVCW3 or MNoVCW3-NS1-CR6 infection. CD300lfF/F DCLK1Cre− and Cre+ mice were infected with 106 PFU PO of MNoVCR6, MNoVCW3, and MNoVCW3-NS1-CR6 and sacrificed at 7 dpi to assess viral titers in the MLN (A), spleen (B), ileum (C), and colon (D) by qPCR. MNoV genome copies were then normalized to actin. At least two independent repeats were performed using littermate controls. Statistical analysis was performed using Mann-Whitney test. Significance is annotated as follows: ***, P < 0.001; **, P < 0.01; *, P < 0.05; NS, not significant.

CD300lf expression on B cells and dendritic cells is not required for MNoVCW3 infection.

We next evaluated the role of CD300lf-expressing hematopoietic cell types previously implicated in MNoVCW3 infection. B cells have been suggested as a target cell of both HuNoV and nonpersistent MNV both in vivo and in vitro (10, 43, 47). To test whether B cells were essential for MNoVCW3 infection, we generated a CD300lfF/F CD19 Cre line (48). CD19 is only transcribed in cells of the B cell lineage and is expressed throughout B cell development and differentiation. A total of 106 PFU of MNoVCW3 was administered PO to these mice, and tissue samples were harvested at 7 dpi for qPCR (Fig. 3). There was no significant difference in viral genomes between CD300lfF/F CD19 Cre+ and Cre− littermates, indicating that CD300lf on B cells is not essential for productive MNoVCW3 infection at 7 dpi (Fig. 3A to D).

FIG 3.

FIG 3

Open in a new tab

CD300lf expression on B cells (CD19 Cre+) and dendritic cells (CD11c Cre+) is not essential for MNoVCW3 infection in vivo. CD300lfF/F CD19Cre and CD300lfF/F CD11cCre mice were perorally infected with 106 PFU of MNoVCW3 and sacrificed at 7 dpi. MNoV titers in the MLN (A), spleen (B), ileum (C), and colon (D) of CD19 Cre mice were analyzed via qPCR for MNoV genome copies and normalized to actin. MNoV titers from the MLN (E), spleen (F), ileum (G), and colon (H) of CD11c Cre mice were analyzed by qPCR for viral genome copies and normalized to actin. Mouse experiments were performed using littermate controls with data pooled from four independent repeats. Data were analyzed via Mann-Whitney test. Statistical significance annotated as follows: NS, not significant.

As dendritic cells have also been implicated as a target cell of nonpersistent MNoVCW3 (43, 47, 49), we generated CD300lfF/F CD11cCre mice to test the role of dendritic cell infection in MNoVCW3 pathogenesis. CD11c, also known as integrin αX, is a widely used marker for dendritic cells (50). Similar to CD19-Cre, there was no significant difference in MNoVCW3 viral genome copies in the MLN, spleen, ileum, or colon (Fig. 3E to H), suggesting CD300lf expression on dendritic cells is not essential for productive MNoVCW3 infection in vivo.

CD300lf on LysM+ cells contribute to MNoVCW3 infection.

To ascertain whether myelomonocytic cells were essential for MNoVCW3 infection, we generated mice with myeloid lineage cells deficient in CD300lf (CD300lfF/F LysM Cre). LysM is a lysozyme that is widely produced by immune cells and serves as a marker for myelomonocytic cells (51, 52). CD300lf expression on WT bone marrow macrophages (BMDMs) is below the limit of detection by flow cytometry (27). Therefore, we validated the activity of the Cre recombinase by harvesting BMDMs from both CD300lfF/F LysM Cre− and Cre+ mice and infecting these cells with MNoVCW3 at a multiplicity of infection (MOI) of 0.05. We quantified viral replication by plaque assay at 1- and 24-h postinfection (hpi). BMDMs from CD300lfF/F LysM Cre+ mice have reduced infectious virus compared to BMDMs from LysM Cre− littermates at 24 hpi, consistent with efficient CD300lf disruption in macrophages (Fig. 4A). CD300lfF/F LysM Cre− and Cre+ mice were then challenged with 106 PFU MNoVCW3 PO, and tissues were harvested at 7 dpi for qPCR. There was a significant reduction in viral genomes in spleen and ileum in CD300lfF/F LysM Cre+ mice (Fig. 4B to E), suggesting that MNoVCW3 infection is in part supported by LysM+ cells in vivo. Interestingly, no significant difference in viral genomes was detected between CD300lfF/F LysMCre− and Cre+ littermates in the MLN and colon.

FIG 4.

FIG 4

Open in a new tab

LysM+ cells contribute to productive MNoVCW3 infection in a CD300lf-dependent manner. (A) Bone marrow-derived macrophages from CD300lfF/F LysMCre− and + mice were infected with MNoVCW3 at an MOI of 0.05 for 1 or 24 hpi. Infectious virus was quantified by plaque assay. (B to E) CD300lfF/F LysMCre mice were perorally infected with 106 PFU of MNoVCW3 and sacrificed at 7 dpi. Tissue titers for the MLN (B), spleen (C), ileum (D), colon (E) were analyzed via qPCR for MNoV genome copies and normalized to actin. Mouse experiments were performed using littermate controls with four independent repeats analyzed via Mann-Whitney test. Data in A were analyzed via unpaired Student’s t test. Statistical significance annotated as follows: *, P < 0.05; NS = not significant.

CD300lf expression on neutrophils is not essential for MNoVCW3 infection.

LysM is expressed on macrophages and neutrophils, which both express CD300lf (27, 53, 54). To determine whether neutrophils are infected by MNoVCW3, we crossed the CD300lfF/F to a myeloid-related protein 8 (Mrp8) Cre mouse to generate mice with CD300lf-deficient neutrophils (CD300lfF/F Mrp8 Cre+). Blood samples were collected from these mice, and CD300lf disruption efficiency was assessed by flow cytometry (Fig. 5A). Samples harvested from CD300lfF/F Mrp8 Cre+ mice showed a reduction in CD300lf on neutrophils compared with that of the CD300lfF/F Mrp8 Cre− mice (Fig. 5B and C), confirming activity of the Cre recombinase. These mice were then infected PO with 106 PFU of MNoVCW3, and tissues were collected at 7 dpi (Fig. 5D to G). Viral genome copies in the MLN, spleen, ileum, and colon were equivalent between CD300lfF/F Mrp8 Cre− and Cre+ mice (Fig. 5D to G). These results suggest that neutrophils are not required for MNoVCW3 infection in vivo.

FIG 5.

FIG 5

Open in a new tab

CD300lf depletion on neutrophils does not affect MNoVCW3 infection in vivo. (A) FACS plot and quantification of CD300lf expression levels on neutrophils harvested from CD300lfF/F MRP8 Cre mice. Each dot represents one mouse. (B) Mean fluorescent intensity (MFI) of CD300lf expression on neutrophils. (C) Detection of CD300lf+ neutrophils in CD300lfF/F MRP8 Cre− and CD300lfF/F MRP8 Cre+ mice. CD300lfF/F MRP8Cre mice were infected with 106 PFU PO of MNoVCW3 and sacrificed at 7 dpi. MNoVCW3 genome copies from MLN (D), spleen (E), ileum (F), and colon (G) were analyzed by qPCR and normalized to actin. Data in A to C were analyzed via Mann-Whitney test and are representative of at least two independent experiments. Mouse experiments were performed using littermate controls with two independent repeats analyzed via Mann-Whitney test. Statistical significance annotated as follows: **, P < 0.01; NS, not significant.

CD300lf on LysM+ but not B cells contribute to MNoVCW3 infection during early infection.

Next, we asked whether the cell tropism of MNoVCW3 varied across the course of acute infection. We evaluated the role of both CD19+ and LysM+ cells in MNoVCW3 infection at 24 hpi. CD300lfF/F CD19 Cre+ mice were challenged with 106 PFU PO MNoVCW3, and infectious virus was quantified in the MLN, spleen, ileum, and colon at 24 hpi by plaque assay (Fig. 6A to D). There were no significant differences in infectious virus between CD19 Cre− and Cre+ mice in any of the four tissues assessed, which is consistent with that observed at 7 dpi (Fig. 3). Notably, viral loads in the spleen are minimal at 24 hpi, which is consistent with the known kinetics of dissemination of MNoVCW3 to the spleen (25). Next, we infected CD300lfF/F LysM Cre− and Cre+ mice with 106 PFU PO MNoVCW3 and quantified infectious virus in the MLN, spleen, ileum, and colon at 24 hpi by plaque assay (Fig. 6D to H). LysM Cre+ mice exhibited reduced virus in the ileum at 24 hpi, consistent with that observed at 7 dpi (Fig. 4). Infectious virus was detected similar levels between LysM Cre− and LysM Cre+ mice in the MLN, spleen, and colon.

FIG 6.

FIG 6

Open in a new tab

CD300lf deletion from LysM+ but not B cells reduces intestinal MNoVCW3 at 24 hpi. (A) CD300lfF/F CD19 Cre mice were infected PO with 106 PFU MNoVCW3. Infectious virus was quantified by plaque assay at 24 hpi in the MLN (A), spleen (B), ileum (C), and colon (D). Data are shown as PFU per gram of tissue. CD300lfF/F LysMCre mice were infected PO with 106 PFU of MNoVCW3 and sacrificed at 24 hpi. Infectious virus was quantified by plaque assay in the MLN (E), spleen (F), ileum (G), and colon (H). Data are pooled from at least two independent experiments, each performed with littermate controls. Data were analyzed by Mann-Whitney test. Statistical significance annotated as follows: *, P < 0.05; NS, not significant.

MNoVCW3 infection of LysM+ cells is not essential for lethality in innate immune-deficient mice.

Mice deficient in type I interferon signaling, including Stat1−/−, mice are highly susceptible to MNoVCW3 infection resulting in lethality (23, 45). Given that LysM+ cells contribute to MNoVCW3 infection, we asked whether disruption of CD300lf on LysM+ cells would confer protection against MNoVCW3 on a Stat1−/− background. We challenged CD300lfF/F LysMCre− Stat1−/−or Cre+ Stat1−/− mice with 104 or 106 PFU MNoVCW3 and assessed survival. No significant differences in lethality were observed between these groups at either viral challenge dose (Fig. 7A and B). Next, we harvested tissues for viral RNA quantification at 3 dpi, prior to the onset of lethality. Interestingly, viral genomes were equivalent between the CD300lfF/F LysM Cre− Stat−/− and CD300lfF/F LysM Cre+ Stat−/− mice across tissues (Fig. 7C to F). These results indicate that in the absence of STAT1 signaling, MNoVCW3 infection is not dependent on the expression of CD300lf on LysM+ cells.

FIG 7.

FIG 7

Open in a new tab

Ablation of CD300lf expression on LysM+ cells does not provide protection from lethal MNoVCW3 infection in Stat1−/− mice. (A and B) CD300lfF/F LysMCre × Stat1−/−mice were infected with either 104 (A) or 106 (B) PFU of MNoVCW3 and monitored for lethality. (C to F) CD300lfF/F LysMCre mice were infected with 106 PFU PO of MNoVCW3 and sacrificed at 3 dpi. Tissue titers for the MLN (C), spleen (D), ileum (E), and colon (F) were analyzed via qPCR for MNoV genome copies and normalized to actin. Mouse experiments were performed using littermate controls with pooled data from at least two independent experiments and analyzed via Mann-Whitney test. Kaplan-Meier curves were generated for survival experiments. Statistical significance annotated as follows: NS, not significant.

DISCUSSION

We previously identified CD300lf as the primary physiologic receptor for MNoV (27, 30). CD300lf is necessary and sufficient for infection of diverse MNoV strains in vivo which we leveraged to interrogate MNoV cell tropism (27, 30). Here, we introduce a novel conditional knockout mouse model that serves as a valuable tool for studying tissue-specific CD300lf expression. We previously demonstrated that persistent MNoVCR6 infects a rare population of IECs called tuft cells. However, it was unknown whether tuft cell infection is essential in vivo, as other putative target cells may support MNoVCR6 replication. Here, we show that that MNoVCR6 infection can be ablated by conditionally deleting CD300lf on IECs broadly and tuft cells more specifically. This result demonstrates that CD300lf expression on tuft cells is essential for oral infection of MNoVCR6. In contrast to MNoVCR6, MNoVCW3 was unaffected by conditional ablation of CD300lf on both IECs and tuft cells. Using a chimeric virus (MNoVCW3-NS1-CR6), we demonstrated that the NS1 of CR6 permits tuft cell tropism, which requires tuft cell-specific CD300lf expression for intestinal tissue infection (21, 25, 30, 32). Interestingly, MNoVCW3-NS1-CR6 maintained the ability to infect systemic tissues, suggesting additional determinants of cell and tissue tropism for MNoV. These data ultimately support different tropism patterns across MNoV strains.

Previous reports identified dendritic cells, B cells, macrophages, monocytes, and neutrophils as targets of MNoVCW310 (42, 44, 47). We therefore sought to investigate the relative contribution of these cell types to MNoVCW3 infection by crossing CD300lfF/F mice to cell-specific Cre recombinases to generate mouse lines with CD300lf deleted on specific target cells. We demonstrated that CD300lf expression on LysM+ cells (i.e., macrophages and monocytes) significantly contributes to MNoVCW3 infection, whereas we observed no impact of CD300lf disruption on dendritic cells, B cells, and neutrophils. Our finding that LysM+ cells are important for MNoVCW3 infection is consistent with a recent report demonstrating that MNoVCW3 requires susceptible myeloid cells and depends on cell lysis to induce chemotaxis and inflammatory responses for myeloid cell recruitment to the site of infection (44). Our observation of only a partial reduction in MNoVCW3 viral load in mice in which CD300lf is ablated from LysM+ cells supports that a single target cell type may not be essential for MNoVCW3 infection, as it is for MNoVCR6. Instead, multiple CD300lf-expressing cell types likely contribute to infection and pathogenesis. Alternatively, it is possible that the lack of complete resistance to MNoVCW3 in any of the seven Cre lines tested may result from incomplete Cre-mediated recombination of MNoVCW3 target cells or infection of an as yet unidentified cell type.

MNoV tropism is governed both by virus-receptor and virus-immune system interactions. Specifically, disruption of type I IFN signaling through Ifnar or Stat1 deletion results in lethal MNoVCW3 infection and systemic spread of MNoVCR6 likely due to expanded cell tropism (23, 26). Consistent with this finding, we observed no reduction of MNoVCW3 viral load in Stat1−/− mice with conditional ablation of CD300lf on LysM+ cells, demonstrating that STAT1 partially restricts MNoVCW3 to myelomonocytic cells, and suggests an expanded tropism in mice lacking innate immunity. The mechanisms of this restriction represent an important area of future investigation.

In addition to its role in MNoV infection, CD300lf has been implicated in diverse disease states, including multiple sclerosis, inflammatory bowel disease, and depression (34, 36–38, 55). Elucidating the cell type-specific role of CD300lf in these disease contexts may provide critical insight into mechanisms of pathogenesis. The mouse model described here thus provides an important tool for studying CD300lf expression in various contexts.

HuNoV cell tropism remains incompletely understood. Diverse hematopoietic and epithelial cell types, including enteroendocrine cells, have been implicated in HNoV infection in vivo in humans, nonnative hosts, and in vitro (6, 8, 9, 11, 18). Elucidating the host and viral determinants governing HNoV tropism may reveal insight into HNoV transmission, pathogenesis, and persistence. MNoV provides a useful tool to reveal molecular interactions at the viral and host levels that may inform studies of HNoV. Here, we demonstrate that subtle genetic variation among MNoV strains can result in substantial differences in cell tropism. This suggests a similar phenomenon may be at play for HNoV.

MATERIALS AND METHODS

Mouse strains.

Cd300lf conditional knockout mice were generated by introducing LoxP sites flanking exon 3 of Cd300lf. The 5′ and 3′ LoxP sites were introduced by CRISPR/Cas9-mediated homology-directed repair. The following single guide RNAs (sgRNAs) were used: GTGTTGTGGCCTAACTTGCANGG and TCAAGTTCCCTGTCTCTTGGGGG to insert donor sequences GAATTCATAACTTCGTATAATGTATGCTATACGAAGTTAT at Chr11 (nucleotides 115,122,845 to 115,122,846) and GTGCTCATTAATGATGTTCTCTTTGAGAGTCCTTCTAGAG at Chr11 (nucleotides 115,125,303 to 115,125,304), respectively. Mice were genotyped by qPCR for the 5′ LoxP site at Transnetyx, Inc.

Ethics statement.

Animal use and care was approved in agreement with the Yale Animal Resource Center and Institution Animal Care and Use Committee (number 2018-20198) according to the standards set by the Animal Welfare Act.

Viral stocks.

Molecular clones of MNoVCW3 (Gen Bank accession EF014462.1) and MNoVCR6 (Gen Bank accession JQ237823) were used to generate a working stock of infectious virus. To create stocks, plasmids containing infectious molecular clones were transfected into 293T cells (ATCC) to generate a P0 stock as described previously (26, 27). Then, the P0 stock was used to infect susceptible BV2 cells (gifted from H.W. Virgin) for generation of the P1 stock. Generation of the P2 stock was performed by inoculating BV2 cells with the P1 stock for 48 hours followed by freezing/thawing the infected cultures at –80°C. Upon thawing the infected BV2 cultures, cellular debris was pelleted at 1,200 × g for 5 minutes and then filtered through a 0.22-μm filter. Viral stocks were aliquoted and stored at –80°C. Virus titer was determined by plaque assay at least three independent times.

Cell culture.

BV2 cells were maintained in Dulbecco’s modified Eagle media (DMEM; Gibco, Gaithersburg, MD) was supplemented with 10% fetal bovine serum (FBS; VWR, Radnor, PA), 1% HEPES (Gibco), and 1% penicillin/streptomycin (pen/strep; Gibco). In order to differentiate bone marrow progenitors into BMDMs, 106 cells were plated into a 10-cm nontissue culture plate with BMDM media (DMEM, 10% FBS, 10% CMG14 conditioned media, 2 mM l-glutamine, 1% pen/strep, and 1% sodium pyruvate), incubated at 37°C for 7 days at 5% CO2 (56). Differentiation of progenitors into BMDMs was confirmed by assessing F4/80 expression by flow cytometry. More than 95% of cells were F4/80+.

In vitro MNoV infections.

BMDMs from Cd300lf−/− and Cd300lff/f LysMCre mice were generated as described above. After 7 days in differentiation media, 50,000 cells were plated per well of a 96-well plate and infected with MNoVCW3 at an MOI of 0.05. Infected plates were frozen at –80°C at 1 and 24 hpi for plaque assay.

In vivo MNoV infections.

Trio breeding (one male and two females) was used to generate mice for experiments. Littermate controls were used for all experiments. Mouse infections were performed by inoculating mice with 25 μl of 106 PFU MNoVCW3 or MNoVCR6 diluted in DMEM supplemented with 10% FBS. At 1 or 7 dpi, mice were sacrificed by isoflurane overdose. Freshly collected fecal pellets and approximately 20 mg of MLN, spleen, small intestine, and proximal colon were collected and flash frozen for qPCR analysis. For plaque assay, MLN, spleen, 10 cm of central small intestine (ileum), and the entire colon were collected and weighed prior to flash freezing in 1 ml of DMEM supplemented with 10% FBS, 1% pen/strep, and 1% HEPES. Tissue and fecal samples as well as tissues were stored at –80°C until processing. Immediately before quantification of virus by plaque assay, tissues were thawed and homogenized with 1.0-mm silica beads.

Viral quantification by plaque assay.

Each well of a 6-well plate was seeded with 1.8 × 106 BV2 cells in DMEM with 10% FBS, 1% pen/strep, and 1% HEPES and then incubated overnight at 37°C and 5% CO2. After 24 h, the BV2 cells were checked for confluence, and BMDM-infected plates were thawed, followed by 6 serial dilutions. The medium was removed from the BV2 cells, and one diluted inoculum was added to one well of the 6-well plate and rocked gently for 1 hour. After rocking, the inoculum was removed, and 2 ml overlay medium was applied (MEM with 10% FBS containing 1% methylcellulose, 1% HEPES, 1% GlutaMAX [Gibco], and 1% pen/strep) followed by a 48-h incubation. Following incubation, the overlay medium was aspirated off and each well was stained with 1 ml crystal violet (20% ethanol and 0.2% [wt/vol] crystal violet) on a plate rocker for 30 min as previously described (27).

Quantitative PCR.

Viral genome copies in tissues and fecal pellets were previously described (27, 30). Briefly, viral RNA extraction from tissues was performed using TRIzol (Life Technologies, Carlsbad, CA) and purified with a Direct-zol RNA miniprep plus kit according to the manufacturer’s protocol (Zymo Research, Irvine, CA). Following purification, a two-step cDNA synthesis was performed using 5 μl of RNA and random hexamers, and ImProm-II reverse transcriptase (Promega) was performed. qPCR analysis on standard curves and samples was performed in duplicate using MNoV-specific oligonucleotides, as follows: forward primer, 5′-CACGCCACCGATCTGTTCTG-3′; reverse primer, 5′-GCGCTGCGCCATCACTC-3′; and probe, 5′-6-carboxyfluorescein [FAM]-CGCTTTGGAACAATG-MGBNFQ-3′. The limit of detection for qPCR analysis was 10 MNoV genome copies/1 μl. MNoV genome copies were normalized to the expression of housekeeping gene β-actin detected using the following: forward primer, 5′-GCTCCTTCGTTGCCGTCCA-3′; reverse primer, 5′-TTGCACATGCCGGAGCCGTT-3′; and probe, 5′-6-JOE (6-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein NHS ester)-CACCAGTTC/ZEN/GCCATGGATGACGA-IABKFQ (Iowa Black FQ quencher)-3′. The limit of detection for β-actin was 100 copies/1 μl. Undetectable genome copies were set at 0.0001 copies relative to actin.

Tissue processing and low cytometry.

Mice were euthanized and sacrificed in compliance with the IACUC protocol. Colonic tissue was harvested, opened longitudinally, and washed three times in ice cold 1× Dulbecco’s PBS (DPBS). To dissociate cells, colonic tissue was finely chopped with a razor blade and suspended in stripping buffer (1× DPBS, 5% FBS, 0.1% pen/strep, 5 mM EDTA, and 0.5 M dithiothreitol [DTT]). Cells were incubated at 37°C for 15 min and gently agitated at 200 rpm. Dissociated cells were filtered sequentially through 100-μm filters and then through 40-μm filters. Cellular filtrate was pelleted by centrifugation (1,500 rpm for 5 min at 4°C) and washed once with fluorescence-activated cell sorter (FACS) buffer (1× DPBS, 2 mM EDTA, and 2.5% FBS). Cells were then stained for viability with Zombie Aqua (BioLegend) diluted 1:500 in 1× DPBS on ice for 10 min. Samples were centrifuged at 1,200 × g for 2 min, and the supernatant was removed. CD300lf primary antibody 3F6 (Armenian hamster; Genentech) was added at a 1:800 dilution for 20 min at room temperature (38). Cells were then washed with FACS buffer. To identify epithelial cells expressing CD300lf, cells were stained with the following antibodies diluted in FACS buffer: Alexa Fluor 488 goat anti-Armenian hamster (1:500; 127545160; lot 128099; in 50% glycerol; Jackson ImmunoResearch), EpCAM (1:200; BioLegend), SiglecF (1:200; BioLegend), CD24 (1:200; BioLegend), and CD45 (1:200; BioLegend) on ice for 20 min. Cells were washed with FACS buffer, resuspended in 4% paraformaldehyde, and filtered. Samples were analyzed on a CytoFLEX S instrument (Beckman Coulter).

Statistical analysis.

Statistical analysis was performed in Prism GraphPad version 8 (San Diego, CA). Error bars show the standard error of the mean unless indicated otherwise. For all nonnormally distributed data, Mann-Whitney tests were performed, whereas normally distributed data were analyzed with an unpaired Student’s t test. Kaplan-Meier curves were used to analyze survival data. P values of <0.05 were considered significant (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

Data availability.

All relevant data are contained within the manuscript. CD300lfF/F mice are available upon request.

ACKNOWLEDGMENTS

We acknowledge Herbert “Skip” Virgin, Michael White, Shondra Pruett-Miller, and Darren Kreamalmayer for their generous resources, guidance, and technical support. We thank Timothy Wang for sharing critical reagents and the Washington University Genome Engineering and iPSC Center for genetically engineering mice.

This work was supported by the Burroughs Wellcome Fund (C.B.W.); NSF DGE1752134 (M.S.S.); and NIH grants K08 A1128043 (C.B.W.), R01 AI148467 (C.B.W.), ROO Dk116666 (R.C.O.), R01 AI127552 (M.T.B.), and R01 AI139314 (M.T.B.).

V.R.G., conceptualization, formal analysis, investigation, writing—original draft, and visualization; M.M.A., validation, formal analysis, investigation, writing—original draft, and visualization; C.O.S., formal analysis and investigation; R.B.F., investigation; M.S.S., formal analysis and investigation; J.W., investigation; L.L.H., investigation; M.T.B., conceptualization and supervision; T.J.N., conceptualization and supervision; S.L., conceptualization and supervision; R.C.O., conceptualization, methodology, supervision, and resources; C.B.W., conceptualization, methodology, supervision, investigation, resources, funding acquisition, and writing—original draft. All authors reviewed and edited the manuscript.

REFERENCES

  • 1.Patel MM, Widdowson MA, Glass RI, Akazawa K, Vinjé J, Parashar UD. 2008. Systematic literature review of role of noroviruses in sporadic gastroenteritis. Emerg Infect Dis 14:1224–1231. doi: 10.3201/eid1408.071114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ahmed SM, Hall AJ, Robinson AE, Verhoef L, Premkumar P, Parashar UD, Koopmans M, Lopman BA. 2014. Global prevalence of norovirus in cases of gastroenteritis: a systematic review and meta-analysis. Lancet Infect Dis 14:725–730. doi: 10.1016/S1473-3099(14)70767-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kroneman A, Vega E, Vennema H, Vinjé J, White PA, Hansman G, Green K, Martella V, Katayama K, Koopmans M. 2013. Proposal for a unified norovirus nomenclature and genotyping. Arch Virol 158:2059–2068. doi: 10.1007/s00705-013-1708-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Karst SM, Wobus CE, Goodfellow IG, Green KY, Virgin HW. 2014. Advances in norovirus biology. Cell Host Microbe 15:668–680. doi: 10.1016/j.chom.2014.05.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Karst SM, Tibbetts SA. 2016. Recent advances in understanding norovirus pathogenesis. J Med Virol 88:1837–1843. doi: 10.1002/jmv.24559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Graziano VR, Wei J, Wilen CB. 2019. Norovirus attachment and entry. Viruses 11:495. doi: 10.3390/v11060495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Katayama K, Murakami K, Sharp TM, Guix S, Oka T, Takai-Todaka R, Nakanishi A, Crawford SE, Atmar RL, Estes MK. 2014. Plasmid-based human norovirus reverse genetics system produces reporter-tagged progeny virus containing infectious genomic RNA. Proc Natl Acad Sci U S A 111:E4043–E4052. doi: 10.1073/pnas.1415096111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ettayebi K, Crawford SE, Murakami K, Broughman JR, Karandikar U, Tenge VR, Neill FH, Blutt SE, Zeng XL, Qu L, Kou B, Opekun AR, Burrin D, Graham DY, Ramani S, Atmar RL, Estes MK. 2016. Replication of human noroviruses in stem cell-derived human enteroids. Science 353:1387–1393. doi: 10.1126/science.aaf5211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Green KY, Kaufman SS, Nagata BM, Chaimongkol N, Kim DY, Levenson EA, Tin CM, Yardley AB, Johnson JA, Barletta ABF, Khan KM, Yazigi NA, Subramanian S, Moturi SR, Fishbein TM, Moore IN, Sosnovtsev SV. 2020. Human norovirus targets enteroendocrine epithelial cells in the small intestine. Nat Commun 11:2759. doi: 10.1038/s41467-020-16491-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Jones MK, Watanabe M, Zhu S, Graves CL, Keyes LR, Grau KR, Gonzalez-Hernandez MB, Iovine NM, Wobus CE, Vinjé J, Tibbetts SA, Wallet SM, Karst SM. 2014. Enteric bacteria promote human and mouse norovirus infection of B cells. Science 346:755–759. doi: 10.1126/science.1257147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Jones MK, Grau KR, Costantini V, Kolawole AO, de Graaf M, Freiden P, Graves CL, Koopmans M, Wallet SM, Tibbetts SA, Schultz-Cherry S, Wobus CE, Vinjé J, Karst SM. 2015. Human norovirus culture in B cells. Nat Protoc 10:1939–1947. doi: 10.1038/nprot.2015.121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Davis A, Cortez V, Grodzki M, Dallas R, Ferrolino J, Freiden P, Maron G, Hakim H, Hayden RT, Tang L, Huys A, Kolawole AO, Wobus CE, Jones MK, Karst SM, Schultz-Cherry S. 2020. Infectious norovirus is chronically shed by immunocompromised pediatric hosts. Viruses 12:619. doi: 10.3390/v12060619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bok K, Parra GI, Mitra T, Abente E, Shaver CK, Boon D, Engle R, Yu C, Kapikian AZ, Sosnovtsev SV, Purcell RH, Green KY. 2011. Chimpanzees as an animal model for human norovirus infection and vaccine development. Proc Natl Acad Sci U S A 108:325–330. doi: 10.1073/pnas.1014577107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Seo DJ, Jung D, Jung S, Ha SK, Ha SD, Choi IS, Myoung J, Choi C. 2018. Experimental miniature piglet model for the infection of human norovirus GII. J Med Virol 90:655–662. doi: 10.1002/jmv.24991. [DOI] [PubMed] [Google Scholar]
  • 15.Taube S, Kolawole AO, Höhne M, Wilkinson JE, Handley SA, Perry JW, Thackray LB, Akkina R, Wobus CE. 2013. A mouse model for human norovirus. mBio 4:e00450-13. doi: 10.1128/mBio.00450-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Cheetham S, Souza M, Meulia T, Grimes S, Han MG, Saif LJ. 2006. Pathogenesis of a genogroup II human norovirus in gnotobiotic pigs. J Virol 80:10372–10381. doi: 10.1128/JVI.00809-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Jung K, Wang Q, Kim Y, Scheuer K, Zhang Z, Shen Q, Chang KO, Saif LJ. 2012. The effects of simvastatin or interferon-α on infectivity of human norovirus using a gnotobiotic pig model for the study of antivirals. PLoS One 7:e41619. doi: 10.1371/journal.pone.0041619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Karandikar UC, Crawford SE, Ajami NJ, Murakami K, Kou B, Ettayebi K, Papanicolaou GA, Jongwutiwes U, Perales MA, Shia J, Mercer D, Finegold MJ, Vinjé J, Atmar RL, Estes MK. 2016. Detection of human norovirus in intestinal biopsies from immunocompromised transplant patients. J Gen Virol 97:2291–2300. doi: 10.1099/jgv.0.000545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Murakami K, Tenge VR, Karandikar UC, Lin SC, Ramani S, Ettayebi K, Crawford SE, Zeng XL, Neill FH, Ayyar BV, Katayama K, Graham DY, Bieberich E, Atmar RL, Estes MK. 2020. Bile acids and ceramide overcome the entry restriction for GII.3 human norovirus replication in human intestinal enteroids. Proc Natl Acad Sci U S A 117:1700–1710. doi: 10.1073/pnas.1910138117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Nelson CA, Wilen CB, Dai YN, Orchard RC, Kim AS, Stegeman RA, Hsieh LL, Smith TJ, Virgin HW, Fremont DH. 2018. Structural basis for murine norovirus engagement of bile acids and the CD300lf receptor. Proc Natl Acad Sci U S A 115:E9201–E9210. doi: 10.1073/pnas.1805797115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lee S, Wilen CB, Orvedahl A, McCune BT, Kim KW, Orchard RC, Peterson ST, Nice TJ, Baldridge MT, Virgin HW. 2017. Norovirus cell tropism is determined by combinatorial action of a viral non-structural protein and host cytokine. Cell Host Microbe 22:449–459.e4. doi: 10.1016/j.chom.2017.08.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Baldridge MT, Turula H, Wobus CE. 2016. Norovirus regulation by host and microbe. Trends Mol Med 22:1047–1059. doi: 10.1016/j.molmed.2016.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Karst SM, Wobus CE, Lay M, Davidson J, Virgin HW, IV.. 2003. STAT1-dependent innate immunity to a Norwalk-like virus. Science 299:1575–1578. doi: 10.1126/science.1077905. [DOI] [PubMed] [Google Scholar]
  • 24.Wobus CE, Thackray LB, Virgin HW, IV.. 2006. Murine norovirus: a model system to study norovirus biology and pathogenesis. J Virol 80:5104–5112. doi: 10.1128/JVI.02346-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Nice TJ, Strong DW, McCune BT, Pohl CS, Virgin HW. 2013. A single-amino-acid change in murine norovirus NS1/2 is sufficient for colonic tropism and persistence. J Virol 87:327–334. doi: 10.1128/JVI.01864-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Strong DW, Thackray LB, Smith TJ, Virgin HW. 2012. Protruding domain of capsid protein is necessary and sufficient to determine murine norovirus replication and pathogenesis in vivo. J Virol 86:2950–2958. doi: 10.1128/JVI.07038-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Orchard RC, Wilen CB, Doench JG, Baldridge MT, McCune BT, Lee YC, Lee S, Pruett-Miller SM, Nelson CA, Fremont DH, Virgin HW. 2016. Discovery of a proteinaceous cellular receptor for a norovirus. Science 353:933–936. doi: 10.1126/science.aaf1220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Roth AN, Helm EW, Mirabelli C, Kirsche E, Smith JC, Eurell LB, Ghosh S, Altan-Bonnet N, Wobus CE, Karst SM. 2020. Norovirus infection causes acute self-resolving diarrhea in wild-type neonatal mice. Nat Commun 11:2968. doi: 10.1038/s41467-020-16798-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Graziano VR, Walker FC, Kennedy EA, Wei J, Ettayebi K, Strine MS, Filler RB, Hassan E, Hsieh LL, Kim AS, Kolawole AO, Wobus CE, Lindesmith LC, Baric RS, Estes MK, Orchard RC, Baldridge MT, Wilen CB. 2020. CD300lf is the primary physiologic receptor of murine norovirus but not human norovirus. PLoS Pathog 16:e1008242. doi: 10.1371/journal.ppat.1008242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wilen CB, Lee S, Hsieh LL, Orchard RC, Desai C, Hykes BL, McAllaster MR, Balce DR, Feehley T, Brestoff JR, Hickey CA, Yokoyama CC, Wang YT, MacDuff DA, Kreamalmayer D, Howitt MR, Neil JA, Cadwell K, Allen PM, Handley SA, van Lookeren Campagne M, Baldridge MT, Virgin HW. 2018. Tropism for tuft cells determines immune promotion of norovirus pathogenesis. Science 360:204–208. doi: 10.1126/science.aar3799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Robinson BA, Van Winkle JA, McCune BT, Peters AM, Nice TJ. 2019. Caspase-mediated cleavage of murine norovirus NS1/2 potentiates apoptosis and is required for persistent infection of intestinal epithelial cells. PLoS Pathog 15:e1007940. doi: 10.1371/journal.ppat.1007940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lee S, Liu H, Wilen CB, Sychev ZE, Desai C, Hykes BL, Orchard RC, McCune BT, Kim KW, Nice TJ, Handley SA, Baldridge MT, Amarasinghe GK, Virgin HW. 2019. A secreted viral nonstructural protein determines intestinal norovirus pathogenesis. Cell Host Microbe 25:845–857.e5. doi: 10.1016/j.chom.2019.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Borrego F. 2013. The CD300 molecules: an emerging family of regulators of the immune system. Blood 121:1951–1960. doi: 10.1182/blood-2012-09-435057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lago N, Kaufmann FN, Negro-Demontel ML, Alí-Ruiz D, Ghisleni G, Rego N, Arcas-García A, Vitureira N, Jansen K, Souza LM, Silva RA, Lara DR, Pannunzio B, Abin-Carriquiry JA, Amo-Aparicio J, Martin-Otal C, Naya H, McGavern DB, Sayós J, López-Vales R, Kaster MP, Peluffo H. 2020. CD300f immunoreceptor is associated with major depressive disorder and decreased microglial metabolic fitness. Proc Natl Acad Sci U S A 117:6651–6662. doi: 10.1073/pnas.1911816117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Abadir E, Gasiorowski RE, Lai K, Kupresanin F, Romano A, Silveira PA, Lo TH, Fromm PD, Kennerson ML, Iland HJ, Ho PJ, Hogarth PM, Bradstock K, Hart DNJ, Clark GJ. 2019. CD300f epitopes are specific targets for acute myeloid leukemia with monocytic differentiation. Mol Oncol 13:2107–2120. doi: 10.1002/1878-0261.12549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Moshkovits I, Reichman H, Karo-Atar D, Rozenberg P, Zigmond E, Haberman Y, Ben Baruch-Morgenstern N, Lampinen M, Carlson M, Itan M, Denson LA, Varol C, Munitz A. 2017. A key requirement for CD300f in innate immune responses of eosinophils in colitis. Mucosal Immunol 10:172–183. doi: 10.1038/mi.2016.37. [DOI] [PubMed] [Google Scholar]
  • 37.Martínez-Barriocanal Á, Arcas-García A, Magallon-Lorenz M, Ejarque-Ortíz A, Negro-Demontel ML, Comas-Casellas E, Schwartz S, Malhotra S, Montalban X, Peluffo H, Martín M, Comabella M, Sayós J. 2017. Effect of specific mutations in Cd300 complexes formation; potential implication of Cd300f in multiple sclerosis. Sci Rep 7:13544. doi: 10.1038/s41598-017-12881-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Xi H, Katschke KJ, Helmy KY, Wark PA, Kljavin N, Clark H, Eastham-Anderson J, Shek T, Roose-Girma M, Ghilardi N, van Lookeren Campagne M. 2010. Negative regulation of autoimmune demyelination by the inhibitory receptor CLM-1. J Exp Med 207:7–16. doi: 10.1084/jem.20091508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.von Moltke J, Ji M, Liang HE, Locksley RM. 2016. Tuft-cell-derived IL-25 regulates an intestinal ILC2-epithelial response circuit. Nature 529:221–225. doi: 10.1038/nature16161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Howitt MR, Lavoie S, Michaud M, Blum AM, Tran SV, Weinstock JV, Gallini CA, Redding K, Margolskee RF, Osborne LC, Artis D, Garrett WS. 2016. Tuft cells, taste-chemosensory cells, orchestrate parasite type 2 immunity in the gut. Science 351:1329–1333. doi: 10.1126/science.aaf1648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Gerbe F, Sidot E, Smyth DJ, Ohmoto M, Matsumoto I, Dardalhon V, Cesses P, Garnier L, Pouzolles M, Brulin B, Bruschi M, Harcus Y, Zimmermann VS, Taylor N, Maizels RM, Jay P. 2016. Intestinal epithelial tuft cells initiate type 2 mucosal immunity to helminth parasites. Nature 529:226–230. doi: 10.1038/nature16527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Grau KR, Zhu S, Peterson ST, Helm EW, Philip D, Phillips M, Hernandez A, Turula H, Frasse P, Graziano VR, Wilen CB, Wobus CE, Baldridge MT, Karst SM. 2020. The intestinal regionalization of acute norovirus infection is regulated by the microbiota via bile acid-mediated priming of type III interferon. Nat Microbiol 5:84–92. doi: 10.1038/s41564-019-0602-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wobus CE, Karst SM, Thackray LB, Chang KO, Sosnovtsev SV, Belliot G, Krug A, Mackenzie JM, Green KY, Virgin HW, IV.. 2004. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. PLoS Biol 2:e432. doi: 10.1371/journal.pbio.0020432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Van Winkle JA, Robinson BA, Peters AM, Li L, Nouboussi RV, Mack M, Nice TJ. 2018. Persistence of systemic murine norovirus is maintained by inflammatory recruitment of susceptible myeloid cells. Cell Host Microbe 24:665–676.e4. doi: 10.1016/j.chom.2018.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Mumphrey SM, Changotra H, Moore TN, Heimann-Nichols ER, Wobus CE, Reilly MJ, Moghadamfalahi M, Shukla D, Karst SM. 2007. Murine norovirus 1 infection is associated with histopathological changes in immunocompetent hosts, but clinical disease is prevented by STAT1-dependent interferon responses. J Virol 81:3251–3263. doi: 10.1128/JVI.02096-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Westphalen CB, Asfaha S, Hayakawa Y, Takemoto Y, Lukin DJ, Nuber AH, Brandtner A, Setlik W, Remotti H, Muley A, Chen X, May R, Houchen CW, Fox JG, Gershon MD, Quante M, Wang TC. 2014. Long-lived intestinal tuft cells serve as colon cancer-initiating cells. J Clin Invest 124:1283–1295. doi: 10.1172/JCI73434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Grau KR, Roth AN, Zhu S, Hernandez A, Colliou N, DiVita BB, Philip DT, Riffe C, Giasson B, Wallet SM, Mohamadzadeh M, Karst SM. 2017. The major targets of acute norovirus infection are immune cells in the gut-associated lymphoid tissue. Nat Microbiol 2:1586–1591. doi: 10.1038/s41564-017-0057-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Rickert RC, Roes J, Rajewsky K. 1997. B lymphocyte-specific, Cre-mediated mutagenesis in mice. Nucleic Acids Res 25:1317–1318. doi: 10.1093/nar/25.6.1317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Perry JW, Taube S, Wobus CE. 2009. Murine norovirus-1 entry into permissive macrophages and dendritic cells is pH-independent. Virus Res 143:125–129. doi: 10.1016/j.virusres.2009.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wu J, Wu H, An J, Ballantyne CM, Cyster JG. 2018. Critical role of integrin CD11c in splenic dendritic cell capture of missing-self CD47 cells to induce adaptive immunity. Proc Natl Acad Sci U S A 115:6786–6791. doi: 10.1073/pnas.1805542115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Clausen BE, Burkhardt C, Reith W, Renkawitz R, Förster I. 1999. Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res 8:265–277. doi: 10.1023/A:1008942828960. [DOI] [PubMed] [Google Scholar]
  • 52.Shi J, Hua L, Harmer D, Li P, Ren G. 2018. Cre driver mice targeting macrophages. Methods Mol Biol 1784:263–275. doi: 10.1007/978-1-4939-7837-3_24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Nakano T, Tahara-Hanaoka S, Nakahashi C, Can I, Totsuka N, Honda S, Shibuya K, Shibuya A. 2008. Activation of neutrophils by a novel triggering immunoglobulin-like receptor MAIR-IV. Mol Immunol 45:289–294. doi: 10.1016/j.molimm.2007.04.011. [DOI] [PubMed] [Google Scholar]
  • 54.Can I, Tahara-Hanaoka S, Hitomi K, Nakano T, Nakahashi-Oda C, Kurita N, Honda S, Shibuya K, Shibuya A. 2008. Caspase-independent cell death by CD300LF (MAIR-V), an inhibitory immunoglobulin-like receptor on myeloid cells. J Immunol 180:207–213. doi: 10.4049/jimmunol.180.1.207. [DOI] [PubMed] [Google Scholar]
  • 55.Matsukawa T, Izawa K, Isobe M, Takahashi M, Maehara A, Yamanishi Y, Kaitani A, Okumura K, Teshima T, Kitamura T, Kitaura J. 2016. Ceramide-CD300f binding suppresses experimental colitis by inhibiting ATP-mediated mast cell activation. Gut 65:777–787. doi: 10.1136/gutjnl-2014-308900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Takeshita S, Kaji K, Kudo A. 2000. Identification and characterization of the new osteoclast progenitor with macrophage phenotypes being able to differentiate into mature osteoclasts. J Bone Miner Res 15:1477–1488. doi: 10.1359/jbmr.2000.15.8.1477. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are contained within the manuscript. CD300lfF/F mice are available upon request.

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES