Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2020 Dec 16;65(1):e01622-20. doi: 10.1128/AAC.01622-20

Emergence of a Novel tet(L) Variant in Campylobacter spp. of Chicken Origin in China

Hong Yao a,#, Dian Jiao a,#, Wenbo Zhao a, Aijuan Li a, Ruichao Li b, Xiang-Dang Du a,
PMCID: PMC7927821  PMID: 33046498

Tetracyclines are widely used in veterinary medicine and food animal production. Campylobacter members are major foodborne pathogens, and their resistance to tetracycline has been widely reported in different countries. To date, Tet(O), a ribosomal protection protein, is the only confirmed Tet resistance determinant in Campylobacter spp. Here, we reported the detection and characterization of a novel Tet resistance element in Campylobacter spp. of chicken origin.

KEYWORDS: Campylobacter, tet(L) variant, tigecycline resistance

ABSTRACT

Tetracyclines are widely used in veterinary medicine and food animal production. Campylobacter members are major foodborne pathogens, and their resistance to tetracycline has been widely reported in different countries. To date, Tet(O), a ribosomal protection protein, is the only confirmed Tet resistance determinant in Campylobacter spp. Here, we reported the detection and characterization of a novel Tet resistance element in Campylobacter spp. of chicken origin. This gene is identified to be a variant of tet(L), which encodes an efflux pump for Tet resistance. The variant was detected in 14 of the 82 tetracycline-resistant Campylobacter isolates collected from chickens in Henan, China. Cloning of the tet(L) variant into tetracycline-susceptible Campylobacter jejuni NCTC 11168 confirmed its function in conferring resistance to tetracycline and doxycycline. In addition, this tet(L) variant elevated the MIC (4-fold increase) of tigecycline in the heterologous Escherichia coli host. Sequencing analysis indicated the tet(L) variant was located within a multidrug-resistance genomic island (MDRGI) containing tet(L) variant IS1216E-ORF1-fexAtnp-IS1216E-tet(O)-tnpV-repA. This MDRGI is inserted into conserved gene potB on the chromosome. Multilocus sequence type (MLST) analysis revealed that both clonal expansion and horizontal transfer were involved in the dissemination of the tet(L) variant. These findings reveal the emergence of a new Tet resistance determinant in Campylobacter spp., which may facilitate their adaptation to the antimicrobial selection pressure in chickens.

INTRODUCTION

The class of tetracyclines is one of the most frequently applied antimicrobials in veterinary medicine and food animal production (1). The vast use of tetracyclines has led to the emergence and widespread distribution of tetracycline resistance genes. Several tetracycline resistance mechanisms and a range of resistance genes have been described in tetracycline-resistant bacteria of food animal and human origin, such as tet(A), tet(K), tet(L), and tet(Y) genes encoding an efflux pump (2); tet(M) and tet(O) genes encoding ribosomal protection (3); and tet(X) and its variants encoding enzymatic inactivation (4, 5). The tet(L) gene encodes a membrane-associated efflux system preventing the accumulation of tetracycline in the cell. Since the tet(L) gene was reported in 1980s, it has often been identified on plasmids of Gram-positive bacterium, such as Staphylococcus aureus (6, 7).

Thermophilic Campylobacter species, including Campylobacter jejuni and Campylobacter coli, are major foodborne pathogens and leading causes of human gastroenteritis, accounting for 400 to 500 million cases of diarrhea each year worldwide (8). Food-producing animals, such as poultry, are the predominant reservoirs for this pathogenic organism (9). An increasing prevalence of resistance to antimicrobials in Campylobacter spp. has been reported in many countries (1013). Several mechanisms mediating resistance to clinically useful antimicrobials have been described in Campylobacter spp., including multidrug efflux pump CmeABC (14) and its functional enhanced variant RE-CmeABC (15); mutations in gyrA (to fluoroquinolones) and 23S rRNA (to macrolides) (16); and horizontally transferrable resistance genes tet(O) (to tetracyclines) (17), aph(2″)-If (to aminoglycosides) (18), erm(B) (to macrolides) (19), cfr(C) (20), fexA (21), and optrA (to florfenicol) (22).

Campylobacter members are constantly exposed to antimicrobials used for food animal production, such as tetracyclines. The prevalence of tetracycline-resistant Campylobacter isolates of food animal origin was reported in various studies (2325). To date, the ribosomal protection protein Tet(O) is the only specialized tetracycline-resistant gene confirmed in Campylobacter spp. Previously, there was a report of PCR detection of tet(A) in Campylobacter spp. (26), but a more recent study indicated the PCR-detected tet(A) was actually tet(O) (27). In addition to Tet(O), the efflux pump CmeABC or RE-CmeABC can also act synergistically with Tet(O) to confer a higher level of tetracycline resistance (28). In this study, we report the identification of a novel tetracycline resistance determinant in Campylobacter spp. during our routine antibiotic resistance surveillance. This element is a variant of Tet(L) that confers tetracycline resistance by an efflux mechanism.

RESULTS AND DISCUSSION

Identification of tet(L) variant in tetracycline-resistant Campylobacter spp.

In total, 82 (C. jejuni, n = 73; C. coli, n = 9) of the 85 Campylobacter isolates displayed resistance to tetracycline, representing a prevalence of tetracycline resistance at 96.5%. These isolates were from cecal contents of chicken that were collected in our routine surveillance study for antimicrobial resistance in Campylobacter spp. from food-producing animals. The reported resistance rates of Campylobacter spp. to tetracycline ranged from 14.0% to 78.6% in other countries (10, 23, 24). Thus, the tetracycline resistance rate detected in this study is higher than that previously reported, which is consistent with previous findings in China (25). This trend may be driven by the large-scale usage of tetracycline antibiotics in poultry production.

All 82 tetracycline-resistant Campylobacter isolates were examined for the presence of the tet(O) gene by PCR, which, to date, was the main determinant conferring tetracycline resistance in Campylobacter spp. (28). Most tetracycline-resistant Campylobacter spp. (n = 76, 92.7%) harbored tet(O). Furthermore, other tetracycline resistance genes, including tet(A), tet(K), tet(Y), tet(M), tet(L), and tet(X), were also analyzed in these 82 tetracycline-resistant Campylobacter isolates by PCR. The tet(L) gene, encoding an efflux pump, was often reported on plasmids of methicillin-resistant Staphylococcus aureus (MRSA) that confers resistance to tetracycline (7), but it has not been described in Campylobacter spp. However, tet(L) was identified in 14 Campylobacter (C. jejuni, n = 6; C. coli, n = 8) isolates (17.1%) in this study (Table 1). These 14 tet(L)-positive Campylobacter isolates also harbored tet(O). No other tetracycline resistance gene, such as tet(A), tet(K), tet(Y), tet(M), and tet(X), was identified in these tetracycline-resistant Campylobacter spp. These results indicated that the emergence of tet(L) in Campylobacter spp. may represent another novel tetracycline resistance determinant in addition to tet(O).

TABLE 1.

MLST types of the 14 tet(L)-positive Campylobacter isolatesa

Species Isolate ST CCb
C. coli 1922C3 ST830 828
1922C6 ST830 828
1922C15 ST830 828
1922C17 ST830 828
1922C20 ST830 828
1922C27 ST830 828
1922C39 ST830 828
1922C59 ST830 828
C. jejuni 1922C42 ST8089 -c
1922C12 ST429 48
1922C14 ST429 48
1922C24 ST8089 -
1922C28 ST305 574
1922C33 ST574 574
a

All samples were isolated from chicken.

b

CC, clonal complex.

c

-, untypeable.

Subsequently, C. coli 1922C17 was selected from the tet(L)-positive strains for whole-genome sequencing. A 1,374-bp gene was identified, which is highly homologous to the staphylococcal tet(L) gene (GenBank accession number RCDF01000030.1) with only a 7-bp mutation and a 3-bp deletion. This gene is designed tet(L) variant in this study.

Functional confirmation of the tet(L) variant in Campylobacter spp. and E. coli.

To determine the role of tet(L) alone in contributing to tetracycline resistance in Campylobacter spp., the intact copy of the tet(L) variant and its putative promoter were successfully cloned from C. coli 1922C17 into C. jejuni NCTC 11168 and inserted between the housekeeping genes panB and cj0299 on the chromosome. The construct, designated C. jejuni 11168-tet(L), displayed a 16-fold and 8-fold increase in the MICs of tetracycline and doxycycline, respectively, compared with MICS of the parent strain C. jejuni NCTC11168 (Table 2). The result revealed that the tet(L) variant alone can mediate a significantly increased resistance to tetracycline and doxycycline in Campylobacter spp.

TABLE 2.

MICs of tetracycline antibiotics and other antibiotics for various isolates and constructs

Strain Description MIC (μg/ml) of:
TETa DOX TIG FFC ERY
C. jejuni NCTC 11168 Wild-type Campylobacter strain 0.5 0.125 0.06 1 0.5
C. jejuni 11168-tet(L) Transformant harboring tet(L) variant 8 1 0.06 1 32
C. coli 1922C17 Donor for tet(L) variant and MDRGI >256 64 0.06 64 >256
DH5α Wild-type E. coli strain 1 0.5 0.5
DH5α-pUC19 DH5α containing pUC19 plasmid 1 1 0.5
DH5α-pUC19-tet(L).ref DH5α containing pUC19-tet(L).ref plasmid 8 4 0.5
DH5α-pUC19-tet(L) DH5α containing pUC19-tet(L) variant plasmid 128 32 2
a

TET, tetracycline; DOX, doxycycline; TIG, tigecycline; FFC, florfenicol; ERY, erythromycin.

To further investigate the influence of the tet(L) variant on resistance to tetracyclines in a heterologous host, the tet(L) variant together with its promoter region was amplified from C. coli 1922C17 and then cloned into the pUC19 vector to obtain pUC19-tet(L) in Escherichia coli DH5α. The E. coli construct DH5α-pUC19-tet(L) showed increased MICs to tetracycline (128-fold), doxycycline (64- or 32-fold), and tigecycline (4-fold), compared with those of the parent strain E. coli DH5α and DH5α-pUC19 (Table 2). Furthermore, the tet(L) gene in Staphylococcus sp. as a reference was also cloned into the pUC19 vector DH5α-pUC19-tet(L).ref and displayed 8-fold and 8- or 4-fold increased MICs to tetracycline and doxycycline compared with those of DH5α and DH5α-pUC19, respectively, while it showed the same level of resistance to tigecycline compared with that of the parent strains.

Tet(L), consisting of 14 transmembrane segments, represents a member of the MFS efflux pump family to export tetracycline but not minocycline or glycylcyclines from the cell cytoplasm (6, 29). It has been reported mostly in Gram-positive bacteria but has not formally been reported in Campylobacter spp. The Tet(L) variant identified in this study displayed mutation profiles of V1 deletion, N2M, T3K, S4C, and Y5N and showed 98.9% amino acid identity to the reference Tet(L) which was susceptible to tigecycline in MRSA (GenBank accession number RCDF01000030.1) and Enterococcus faecium (NC_017961). However, the tet(L) variant in the heterologous E. coli host can confer an increased resistance to tigecycline, which was regarded as the last resort antibiotic to treat infections caused by carbapenem-resistant Enterobacteriaceae (30). Similarly, the tet(A) variant identified in carbapenem-resistant hypervirulent Klebsiella pneumonia, which displayed a mutation profile of I5R, V55M, I75V, T84A, S201A, F202S, and V203F compared with the reference tet(A), had also conferred an increased resistance to tigecycline (31). The amino acid substitution of F62V in the tet(L) variant can also be associated with increased resistance to tigecycline in E. faecium UW8175 (29). Together with these studies, these data suggested the mutations in the tetracycline efflux pump, whether in tet(A) or tet(L), can contribute to an increased tigecycline resistance to some degree. However, the MIC difference displayed between Campylobacter spp. and E. coli is unknown, which needs to be further studied.

Furthermore, we retrieved all tet(L) variants in Campylobacter spp. from the GenBank database. The results revealed that a total of 17 Campylobacter WGS records were positive for tet(L) homologs; all sequences were deposited in February to May in 2020. The comparison analysis was performed for these 18 tet(L) variants (17 from database and 1 from this study), revealing they exhibited high identity to each other, and 3 tet(L) genes from the database showed 100% identity to the tet(L) variant identified in this study (see Fig. S1 in the supplemental material).

tet(L) variant-harboring MDRGI.

Comparative genomic analysis indicated that the tet(L) variant was located within a 12,680-bp multidrug resistance genomic island (MDRGI) and inserted into the housekeeping gene potB on chromosome in Campylobacter spp., along with a florfenicol resistance gene fexA and a tetracycline resistance gene tet(O) (Fig. 1). Two intact copies of IS1216E were identified as being located in the same orientation up- and downstream of fexA (Fig. 1). Although the same MDRGI from other species was not found, it showed 66.0% query coverage and 99.7% identity with that in the plasmid pE508 in E. faecalis (GenBank accession number MK425645). The GC content of this MDRGI was 38.2%, which was higher than that of the Campylobacter genome (approximately 30%). These results suggested that this tet(L) variant-containing MDRGI might originate from other species, possibly a Gram-positive organism. Interestingly, the MDRGI in this study showed high identity to that from C. jejuni ZH003 and C. coli 16SHKX65C (GenBank accession number CP048764 and BioSample accession number SAMN11316573), indicating its transfer potential (Fig. 1). A comparison analysis was also performed and indicated that the tet(L) variant in this study showed 100% and 99.20% identity with that in the isolates C. jejuni ZH003 and C. coli 16SHKX65C, respectively.

FIG 1.

FIG 1

The comparison of tet(L) variant-carrying MDRGI identified in this study with others. The antimicrobial resistance genes were colored in red, with insertion sequences in yellow. Genes with predicted functions are showed in blue. The conserved genes in Campylobacter spp. at both termini of the MDRGIs are displayed in black. Regions sharing more than 99% DNA identity are indicated by gray shading.

Molecular typing of tet(L)-carrying C. jejuni and C. coli isolates.

To determinate if the tet(L)-carrying Campylobacter isolates were genetically related, MLST analysis for all the 14 tet(L) variant-positive isolates were performed. The results showed that various sequence types (STs) were identified, including ST830 (n = 8), ST429 (n = 2), ST8089 (n = 2), ST305 (n = 1), and ST574 (n = 1) (Table 1). Of those STs, C. coli ST830 (belonging to clonal complex CC828) was the dominant clone harboring the tet(L) variant, while no dominant clone was found in C. jejuni. These findings in this study revealed both the genetic diversity and clonality of tet(L)-carrying isolates, revealing that both horizontal transmission and clonal expansion were involved in the dissemination of the tet(L) variant. Considering the usage of tetracyclines and florfenicol in veterinary medicine and food animal production, it is expected that the tet(L) variant will increase in prevalence under a selection pressure of antibiotics.

In conclusion, a novel tet(L) variant was identified in Campylobacter spp. of chicken origin. Gene cloning confirmed its function in conferring tetracycline resistance. When expressed in the heterologous E. coli host, the tet(L) variant can also confer resistance to tigecycline, in addition to tetracycline and doxycycline. The genetic diversity of the tet(L) variant-carrying Campylobacter spp. and its location in an MDRGI indicated that both horizontal transfer and clonal expansion were involved in its dissemination.

MATERIALS AND METHODS

Campylobacter isolates and antimicrobial susceptibility testing.

A total of 85 Campylobacter isolates (75 C. jejuni and 10 C. coli) were investigated in this study. These isolates were collected from cecal contents of chicken in a poultry farm in Henan Province, China, in 2019. All the Campylobacter strains were grown on Mueller-Hinton (MH) agar (Sigma-Aldrich, MO, USA) at 42°C under microaerobic conditions (5% O2, 10% CO2, and 85% N2).

Antimicrobial susceptibility testing was performed using the standard agar dilution method according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI) (32). C. jejuni ATCC 33560 was used as a quality-control strain. The resistance of antimicrobial agents was interpreted according to the criteria of CLSI.

PCR detection of tetracycline resistance genes in Campylobacter isolates.

The tetracycline resistance genes were detected in Campylobacter isolates by PCR and sequencing analysis using primers listed in Table S1 in the supplemental material, as described previously (5, 33). The PCR mixture was composed of 12.5 μl of Ex Taq (TaKaRa, Dalian, China), 0.5 μl of each primer, 0.5 μl of chromosomal DNA template prepared by boiling according to the methods described previously (34), and 11 μl of sterile distilled water.

Whole-genome sequencing.

Genomic DNA of C. coli 1922C17 was extracted using the Wizard genomic DNA purification kit (Promega, Beijing, China), following the manufacturer’s instructions, and then was used for whole-genome sequencing using the Illumina HiSeq 2500 platform. Draft genome sequences were assembled using BioNumerics v. 7.6 (Applied Maths). The Oxford Nanopore Technologies MinION long-read platform was used to obtain the complete sequence of C. coli 1922C17.

Functional cloning of the tet(L) variant.

In order to demonstrate the association of the tet(L) variant with tetracycline resistance, it was cloned to tetracycline-susceptible C. jejuni NCTC11168. Briefly, several pairs of primers (Table 3) were designed to amplify the intact copy of the tet(L) variant and its putative promoter (primers P1 and P2) from 1922C17, the erm(B) as a resistance screening gene (primers P3 and P4) in C. coli, and cj0299 (primers P5 and P6) and the panB (primers P7 and P8) in NCTC11168 using the online assembly tool NEBuilder (New England BioLabs, Ipswich, MA). The products of PCR were assembled with NEBuilder HiFi DNA assembly master mix (New England BioLabs, Beverly, MA, USA) according to the protocol provided by the manufacturer. Then, the assembled fragments were used as the PCR template, and the primers P5 and P8 were used to amplify the donor DNA. C. jejuni NCTC 11168 was used as the recipient strain for natural transformation according to the method described previously (35). A total of 4 μg/ml erythromycin was used for selecting the transformants.

TABLE 3.

Primers used in this study

Target Primer name Primer sequence (5′–3′)
tet(L) P1 TGTGGCAACACATCGTCATTCCTCCTGC
P2 TTTTTCTCATAGCTAACTTGTGGAACATATG
erm(B) P3 TTTTTTTCATGCCATGGTTTTTGGAGCC
P4 AATGACGATGTGTTGCCACACTTAGGAC
cj0299 P5 CTAGCCATCATTTTTAACTTTTTTTAC
P6 AAACCATGGCATGAAAAAAATAACTTTATTTTTACTTTTC
panB P7 CAAGTTAGCTATGAGAAAAAGTATGATTAGTTTTTTG
P8 TTAGTATAATTTATCTAATAATTCATCATCTAAATAATC
pUC19 P9 TCGCGCGTTTCGGTGATG
P10 GACGAAAGGGCCTCGTGATAC
tet(L) P11 TATCACGAGGCCCTTTCGTCCTACCTTATTTGATAGTAGATTTAAAAC
P12 GTCATCACCGAAACGCGCGAAGCTAACTTGTGGAACATATG

Similarly, the tet(L) variant was amplified from 1922C17 and cloned to pUC19 by using primers P9 to P12 (Table 3) and then transformed to DH5α by chemical transformation according to the protocol (TaKaRa, Dalian, China).

Multilocus sequence typing (MLST).

MLST was analyzed by PCR and sequencing of the 7 housekeeping genes (aspA, glnA, gltA, glyA, tkt, pgm, and uncA) in tet(L) variant-positive Campylobacter strains according to the PubMLST Web tool (http://pubmlst.org/campylobacter).

Data availability.

The sequence described in this study has been deposited at GenBank under accession number MT663352.

Supplementary Material

Supplemental file 1
AAC.01622-20-s0001.pdf (129.9KB, pdf)

ACKNOWLEDGMENTS

This work was financially supported by Youth Program of National Natural Science Foundation of China (number 31802239), the China Postdoctoral Science Foundation (number 2018M630822 and 2020T130175), and the Program for Innovative Research Team (in Science and Technology) in University of Henan Province (number 18IRTSTHN020).

Footnotes

Supplemental material is available online only.

REFERENCES

  • 1.Zhang Q-Q, Ying G-G, Pan C-G, Liu Y-S, Zhao J-L. 2015. Comprehensive evaluation of antibiotics emission and fate in the river basins of China: source analysis, multimedia modeling, and linkage to bacterial resistance. Environ Sci Technol 49:6772–6782. doi: 10.1021/acs.est.5b00729. [DOI] [PubMed] [Google Scholar]
  • 2.Tuckman M, Petersen PJ, Howe AY, Orlowski M, Mullen S, Chan K, Bradford PA, Jones CH. 2007. Occurrence of tetracycline resistance genes among Escherichia coli isolates from the phase 3 clinical trials for tigecycline. Antimicrob Agents Chemother 51:3205–3211. doi: 10.1128/AAC.00625-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Jones CH, Tuckman M, Murphy E, Bradford PA. 2006. Identification and sequence of a tet(M) tetracycline resistance determinant homologue in clinical isolates of Escherichia coli. J Bacteriol 188:7151–7164. doi: 10.1128/JB.00705-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sun J, Chen C, Cui C-Y, Zhang Y, Liu X, Cui Z-H, Ma X-Y, Feng Y, Fang L-X, Lian X-L, Zhang R-M, Tang Y-Z, Zhang K-X, Liu H-M, Zhuang Z-H, Zhou S-D, Lv J-N, Du H, Huang B, Yu F-Y, Mathema B, Kreiswirth BN, Liao X-P, Chen L, Liu Y-H. 2019. Plasmid-encoded tet(X) genes that confer high-level tigecycline resistance in Escherichia coli. Nat Microbiol 4:1457–1464. doi: 10.1038/s41564-019-0496-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.He T, Wang R, Liu D, Walsh TR, Zhang R, Lv Y, Ke Y, Ji Q, Wei R, Liu Z, Shen Y, Wang G, Sun L, Lei L, Lv Z, Li Y, Pang M, Wang L, Sun Q, Fu Y, Song H, Hao Y, Shen Z, Wang S, Chen G, Wu C, Shen J, Wang Y. 2019. Emergence of plasmid-mediated high-level tigecycline resistance genes in animals and humans. Nat Microbiol 4:1450–1456. doi: 10.1038/s41564-019-0445-2. [DOI] [PubMed] [Google Scholar]
  • 6.McMurry LM, Park BH, Burdett V, Levy SB. 1987. Energy-dependent efflux mediated by class L (tetL) tetracycline resistance determinant from streptococci. Antimicrob Agents Chemother 31:1648–1650. doi: 10.1128/aac.31.10.1648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Jiang N, Li J, Feßler AT, Wang Y, Schwarz S, Wu C. 2019. A novel small tet(T)-tet(L)-aadD-carrying plasmid from MRSA and MSSA ST9 isolates of swine origin. J Antimicrob Chemother 74:2462–2464. doi: 10.1093/jac/dkz177. [DOI] [PubMed] [Google Scholar]
  • 8.Ruiz-Palacios GM. 2007. The health burden of Campylobacter infection and the impact of antimicrobial resistance: playing chicken. Clin Infect Dis 44:701–703. doi: 10.1086/509936. [DOI] [PubMed] [Google Scholar]
  • 9.Kaakoush NO, Castaño-Rodríguez N, Mitchell HM, Man SM. 2015. Global epidemiology of Campylobacter infection. Clin Microbiol Rev 28:687–720. doi: 10.1128/CMR.00006-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Geissler AL, Bustos Carrillo F, Swanson K, Patrick ME, Fullerton KE, Bennett C, Barrett K, Mahon BE. 2017. Increasing Campylobacter infections, outbreaks, and antimicrobial resistance in the United States, 2004–2012. Clin Infect Dis 65:1624–1631. doi: 10.1093/cid/cix624. [DOI] [PubMed] [Google Scholar]
  • 11.Elhadidy M, Miller WG, Arguello H, Álvarez-Ordóñez A, Duarte A, Dierick K, Botteldoorn N. 2018. Genetic basis and clonal population structure of antibiotic resistance in Campylobacter jejuni isolated from broiler carcasses in Belgium. Front Microbiol 9:1014. doi: 10.3389/fmicb.2018.01014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wang Y, Dong Y, Deng F, Liu D, Yao H, Zhang Q, Shen J, Liu Z, Gao Y, Wu C, Shen Z. 2016. Species shift and multidrug resistance of Campylobacter from chicken and swine, China, 2008–14. J Antimicrob Chemother 71:666–669. doi: 10.1093/jac/dkv382. [DOI] [PubMed] [Google Scholar]
  • 13.Wei B, Cha S-Y, Kang M, Roh J-H, Seo H-S, Yoon R-H, Jang H-K. 2014. Antimicrobial susceptibility profiles and molecular typing of Campylobacter jejuni and Campylobacter coli isolates from ducks in South Korea. Appl Environ Microbiol 80:7604–7610. doi: 10.1128/AEM.02469-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lin J, Michel LO, Zhang Q. 2002. CmeABC functions as a multidrug efflux system in Campylobacter jejuni. Antimicrob Agents Chemother 46:2124–2131. doi: 10.1128/aac.46.7.2124-2131.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Yao H, Shen Z, Wang Y, Deng F, Liu D, Naren G, Dai L, Su C-C, Wang B, Wang S, Wu C, Yu EW, Zhang Q, Shen J. 2016. Emergence of a potent multidrug efflux pump variant that enhances Campylobacter resistance to multiple antibiotics. mBio 7:e01543-16. doi: 10.1128/mBio.01543-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Engberg J, Aarestrup FM, Taylor DE, Gerner-Smidt P, Nachamkin I. 2001. Quinolone and macrolide resistance in Campylobacter jejuni and C. coli: resistance mechanisms and trends in human isolates. Emerg Infect Dis 7:24–34. doi: 10.3201/eid0701.010104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Taylor DE, Garner RS, Allan BJ. 1983. Characterization of tetracycline resistance plasmids from Campylobacter jejuni and Campylobacter coli. Antimicrob Agents Chemother 24:930–935. doi: 10.1128/aac.24.6.930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yao H, Liu D, Wang Y, Zhang Q, Shen Z. 2017. High prevalence and predominance of the aph(2″)-If gene conferring aminoglycoside resistance in Campylobacter. Antimicrob Agents Chemother 61:e00112-17. doi: 10.1128/AAC.00112-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Qin S, Wang Y, Zhang Q, Zhang M, Deng F, Shen Z, Wu C, Wang S, Zhang J, Shen J. 2014. Report of ribosomal RNA methylase gene erm(B) in multidrug-resistant Campylobacter coli. J Antimicrob Chemother 69:964–968. doi: 10.1093/jac/dkt492. [DOI] [PubMed] [Google Scholar]
  • 20.Tang Y, Dai L, Sahin O, Wu Z, Liu M, Zhang Q. 2017. Emergence of a plasmid-borne multidrug resistance gene cfr(C) in foodborne pathogen Campylobacter. J Antimicrob Chemother 72:1581–1588. doi: 10.1093/jac/dkx023. [DOI] [PubMed] [Google Scholar]
  • 21.Tang B, Tang Y, Zhang L, Liu X, Chang J, Xia X, Yang H, Shen Z. 2020. The emergence of fexA in mediating resistance to florfenicols in Campylobacter. Antimicrob Agents Chemother 64:e00260-20. doi: 10.1128/AAC.00260-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Liu D, Yang D, Liu X, Li X, Feßler AT, Shen Z, Shen J, Schwarz S, Wang Y. 2020. Detection of the enterococcal oxazolidinone/phenicol resistance gene optrA in Campylobacter coli. Vet Microbiol 246:108731. doi: 10.1016/j.vetmic.2020.108731. [DOI] [PubMed] [Google Scholar]
  • 23.Meistere I, Ķibilds J, Eglīte L, Alksne L, Avsejenko J, Cibrovska A, Makarova S, Streikiša M, Grantiņa-Ieviņa L, Bērziņš A. 2019. Campylobacter species prevalence, characterisation of antimicrobial resistance and analysis of whole-genome sequence of isolates from livestock and humans, Latvia, 2008 to 2016. Euro Surveill 24:1800357. doi: 10.2807/1560-7917.ES.2019.24.31.1800357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.French NP, Zhang J, Carter GP, Midwinter AC, Biggs PJ, Dyet K, Gilpin BJ, Ingle DJ, Mulqueen K, Rogers LE, Wilkinson DA, Greening SS, Muellner P, Fayaz A, Williamson DA. 2019. Genomic analysis of fluoroquinolone- and tetracycline-resistant Campylobacter jejuni Sequence Type 6964 in humans and poultry, New Zealand, 2014–2016. Emerg Infect Dis 25:2226–2234. doi: 10.3201/eid2512.190267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Qin SS, Wu CM, Wang Y, Jeon B, Shen ZQ, Wang Y, Zhang Q, Shen JZ. 2011. Antimicrobial resistance in Campylobacter coli isolated from pigs in two provinces of China. Int J Food Microbiol 146:94–98. doi: 10.1016/j.ijfoodmicro.2011.01.035. [DOI] [PubMed] [Google Scholar]
  • 26.Abdi-Hachesoo B, Khoshbakht R, Sharifiyazdi H, Tabatabaei M, Hosseinzadeh S, Asasi K. 2014. Tetracycline resistance genes in Campylobacter jejuni and C. coli isolated from poultry carcasses. Jundishapur J Microbiol 7:e12129. doi: 10.5812/jjm.12129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lynch C, Hawkins K, Lynch H, Egan J, Bolton D, Coffey A, Lucey B. 2019. Investigation of molecular mechanisms underlying tetracycline resistance in thermophilic Campylobacter spp. suggests that previous reports of tet(A)-mediated resistance in these bacteria are premature. Gut Pathog 11:56. doi: 10.1186/s13099-019-0338-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Shen Z, Wang Y, Zhang Q, Shen J. 2018. Antimicrobial resistance in Campylobacter spp. Microbiol Spectr 6:10.1128/microbiolspec.ARBA-0013-2017. doi: 10.1128/microbiolspec.ARBA-0013-2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Fiedler S, Bender JK, Klare I, Halbedel S, Grohmann E, Szewzyk U, Werner G. 2016. Tigecycline resistance in clinical isolates of Enterococcus faecium is mediated by an upregulation of plasmid-encoded tetracycline determinants tet(L) and tet(M). J Antimicrob Chemother 71:871–881. doi: 10.1093/jac/dkv420. [DOI] [PubMed] [Google Scholar]
  • 30.Rodríguez-Baño J, Gutiérrez-Gutiérrez B, Machuca I, Pascual A. 2018. Treatment of infections caused by extended-spectrum-beta-lactamase-, AmpC-, and carbapenemase-producing Enterobacteriaceae. Clin Microbiol Rev 31:e00079-17. doi: 10.1128/CMR.00079-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yao H, Qin S, Chen S, Shen J, Du X-D. 2018. Emergence of carbapenem-resistant hypervirulent Klebsiella pneumoniae. Lancet Infect Dis 18:25. doi: 10.1016/S1473-3099(17)30628-X. [DOI] [PubMed] [Google Scholar]
  • 32.Clinical and Laboratory Standards Institute. 2008. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals: approved standard M31-A3. Clinical and Laboratory Standards Institute, Wayne, PA, USA. [Google Scholar]
  • 33.Schwaiger K, Harms K, Hölzel C, Meyer K, Karl M, Bauer J. 2009. Tetracycline in liquid manure selects for co-occurrence of the resistance genes tet(M) and tet(L) in Enterococcus faecalis. Vet Microbiol 139:386–392. doi: 10.1016/j.vetmic.2009.06.005. [DOI] [PubMed] [Google Scholar]
  • 34.Bachoual R, Ouabdesselam S, Mory F, Lascols C, Soussy CJ, Tankovic J. 2001. Single or double mutational alterations of gyrA associated with fluoroquinolone resistance in Campylobacter jejuni and Campylobacter coli. Microb Drug Resist 7:257–261. doi: 10.1089/10766290152652800. [DOI] [PubMed] [Google Scholar]
  • 35.Wang Y, Taylor DE. 1990. Natural transformation in Campylobacter species. J Bacteriol 172:949–955. doi: 10.1128/jb.172.2.949-955.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1
AAC.01622-20-s0001.pdf (129.9KB, pdf)

Data Availability Statement

The sequence described in this study has been deposited at GenBank under accession number MT663352.


Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES