Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Mar 3.
Published in final edited form as: Methods Mol Biol. 2017;1632:91–105. doi: 10.1007/978-1-4939-7138-1_6

Cotranscriptional Production of Chemically Modified RNA Nanoparticles

Maria L Kireeva 1, Kirill A Afonin 2,3,4, Bruce A Shapiro 2,5, Mikhail Kashlev 2
PMCID: PMC7927353  NIHMSID: NIHMS1664749  PMID: 28730434

Abstract

RNA nanoparticles consisting of multiple RNA strands of different sequences forming various three-dimensional structures emerge as promising carriers of siRNAs, RNA aptamers, and ribozymes. In vitro transcription of a mixture of dsDNA templates encoding all the subunits of the RNA nanoparticle may result in cotranscriptional self-assembly of the nanoparticle. Based on our experience with production of RNA nanorings, RNA nanocubes, and RNA three-way junctions, we propose a strategy for optimization of the cotranscriptional production of chemically modified ribonuclease-resistant RNA nanoparticles.

Keywords: In vitro transcription, T7 RNA polymerase, T7 R&DNA polymerase, 2′-F-dUTP, 2′-F-dCTP, RNA nanorings, RNA nanocubes, Cotranscriptional assembly

1. Introduction

RNA-based therapeutics and biotechnology tools are becoming increasingly popular. The most widely used applications, including siRNA (reviewed in [1, 2]) and gene targeting by CRISPR-Cas9 [3], typically rely on chemically synthesized short RNA oligonucleotides [4]. Other applications, such as transfection of mRNA [5, 6], and technologies based on assembly of the RNA nanoparticles [7–9], require the synthesis of a relatively large (nanomolar and higher) amounts of long RNA molecules. The production of RNAs longer than about 100 nt is usually achieved by in vitro transcription on synthetic or PCR-amplified DNA templates. This chapter describes experimental approaches for optimizing conditions for linear DNA templates transcription by bacteriophage T7 RNA polymerase (T7 RNAP) in order to achieve self-assembly of RNA nanoparticles functionalized with siRNA and RNA aptamers [10]. Cotranscriptional self-assembly has been performed for RNA nanorings (single and double rings, with six and 12 different RNA core structural strands respectively), nanocubes containing six and ten different RNA core structural strands [11–14] (see Fig. 1), and three-way junctions assembled from three RNA strands. Other examples of self-assembling RNAs were also shown to form cotranscriptionally [15]. Cotranscriptionally folded RNA nanorings were successfully used in delivering siRNA to human breast cancer cells [11, 12]. Recently, cotranscriptional assemblies of larger RNA structures have been also demonstrated [16].

Fig. 1.

Fig. 1

Illustration of our previously cotranscriptionally assembled unmodified RNA nanoparticles (ring, cube, and double ring) with and without siRNA arms and their corresponding assembly gels (see [11, 13])

While RNA nanoparticles efficiently self-assemble under the conditions in which transcription is performed [10, 11], the molar yield of the mature nanoparticle cannot exceed the yield of the RNA strand from the least efficiently transcribed template. Excessive transcription of one or a few DNA templates in the mix may lead to the appearance of subassembled particles and thus interfere with the efficient purification of the mature nanoparticle. Therefore, optimization of the transcription conditions to increase and balance the amounts of transcripts produced from each individual template represents one main methodological challenge for the cotranscriptional production of RNA nanoparticles. Some templates are not efficiently transcribed under a broad variety of conditions tested. For these cases we used the findings by Uhlenbeck and coauthors that the efficiency of transcription initiation and promoter escape by bacteriophage T7 RNAP does not only strictly require two GMP residues encoded at the 5′ end of the transcript [17], but also strongly depends on the nature of the next four to five residues [18]. Addition of the polypurine stretch at the 5′ end of the transcript encoded by the poorly transcribed templates significantly improved the RNA yield and enabled the production of equal amounts of RNA nanocube subunits and RNA three-way junctions, as described below in Subheadings 3.2 and 3.4.

Synthesis of chemically modified nanoparticles, which are resistant to nucleases [11], poses an additional technical difficulty. NTPs carrying chemical modifications, such as fluorine modification of the sugar ring (2′-F-dNTPs) structurally resemble dNTPs and, therefore, are less efficiently incorporated by T7 RNAP during initiation and elongation [19]. Substitution of Mg2+ with Mn2+ was first reported to enable dNTP incorporation by T7 RNAP, albeit with a low efficiency, by Wyatt and Walker [20]. The combination of 2.5 mM MgCl2 and 2.5 mM MnCl2 supported the full-length transcript synthesis when ATP or CTP were replaced by dATP or dCTP and enabled the incorporation of 2′-O-methyl ATP and 2′-O-methyl CTP [21]. The same concentrations of divalent cations were used to synthesize transcripts modified with 8-N3AMP [22]. In our hands, the addition of 0.5 mM MnCl2 along with 5 mM MgCl2 to the transcription reaction sufficiently relaxes the substrate specificity of T7 RNAP to promote efficient incorporation of 2′-F-dUTP and 2′-F-dCTP and the production of fluorinated ribonuclease-resistant nanorings and nanocubes [11, 23]. Analyses of the MnCl2 concentration effect on the yield of the regular and chemically modified RNAs is described in [11]. A similar approach to determine the optimal concentration of MgCl2 in the presence of MnCl2 is outlined below (in Subheading 3.2). Production of chemically modified RNAs has been reported with the error-prone Y639 mutant of T7 RNAP (T7 R&DNAP™, Epicentre), which poorly discriminates between rNTP and dNTP substrates [19]. The production of chemically modified nanoring subunits by wild type and mutant T7 RNAP variants is presented in Subheading 3.1.

Currently, it is challenging to provide a generic protocol for RNA expression and nanoparticle assembly that will work without substantial modifications for any newly designed scaffold. In our experience, each template set requires stepwise optimization of the reaction conditions performed as outlined in Fig. 2. The conditions developed for the nanoring cotranscriptional assembly [11] represent a good starting point for the reaction buffer composition and concentrations of T7 RNAP and template DNA. In addition to the parameters outlined in Fig. 2, the initial optimization of the reaction conditions might include substituting KCl with polyamines or potassium glutamate and Tris–HCl with HEPES, as recommended for in vitro transcription by E. coli RNAP [24]. Four protocols outlined below provide a framework for testing a variety of the reaction parameters and choosing the conditions resulting in the best yield of the nanoparticle of your choice. Subsequent up-scaling of the reaction is straightforward and involves the proportional increase of all the reagent volumes [11].

Fig. 2.

Fig. 2

Workflow for establishing reaction conditions supporting the cotranscriptional assembly of an RNA nanoparticle. The green arrows indicate the satisfactory outcomes of the optimization steps. The red arrows point toward the steps to be taken to improve the RNA yield. The numbers in bold indicate the Subheadings from Methods

2. Materials

2.1. Components for the In Vitro Transcription and RNA Nanoparticle Purification

  1. 10× transcription buffer (TB): 200 mM Tris–HCl, pH 7.9, 400 mM KCl, 50 mM MgCl2 (see Note 1).

  2. 10 mM MnCl2 in H2O (see Note 2).

  3. 50, 150, 250 mM MgCl2.

  4. DTT: 0.1 mM 1,4-dithiothreitol.

  5. RNasin: ribonuclease inhibitor (isolated from human placenta) supplied in 20 mM HEPES–KOH (pH 7.6), 50 mM KCl, 8 mM DTT, 50% (v/v) glycerol (Promega).

  6. T7 RNAP (200 units/μL, TM910K, Epicentre).

  7. T7R&DNA polymerase (50 units/μL, D7P9205K, Epicentre).

  8. ATP, GTP, CTP, and UTP (GE Healthcare).

  9. Purified ATP, GTP, and CTP (see Note 3).

  10. 2′-F-dUTP and 2′-F-dCTP (Epicentre).

  11. 4 NTP stock: 1 mM solution of each ATP, GTP, CTP, and UTP (use the commercial NTPs).

  12. ACGF-U stock: 1 mM solution of each ATP, GTP, CTP, and 2′-F-dUTP in water (see Note 4).

  13. AUCF-C stock: 1 mM solution of each ATP, GTP, UTP, and 2′-F-dCTP (see Note 4).

  14. α-[32P] GTP (3000 Ci/mmol, PerkinElmer BLU506H) (see Note 5).

  15. Acetylated bovine serum albumin (BSA): 20 mg/mL.

  16. RNase H from Escherichia coli (Sigma or Promega).

  17. Centrifugal filter devices (microcons) for volumes up to 500 μL with a 100 kDa molecular weight cutoff (Amicon Ultra-0.5; Millipore).

2.2. Components for the Polyacrylamide gel Electrophoresis (PAGE) of RNA

  1. Nondenaturing (native) PAGE buffer stock (5×): Dissolve 27.5 g of boric acid and 104 g of Trizma base in water and adjust to a final volume of 1 L.

  2. 1 M Mg(OAc)2.

  3. Native PAGE running buffer (1×): combine 200 mL of the 5× running buffer and 2 mL 1 M Mg(OAc)2 and adjust to a final volume of 1 L with water. Cool down the running buffer after the preparation. It can be stored at 4 °C for several days.

  4. Native gel loading buffer: combine 200 μL 5× native PAGE buffer stock, 2 μL 1 M Mg(OAc)2, 0.5 g glycerol, and 10 μg of each bromophenol blue and xylene cyanol, and adjust to 1 mL with water. Vortex thoroughly.

  5. Acrylamide solution for nondenaturing PAGE: 7% acrylamide–bis-acrylamide 29:1.

  6. Denaturing gel-loading solution: 7 M urea, 50 mM EDTA, 0.001% bromophenol blue and xylene cyanol.

  7. 5× Tris–borate–EDTA buffer (5× TBE): Dissolve 220 g of boric acid, 432 g of Trizma base, 160 mL 0.5 M EDTA in water and adjust to a final volume of 8 L.

  8. Denaturing acrylamide solution: 20% acrylamide–bis-acrylamide 19:1, 7 M urea, 1× TBE. The solution should be filtered through 0.22 μ filter.

  9. 10% ammonium persulfate (APS).

  10. N,N,N′,N′-tetramethylethylenediamine (TEMED).

  11. 20 × 20 cm electrophoretic glass plates.

  12. 0.8 mm comb and spacers (for the nondenaturing PAGE).

  13. 0.4 mm comb and spacers (for the denaturing PAGE).

  14. Vertical electrophoretic unit (Thermo Scientific or similar).

  15. Storage Phosphor screen and a Phosphorimager.

2.3. Software

  1. Image Processing Software Such as ImageQuant or ImageJ.

3. Methods

3.1. Comparison of the Wild Type T7 RNAP and the Mutant T7 R&DNAP for the Production of Chemically Modified RNA

  1. Prepare a master mix: 6 μL of 10× TB, 3 μL of 10 mM MnCl2, 39 μL of 0.02 μM template DNA, 3 μL of α-[32P] GTP.

  2. Split the master mix to two 25.5 μL aliquots. Add 3 μL of 1 mM 4 NTP stock to the first aliquot and 3 μL of 1 mM ACGF-U stock to the second aliquot (see Note 6).

  3. Take out two 9.5 μL aliquots from each mix. Start the reaction by adding 0.5 μL of T7 RNAP or T7 R&DNAP. Incubate at 37 °C for 60 min.

  4. Prepare the denaturing gel:
    1. Prewarm 25 mL of the denaturing acrylamide solution to room temperature in a 50 mL disposable screw-cap tube, add 250 μL of 10% APS, mix by inverting the tube, add 25 μL of TEMED, and mix again.
    2. Cast the gel using the 0.4 mm-thick spacers and a comb.
    3. Let the polymerization proceed for at least 30 min. It is not necessary to prerun the gel before the samples are loaded.
  5. Stop the transcription reactions by adding 10 μL of denaturing gel loading buffer. Incubate at 95 °C for 2 min.

  6. Load up to 10 μL of sample per well. Perform electrophoresis in 1× TBE for 50 min at 50 W constant power. The bromophenol blue dye should migrate 3/4 of the gel length.

  7. Transfer the gel to a sheet of the developed X-ray film or leave it on the glass plate, and wrap with a plastic film.

  8. Expose to a Phosphor screen and scan using Phosphor imager. The result of the described experiment performed using the DNA template encoding the strand F of a basic (nonfunctionalized) nanoring [11] is shown in Fig. 3 (see Note 7).

Fig. 3.

Fig. 3

Transcription by the wild type T7 RNAP (WT) and the Y639F T7 RNAP mutant (R&D) in the presence of regular NTPs and with UTP substituted by 2′-F-dUTP (ACGF-U mix) (Subheading 3.1)

3.2. Optimization of the Transcript Yield by Modification of the Sequence at the RNA 5′End

The following protocol suggests a framework for the analysis of the effect of a 5′-end extension of the nonfunctionalized RNA nanocube strand A sequence [13] (5′GGCAACUUUGAUCCCUCGGUUUAGCGCCGGCCUUUUCUCCCACACUUUCACG3′) with a purine-rich stretch (5′GGGAAAGGAAGAGC3′) obtaining a new template encoding the modified RNA strand A [23]. Additionally, the protocol includes optimization of [MgCl2] and incorporation of 2′-F-dNTPs.

  1. Prepare two master mixes, one with the original template, and one with the modified template, planning for twelve 10 μL reactions in each: 15 μL of 10× TB, 7.5 μL of 10 mM DTT, 1.5 μL of RNasin, 3 μL of T7 RNAP, 3 μL of 0.4 μM template, 7.5 μL of 10 mM MnCl2, 82.5 μL of H2O.

  2. Prepare three tubes with 5 μL each of 2 mM four NTPs, ACGF-U and ACGF-C mixes. Add 5 μL of α-[32P] GTP to each tube to obtain the labeled NTP mixes.

  3. Prepare four tubes containing 30 μL of each master mix. Add 3.75 μL of H2O or 50, 150, or 250 mM MgCl2 to the tubes to test transcription in 5, 10, 20, and 30 mM MgCl2.

  4. Take out three 9 μL aliquots from each of the eight tubes containing two different templates and four various concentrations of MgCl2. Start transcription by adding the labeled NTP mixes to each of the three tubes. Incubate at 37 °C for 30 min.

  5. Analyze the reaction products by denaturing PAGE (see Subheading 3.1, steps 4–8).

  6. Quantify the RNA yield using image processing software, taking into account the different number of the radioactively labeled GMP residues in the transcripts obtained from different templates (Fig. 4a) (see Note 8).

  7. The balancing of nanocube subunit yields by the 5′ extension is shown in Fig. 4b (compare the lanes 1–6 and lanes 7–12).

  8. If necessary, remove the 5′ purine-rich stretch from the transcript to restore the original RNA sequence, using the DNA oligo-guided degradation by RNase H.
    1. After transcription is completed, transfer the reaction tube to room temperature.
    2. Add 1 μM final of DNA oligonucleotide complementary to the purine-rich stretch (5′GCTCTTCCTTTCCC3′) and 0.01 unit/μL RNase H (Sigma).
    3. Incubate for 30 min.
    4. Determine the efficiency of digestion (see Note 9) by denaturing PAGE (see Subheading 3.1, steps 4–8) (Fig. 4b, lanes 13–16).

Fig. 4.

Fig. 4

Effects of the transcript sequence and MgCl2 on transcription. Panel (a) demonstrates that insertion of a polypurine stretch at the 5′end of the transcript substantially promotes transcription by T7 RNAP and that increased MgCl2 inhibits transcription on both the original and extended templates. The experiment is described in Subheading 3.2, steps 1–6. Panel (b) illustrates the outcome of transcription performed in the presence of 5 mM MgCl2 and 0.5 mM MnCl2 in the presence of NTP mixes indicated on top of the gel on the original (lanes 1–6) and extended (lanes 7–16) templates. The original nanocube subunit sequence is restored by the post-transcriptional treatment with RNase H (Subheading 3.2, step 8)

3.3. Optimization of the T7 RNAP and Template DNA Concentrations in the Cotranscriptional Assembly of the RNA Nanoring Containing 2′-Fluorinated UMPs

This protocol represents an example of fine-tuning the cotranscriptional assembly conditions after the best conditions for the individual subunit expression in equally high amounts have been established.

  1. Prepare the master mix: 7.5 μL of 10× TB, 53.5 μL of H2O, 3.25 μL of 10 mM MnCl2, 7.5 μL of ACGF-U, 3.25 μL of α-[32P] GTP, 0.75 μL of 100 mM DTT, and 0.75 μL of RNasin.

  2. Mix six templates, adjusting the concentration to 4 μM each.

  3. Prepare three thin-walled PCR tubes with 6.5 μL, one with 14 μL, and one with 29 μL of the master mix. Add 0.5 μL of the template mix to each tube.

  4. Start the reaction by adding 0.25 and 1 μL of T7 RNAP to the first two tubes and 0.5 μL of T7 RNAP to the remaining tubes. Incubate for 3 h at 37 °C in a thermocycler to diminish evaporation.

  5. During the incubation, prepare the native gel: prewarm 75 mL of the native acrylamide solution to room temperature in a beaker, add 500 μL of 10% APS, carefully mix with a glass rod or a disposable pipette, add 30 μL of TEMED, and mix again. Cast the gel using the 0.8 mm-thick spacers and a comb. Let the polymerization proceed for at least 30 min. Native PAGE should be performed at 4 °C. It is necessary to prerun the gel for 15 min at 25 W before the samples are loaded.

  6. Take out 7 μL aliquots from each tube and add 7 μL of the native gel loading buffer to each. Freeze the remaining transcription mix at −80 °C for the future use or proceed with purification (see Subheading 3.3, step 9 below).

  7. Load the samples and perform PAGE for 4 h at 25 W at 4 °C. Leave the gel on one plate, and wrap with the plastic film.

  8. Expose to a Phosphor screen for 30 min and scan using Phosphor imager. Results showing that a high concentration of T7 RNAP is inhibitory to transcription are shown in Fig. 5.

  9. Purify the remaining nanorings from unincorporated NTPs using centrifugal filter devices (microcons).
    1. Dilute the transcription mix with 450 μL of 1× native PAGE running buffer containing 0.1 mg/mL acetylated BSA (see Note 10) and transfer to a microcon chamber.
    2. Spin for 8–10 min at 20,000 × g. Transfer the chamber to a fresh collection tube, and discard the used collection tube with the radioactive flow-through.
    3. Repeat two more times.
    4. Insert the chamber upside down into a fresh collection tube, and spin down briefly on a tabletop centrifuge to collect the retentate containing the purified nanoring.
    5. Take out 0.7 μL and add to 10 μL of the native gel loading buffer.
    6. Analyze by native PAGE as described in Subheading 3.3, steps 5 and 7.

Fig. 5.

Fig. 5

High concentration of T7 RNAP is inhibitory to transcription and nanoparticle assembly. Panel (a) illustrates the experiment described in Subheading 3.3. Further dilution of the reaction decreases the nanoparticle yield as shown in panel (b)

3.4. Large-Scale Cotranscriptional Production of a Nanoparticle Carrying Three Separate siRNA Precursors Connected by Three-Way Junctions [25] and Removal of the 5′-end Extensions by RNase H Treatment

Three-way junctions are compact RNA tertiary motifs connecting RNA helices. The helices may carry RNA-based functionalities. Fig. 6a depicts RNA sequences designed to obtain the nanoparticle carrying three different asymmetric Dicer substrates (tested in our previous work [26] against eGFP, GSTP1–1, and HIV protease) connected by 3 three-way junctions. The three RNA strands start from 5′-AC-3′, 5′-AA-3′, and 5′-GA-3′ dinucleotides, which makes the templates encoding these RNAs poor substrates for T7 RNAP [17]. To support high and balanced yields of all three RNAs for cotranscriptional assembly, we added a purine-rich stretch (see Subheading 3.2) to the 5′-ends of all RNA strands. The cotranscriptional assembly of the three-way junction RNA nanoparticle, and removal of the extra RNA using RNase H is outlined below.

Fig. 6.

Fig. 6

Cotranscriptional assembly of a three-way junction carrying three different asymmetric Dicer substrates (tested in our previous work [26]) indicated by black, red, and green colors, respectively in panel (a). The three-way junction motif is colored in blue. The 5′-end extensions of the RNA strands are shown in orange, and the complementary sequence of the ssDNA that targets the RNase H-mediated degradation of the ssRNA starting sequence extensions are shown on the bottom of panel (a). The relative mobilities of the RNA nanoparticles before and after the treatment with RNase H analyzed on native-PAGE are illustrated in panel (b)

  1. Prepare the master mix: 10 μL of 10× TB, 71 μL of H2O, 5 μL of 10 mM MnCl2, 1 μL of 25 mM 4 NTPs, 3 μL of α-[32P] GTP, 1 μL of 100 mM DTT, and 1 μL of RNasin.

  2. Prepare the mix of the template DNA fragments containing 0.2 μM of each of the three templates.

  3. Add 2 μL of the template mix to the master mix.

  4. Start transcription by adding 5 μL of T7 RNAP. Incubate for 3 h at 37 °C.

  5. Bring the transcription reaction to room temperature.

  6. Add 1 μL of 100 μM DNA oligo for RNase H (Fig. 6a).

  7. Take out 1 μL from the transcription reaction, add to 10 μL of native gel loading buffer, and place on ice (“No RNase H” control).

  8. Split the transcription reaction to two 50 μL aliquots. Add 5 μL of RNase H (Sigma) to one aliquot and 5 μL of RNase H (Promega) to another aliquot. Incubate for 30 min at room temperature.

  9. Take out 1 μL from each of the two reactions and add to 10 μL of native gel loading buffer.

  10. Analyze the samples, including the “No RNase H” control, by native PAGE (see Subheading 3.3, steps 5 and 7). Fig. 6b shows that treatment with RNase H results in an increase of electrophoretic mobility of the RNA nanoparticle due to removal of the single strand RNA regions by RNase H. Two batches of RNase H tested in the experiment work equally well.

Acknowledgments

We thank Lorena Parlea and Paul Zakrevsky for fruitful discussions, and Josh Turek-Herman for proofreading the manuscript. The contents of this publication do not necessarily reveal the views or policies of the Department of Health and Human Services, nor does the mention of trade names, commercial product, or organizations imply endorsement by the US Government. This work was supported by the Intramural Research Program of the National Institutes of Health, Center for Cancer Research, the National Cancer Institute.

Footnotes

1.

We have been routinely using regular ddH2O, instead of DEPC-treated or commercially produced RNase-free water without ill effect on the quality of RNA.

2.

MnCl2 precipitates in TB within several hours. Add MnCl2 immediately before transcription is started.

3.

The NTP purification rationale and procedure are described in detail in [27].

4.

Use the purified nonmodified NTPs to avoid contamination of the 2′-F-NTP with its unmodified analog.

5.

Exercise caution while handling radioactive material, always use the appropriate shielding and strictly follow your institutional rules about radioactive material handling and disposal. Use extra care while discarding buffers from the bottom chamber of the gel electrophoresis apparatus.

6.

When planning to run x reactions, make the mix sufficient for at least x + 1 reactions to account for the pipetting errors.

7.

The concentration of T7 R&DNAP is four times lower than the concentration of the wild type T7 RNAP. Taking into account the difference in the concentrations of the wild type and the mutant T7 RNAPs, it is clear that T7 R&DNAP is much more efficient (per unit of the enzyme) to incorporate 2′-F-dUTP in the transcription conditions described here. However, the price of R&DNAP per microliter of the commercially available enzyme solution is still at least two times higher than the price of the wild type T7 RNAP. Considering that the yields of chemically modified RNA obtained with equal volumes of wild type T7 RNAP and R&DNAP in Fig. 3 are nearly identical, we have chosen the wild type T7 RNAP for a better price-to-performance ratio in our experiments. T7 R&DNAP should definitely be considered if less expensive approaches to increase the yield of the chemically modified RNA from a certain template prove unsuccessful.

8.

For example, the signal from unmodified full-length transcription product obtained from the original template at 5 mM MgCl2 (Fig. 4a, lane 1) is 11 times lower than the signal from the corresponding sample obtained in the modified template encoding the transcript containing a purine-rich stretch at the 5′ end (Fig. 4a, lane 11). However, the RNA yield on the modified template is only 5.7 times higher, because the original RNA strand contains 8 GMP residues, and the modified one contains 15 GMP residues. The decrease in the amount of the abortive products on the modified template is more dramatic than it appears, because the prominent abortive products on the original template carry only two GMP residues, while relatively minor abortive products appearing during transcription of the modified template carry three or more GMPs.

9.

Mn2+ in millimolar concentrations has been reported to inhibit RNase H from E. coli [28]. If the efficiency of the reaction is low, desalt the RNA the using centrifuge filter units with a 10 kDa MWCO (see Subheading 3.3, step 8).

10.

Addition of BSA is absolutely essential, because it prevents binding of the nanoring to the microcon membrane. A purification attempt in the absence of BSA resulted in a complete absence of the nanoring in the eluate and accumulation of the radioactive signal on the membrane.

References

  • 1.Castanotto D, Rossi JJ (2009) The promises and pitfalls of RNA-interference-based therapeutics. Nature 457(7228):426–433. doi: 10.1038/nature07758 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Zuckerman JE, Davis ME (2015) Clinical experiences with systemically administered siRNA-based therapeutics in cancer. Nat Rev Drug Discov 14(12):843–856. doi: 10.1038/nrd4685 [DOI] [PubMed] [Google Scholar]
  • 3.Cho SW, Kim S, Kim JM, Kim JS (2013) Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31(3):230–232. doi: 10.1038/nbt.2507 [DOI] [PubMed] [Google Scholar]
  • 4.Kelley ML, Strezoska Z, He K, Vermeulen A, Smith A (2016) Versatility of chemically synthesized guide RNAs for CRISPR-Cas9 genome editing. J Biotechnol 233:74–83. doi: 10.1016/j.jbiotec.2016.06.011 [DOI] [PubMed] [Google Scholar]
  • 5.Li L, Allen C, Shivakumar R, Peshwa MV (2013) Large volume flow electroporation of mRNA: clinical scale process. Methods Mol Biol 969:127–138. doi: 10.1007/978-1-62703-260-5_9 [DOI] [PubMed] [Google Scholar]
  • 6.Preskey D, Allison TF, Jones M, Mamchaoui K, Unger C (2016) Synthetically modified mRNA for efficient and fast human iPS cell generation and direct transdifferentiation to myoblasts. Biochem Biophys Res Commun 473(3):743–751. doi: 10.1016/j.bbrc.2015.09.102 [DOI] [PubMed] [Google Scholar]
  • 7.Grabow WW, Jaeger L (2014) RNA self-assembly and RNA nanotechnology. Acc Chem Res 47(6):1871–1880. doi: 10.1021/ar500076k [DOI] [PubMed] [Google Scholar]
  • 8.Haque F, Guo P (2015) Overview of methods in RNA nanotechnology: synthesis, purification, and characterization of RNA nanoparticles. Methods Mol Biol 1297:1–19. doi: 10.1007/978-1-4939-2562-9_1 [DOI] [PubMed] [Google Scholar]
  • 9.Shukla GC, Haque F, Tor Y, Wilhelmsson LM, Toulme JJ, Isambert H, Guo P, Rossi JJ, Tenenbaum SA, Shapiro BA (2011) A boost for the emerging field of RNA nanotechnology. ACS Nano 5(5):3405–3418. doi: 10.1021/nn200989r [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Afonin KA, Kasprzak WK, Bindewald E, Kireeva M, Viard M, Kashlev M, Shapiro BA (2014) In silico design and enzymatic synthesis of functional RNA nanoparticles. Acc Chem Res 47(6):1731–1741. doi: 10.1021/ar400329z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Afonin KA, Kireeva M, Grabow WW, Kashlev M, Jaeger L, Shapiro BA (2012) Cotranscriptional assembly of chemically modified RNA nanoparticles functionalized with siR-NAs. Nano Lett 12(10):5192–5195. doi: 10.1021/nl302302e [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Afonin KA, Grabow WW, Walker FM, Bindewald E, Dobrovolskaia MA, Shapiro BA, Jaeger L (2011) Design and self-assembly of siRNA-functionalized RNA nanoparticles for use in automated nanomedicine. Nat Protoc 6 (12):2022–2034. doi: 10.1038/nprot.2011.418 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Afonin KA, Bindewald E, Yaghoubian AJ, Voss N, Jacovetty E, Shapiro BA, Jaeger L (2010) In vitro assembly of cubic RNA-based scaffolds designed in silico. Nat Nanotechnol 5 (9):676–682. doi: 10.1038/nnano.2010.160 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Afonin KA, Viard M, Tedbury P, Bindewald E, Parlea L, Howington M, Valdman M, Johns-Boehme A, Brainerd C, Freed EO, Shapiro BA (2016) The use of minimal RNA toeholds to trigger the activation of multiple functionalities. Nano Lett 16(3):1746–1753. doi: 10.1021/acs.nanolett.5b04676 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Afonin KA, Lin YP, Calkins ER, Jaeger L (2012) Attenuation of loop-receptor interactions with pseudoknot formation. Nucleic Acids Res 40(5):2168–2180. doi: 10.1093/nar/gkr926 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Geary C, Rothemund PW, Andersen ES (2014) RNA nanostructures. A single-stranded architecture for cotranscriptional folding of RNA nanostructures. Science 345 (6198):799–804. doi: 10.1126/science.1253920 [DOI] [PubMed] [Google Scholar]
  • 17.Milligan JF, Uhlenbeck OC (1989) Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol 180:51–62 [DOI] [PubMed] [Google Scholar]
  • 18.Milligan JF, Groebe DR, Witherell GW, Uhlenbeck OC (1987) Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nucleic Acids Res 15 (21):8783–8798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sousa R, Padilla R (1995) A mutant T7 RNA polymerase as a DNA polymerase. EMBO J 14 (18):4609–4621 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wyatt JR, Walker GT (1989) Deoxynucleotide-containing oligoribonucleotide duplexes: stability and susceptibility to RNase V1 and RNase H. Nucleic Acids Res 17(19):7833–7842 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Conrad F, Hanne A, Gaur RK, Krupp G (1995) Enzymatic synthesis of 2′-modified nucleic acids: identification of important phosphate and ribose moieties in RNase P substrates. Nucleic Acids Res 23(11):1845–1853 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gopalakrishna S, Gusti V, Nair S, Sahar S, Gaur RK (2004) Template-dependent incorporation of 8-N3AMP into RNA with bacteriophage T7 RNA polymerase. RNA 10(11):1820–1830. doi: 10.1261/rna.5222504 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Afonin KA, Viard M, Kagiampakis I, Case CL, Dobrovolskaia MA, Hofmann J, Vrzak A, Kireeva M, Kasprzak WK, KewalRamani VN, Shapiro BA (2015) Triggering of RNA interference with RNA-RNA, RNA-DNA, and DNA-RNA nanoparticles. ACS Nano 9 (1):251–259. doi: 10.1021/nn504508s [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Holmes SF, Foster JE, Erie DA (2003) Kinetics of multisubunit RNA polymerases: experimental methods and data analysis. Methods Enzymol 371:71–81. doi: 10.1016/S0076-6879(03)71005-2 [DOI] [PubMed] [Google Scholar]
  • 25.Parlea L, Bindewald E, Sharan R, Bartlett N, Moriarty D, Oliver J, Afonin KA, Shapiro BA (2016) Ring catalog: a resource for designing self-assembling RNA nanostructures. Methods 103:128–137. doi: 10.1016/j.ymeth.2016.04.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Afonin KA, Viard M, Martins AN, Lockett SJ, Maciag AE, Freed EO, Heldman E, Jaeger L, Blumenthal R, Shapiro BA (2013) Activation of different split functionalities on reassociation of RNA-DNA hybrids. Nat Nanotechnol 8(4):296–304. doi: 10.1038/nnano.2013.44 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lubkowska L, Kireeva ML (2015) Direct competition assay for transcription fidelity. Methods Mol Biol 1276:153–164. doi: 10.1007/978-1-4939-2392-2_8 [DOI] [PubMed] [Google Scholar]
  • 28.Goedken ER, Marqusee S (2001) Co-crystal of Escherichia coli RNase HI with Mn2+ ions reveals two divalent metals bound in the active site. J Biol Chem 276(10):7266–7271. doi: 10.1074/jbc.M009626200 [DOI] [PubMed] [Google Scholar]

RESOURCES