Bronchial Epithelial Tet2 Maintains Epithelial Integrity during Acute Pseudomonas aeruginosa Pneumonia

Respiratory epithelial cells are important for pulmonary innate immune responses during Pseudomonas aeruginosa infection. Tet methylcytosine dioxygenase 2 (Tet2) has been implicated in the regulation of host defense by myeloid and lymphoid cells, but whether Tet2 also contributes to epithelial responses during pneumonia is unknown. The aim of this study was to investigate the role of bronchial epithelial Tet2 in acute pneumonia caused by P. aeruginosa. To this end, we crossed mice with Tet2 flanked by two Lox-P sites (Tet2^fl/fl mice) with mice expressing Cre recombinase under the bronchial epithelial cell-specific Cc10 promoter (Cc10^Cre mice) to generate bronchial epithelial cell-specific Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice.

ABSTRACT

Respiratory epithelial cells are important for pulmonary innate immune responses during Pseudomonas aeruginosa infection. Tet methylcytosine dioxygenase 2 (Tet2) has been implicated in the regulation of host defense by myeloid and lymphoid cells, but whether Tet2 also contributes to epithelial responses during pneumonia is unknown. The aim of this study was to investigate the role of bronchial epithelial Tet2 in acute pneumonia caused by P. aeruginosa. To this end, we crossed mice with Tet2 flanked by two Lox-P sites (Tet2^fl/fl mice) with mice expressing Cre recombinase under the bronchial epithelial cell-specific Cc10 promoter (Cc10^Cre mice) to generate bronchial epithelial cell-specific Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice. Six hours after infection with P. aeruginosa, Tet2^fl/fl Cc10^Cre and wild-type mice had similar bacterial loads in bronchoalveolar lavage fluid (BALF). At this time point, Tet2^fl/fl Cc10^Cre mice displayed reduced mRNA levels of the chemokines Cxcl1, Cxcl2, and Ccl20 in bronchial brushes. However, Cxcl1, Cxcl2, and Ccl20 protein levels and leukocyte recruitment in BALF were not different between groups. Tet2^fl/fl Cc10^Cre mice had increased protein levels in BALF after infection, indicating a disturbed epithelial barrier function, which was corroborated by reduced mRNA expression of tight junction protein 1 and occludin in bronchial brushes. Differences detected between Tet2^fl/fl Cc10^Cre and wild-type mice were no longer present at 24 h after infection. These results suggest that bronchial epithelial Tet2 contributes to maintaining epithelial integrity by enhancing intracellular connections between epithelial cells during the early phase of P. aeruginosa pneumonia.

INTRODUCTION

Pseudomonas aeruginosa is a common cause of nosocomial infections and one of the most common causative pathogens in hospital-acquired pneumonia (1). P. aeruginosa infections usually occur in patients with a compromised host defense (2). Its increasing multidrug resistance has placed this microbe on the WHO priority pathogens list for the development of new antibiotics to treat infections (3).

DNA methylation is one of the most studied epigenetic processes regulating gene expression. During infection, host immune and nonimmune cells initiate robust transcriptional reprogramming, and this response is tightly regulated by complex intracellular mechanisms, including DNA methylation, which is considered to repress gene expression (4). Tet methylcytosine dioxygenase 2 (Tet2) is one of the key enzymes mediating demethylation of DNA, catalyzing the conversion of the modified genomic base 5-methylcytosine into 5-hydroxymethylcytosine, which is subsequently oxidized to 5-formylcytosine and further converted into 5-carboxylcytosine. The higher oxidized forms of methylated cytosine can be turned back to unmodified cytosine by thymine DNA glycosylase and base excision repair, which is the major contributing mechanism for active DNA demethylation (5). Tet2-regulated DNA methylation is strongly involved in regulating immune responses in multiple cell types after infection by bacteria or stimulation with bacterial components (6, 7). In addition, there is increasing evidence indicating that Tet2 regulates host immune responses during infection independent of an effect on DNA methylation (6, 8, 9). While these studies clearly implicate Tet2 as a mediator of innate immunity during infection, its role in pulmonary host defense during pneumonia has not been studied.

Bronchial epithelial cells represent the first line of defense in the lower airways and act as sentinels in lung immunity (10). These cells are continuously in contact with the outer environment and are the first to encounter potential pathogens in the respiratory tract. Bronchial epithelial cells not only form a physical barrier that prevents the entry and transmission of pathogens to deeper tissues but also orchestrate and regulate pulmonary immune responses mediated by leukocytes via producing soluble mediators such as chemoattractant cytokines (11). Epithelial cells express multiple pattern recognition receptors like Toll-like receptors (TLRs) that sense pathogen-associated molecular patterns produced by invading bacteria (12, 13). We and others previously showed that respiratory epithelial cells are strongly activated by P. aeruginosa and required for eliminating this pathogen from the airways (14–17). While the role of Tet2 in regulating immune responses elicited by bacterial infections has been explored extensively in myeloid and lymphoid cells (4, 6, 9, 18), whether Tet2 has a function in regulating the responsiveness of the bronchial epithelium to P. aeruginosa remains elusive. To determine the role of Tet2 in bronchial epithelial cell-mediated pulmonary defense against P. aeruginosa, we induced acute pneumonia in bronchial epithelial cell-specific Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice and their wild-type (Tet2^fl/fl) littermates by inoculation of viable P. aeruginosa via the airways.

RESULTS

Tet2 deficiency in bronchial epithelial cells does not impact bacterial loads.

We generated bronchial epithelial cell-specific Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice by crossing homozygous Tet2^fl/fl mice (19) with Cc10^Cre mice (20). Our laboratory previously showed that Cre activity is detected exclusively in bronchioles of Cc10^Cre mice (20). To evaluate the efficiency of Tet2 deletion in bronchial epithelial cells of Tet2^fl/fl Cc10^Cre mice, we performed quantitative reverse transcription-PCR (qRT-PCR) on RNA isolated from bronchial brushes. The pan-epithelial cell marker Epcam and (especially) the club cell marker Scgb1a1 were highly expressed in bronchial brush samples, while the hematopoietic cell marker Ptprc was barely detected (Fig. 1A), suggesting that the brushes were strongly enriched for bronchial epithelial cells. Additionally, the expression of Epcam and Scgb1a1 was comparable in bronchial brushes collected from either Tet2^fl/fl mice or from Tet2^fl/fl Cc10^Cre mice (Fig. 1B), indicating that Tet2 deficiency from bronchial epithelial cells does not affect the development of club cells. Tet2 expression was significantly reduced in brushes from Tet2^fl/fl Cc10^Cre mice compared to that in brushes from Cre-negative control mice (Fig. 1C). To further check the specificity and efficiency of Tet2 deletion, we did immunohistochemistry staining of Tet2 protein of lung tissues of uninfected Tet2^fl/fl Cc10^Cre and Tet2^fl/fl mice. Tet2 staining in bronchial epithelial cells was much lower in Tet2^fl/fl Cc10^Cre mice than in wild-type littermates, while the Tet2 expression in alveolar epithelial cells was not altered (see Fig. S1 in the supplemental material). These results strongly suggest efficient and specific deletion of Tet2 in bronchial epithelial cells. To obtain a first insight into the role of Tet2 in pulmonary defense against P. aeruginosa infection, we quantified the bacterial burden in the alveolar space 6 h after inoculation and showed similar CFU counts in Tet2^fl/fl Cc10^Cre and Tet2^fl/fl mice (Fig. 1D). Pseudomonas was not detected in blood or distant organs, which is consistent with earlier reports that this model is not associated with bacterial dissemination when the same bacterial dose is used (17, 21). These data suggest that epithelial Tet2 is not necessary for epithelium-derived antibacterial defense in the lung.

FIG 1.

Tet2 deficiency in bronchial epithelial cells does not impact antibacterial defense. (A to C) RNA was isolated from bronchial brushes, cDNA was synthesized for qPCR, and all results were normalized to Hprt mRNA. (A) mRNA expression of hematopoietic cell marker Ptprc, pan-epithelial cell marker Epcam, and club cell marker Scgb1a1. (B) mRNA expression of pan-epithelial cell marker Epcam and club cell marker Scgb1a1 in the bronchial brushes of wild-type (Tet2^fl/fl) and bronchial epithelial Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice. (C) mRNA expression of Tet2 in bronchial brushes of wild-type (Tet2^fl/fl) and bronchial epithelial Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice. (D) Bacterial loads in bronchoalveolar lavage fluid (BALF) of wild-type and bronchial epithelial Tet2-deficient mice infected with P. aeruginosa 6 h earlier. Black bars, wild type (Tet2^fl/fl) mice; open bars, bronchial epithelial Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice. Data are means ± standard errors of the mean (SEM), n = 16 per group. **, P < 0.01 (Mann-Whitney test).

Bronchial epithelial Tet2 deficiency reduces chemokine mRNA expression in bronchial brushes during Pseudomonas pneumonia but does not affect pulmonary inflammatory responses.

Respiratory epithelial cells act as sentinels and sense invading pathogens to initiate and regulate innate immune responses largely through releasing soluble factors (10). To understand the potential role of Tet2 herein, we measured the mRNA expression of Cxcl1, Cxcl2, and Ccl20, of which epithelial cells are a major source (10, 11), in bronchial brushes obtained 6 h after infection with P. aeruginosa. mRNA expression of all three chemokines was significantly reduced in brushes from Tet2^fl/fl Cc10^Cre mice compared to that in brushes from Tet2^fl/fl control mice (Fig. 2A). mRNA levels of interleukin 1β (IL-1β), IL-6, and tumor necrosis factor alpha (TNF-α) in bronchial epithelial cells were not altered by Tet2 deficiency (Fig. S2), ruling out a more global effect of epithelial Tet2 deficiency. Notably, however, Cxcl1, Cxcl2, and Ccl20 protein levels in bronchoalveolar lavage fluid (BALF) were not different between mouse strains (Fig. 2B). Likewise, IL-1β, IL-6, and TNF-α levels were similar in BALF from Tet2^fl/fl Cc10^Cre and Tet2^fl/fl mice (Fig. 2C). Leukocytes are recruited to inflamed tissues to eliminate bacteria during infection. Both macrophages and neutrophils are required for effective bacterial clearance during P. aeruginosa infection (22). In agreement with similar chemokine and cytokine levels in BALF, total cell counts, as well as macrophage and neutrophil numbers, did not differ in BALF harvested from Tet2^fl/fl Cc10^Cre and Tet2^fl/fl mice 6 h after infection (Fig. 3A). Similarly, BALF levels of myeloperoxidase (Mpo), a neutrophil degranulation product, were comparable in Tet2^fl/fl Cc10^Cre and Tet2^fl/fl mice (Fig. 3B). Taken together, these data suggest that bronchial epithelial Tet2 does not impact local chemokine production, cytokine release, or leukocyte recruitment during acute P. aeruginosa pneumonia.

FIG 2.

Tet2 deficiency in bronchial epithelial cells reduces chemokine mRNA expression in bronchial brushes during Pseudomonas pneumonia but does not affect pulmonary inflammatory responses. (A) RNA was isolated from bronchial brushes collected from uninfected mice (naive) or mice infected with P. aeruginosa 6 h earlier; cDNA was synthesized for RT-qPCR to measure mRNA expression of Cxcl1, Cxcl2, and Ccl20; all results were normalized to Hprt mRNA. (B and C) Bronchoalveolar lavage fluid (BALF) was collected from mice infected with P. aeruginosa 6 h earlier; Cxcl1, Cxcl2, and Ccl20 (B) and IL-1β, IL-6, and TNF-α (C) were quantified by ELISA. Black bars, wild-type (Tet2^fl/fl) mice; open bars, bronchial epithelial Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice. Data are means ± SEM, n = 16 for P. aeruginosa-infected mice, n = 3 for uninfected mice (naive mice). *, P < 0.05 (Mann-Whitney test).

FIG 3.

Tet2 deficiency in bronchial epithelial cells does not impact leukocyte influx during Pseudomonas pneumonia. Bronchoalveolar lavage fluid (BALF) was collected from mice infected with P. aeruginosa 6 h earlier. (A) Total cell counts, macrophage counts, and neutrophil counts; (B) myeloperoxidase (Mpo) levels. Black bars, wild-type (Tet2^fl/fl) mice; open bars, bronchial epithelial Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice. Data are means ± SEM, n = 16 per group. Differences between groups were not significant.

Bronchial epithelial Tet2 deficiency impairs lung epithelial barrier integrity.

One of the major functions of respiratory epithelial cells is to form a physical barrier that maintains lung integrity. However, P. aeruginosa can damage the lung epithelium by inducing epithelial cell death and/or disturbing intercellular connections (23–25). To evaluate the potential effects of epithelial Tet2 deficiency on lung barrier function, we measured total protein concentrations in BALF, which is well linked to lung leakage and epithelium damage (26), harvested 6 h after infection with P. aeruginosa via the airways. Protein concentrations were significantly higher in BALF from Tet2^fl/fl Cc10^Cre mice than in BALF from control mice (Fig. 4A), suggesting that epithelial Tet2 plays a role in maintaining lung epithelial integrity. We hypothesized that the intercellular connections between epithelial cells were differentially regulated after epithelial Tet2 deletion. To test this, we measured the expression of major barrier function-related genes in bronchial brushes. Expression of the genes Tjp1 and Ocln, but not Tjp2 and Cdh1, were significantly downregulated in P. aeruginosa-infected Tet2^fl/fl Cc10^Cre mice relative to control mice (Fig. 4B). Tjp1 and Ocln code for tight junction protein 1 and occludin, respectively, which are key components of the tight junctions located at the apical side of the epithelium (27). Importantly, neither total protein concentrations in BALF nor the expression of barrier function-related genes in the bronchial epithelial cells in uninfected mice was affected by epithelial cell-specific Tet2 deficiency (Fig. S3). Taken together, these results suggest that bronchial epithelial Tet2 maintains epithelial integrity via transcriptional regulation of the intercellular connections between epithelial cells during P. aeruginosa infection.

FIG 4.

Tet2 deficiency in bronchial epithelial cells impairs lung integrity. (A) Bronchoalveolar lavage fluid (BALF) was collected from mice infected with P. aeruginosa 6 h earlier; total protein concentrations were measured. (B) RNA was isolated from bronchial brushes collected from mice infected with P. aeruginosa 6 h earlier; cDNA was synthesized for RT-qPCR to measure mRNA expression of tight junction protein 1 (Tjp1), Tjp2, occludin (Ocln), and cadherin 1 (Cdh1); all results were normalized to Hprt mRNA. Black bars, wild-type (Tet2^fl/fl) mice; open bars, bronchial epithelial Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice. Data are means ± SEM, n = 16 per group. *, P < 0.05; **, P < 0.01 (Mann-Whitney test).

Bronchial epithelial Tet2 deficiency does not affect pulmonary immune responses or lung epithelial barrier integrity at a later phase of P. aeruginosa infection.

To examine the role of Tet2 in lung defense at a later stage of P. aeruginosa infection, we infected Tet2^fl/fl Cc10^Cre and control mice with strain PAO1 for 24 h. Unlike at the early stage of infection (6 h), epithelial cell-specific Tet2 deficiency did not impact Cxcl1, Cxcl2, or Ccl20 mRNA levels in bronchial brushes at this late phase of infection (Fig. 5A). Additional analyses of BALF harvested at 24 h postinfection showed similar responses in Tet2^fl/fl Cc10^Cre and control mice with regard to protein levels of these chemokines, neutrophil recruitment, and Mpo and cytokine concentrations (Fig. 5B to E). In addition, unlike differences detected at 6 h after infection, at 24 h the expression of mRNAs encoding tight junction proteins in bronchial brushes as well as total protein levels in BALF was not different between Tet2^fl/fl Cc10^Cre and control mice (Fig. 5F and G). Bacterial loads in BALF were low in both mouse strains and not different between groups (Fig. 5H). Bacterial cultures of blood and distant organs (spleen, liver) remained sterile in both groups at this time point. Taken together, epithelial Tet2 deficiency does not impact the late phase of pulmonary responses during P. aeruginosa infection.

FIG 5.

Tet2 deficiency in bronchial epithelial cells does not affect pulmonary immune responses or epithelial barrier integrity during the later phase of P. aeruginosa infection. (A) RNA was isolated from bronchial brushes collected from mice infected with P. aeruginosa 24 h earlier; cDNA was synthesized for RT-qPCR to measure mRNA expression of Cxcl1, Cxcl2, and Ccl20; all results were normalized to Hprt mRNA. (B to F) Bronchoalveolar lavage fluid (BALF) was collected from mice infected with P. aeruginosa 24 h earlier. Cxcl1, Cxcl2, and Ccl20 (B), neutrophil influx (C), Mpo production (D), IL-1β and TNF-α (E), and total protein concentration (F) were quantified. (G) mRNA expression of tight junction protein 1 (Tjp1), Tjp2, occludin (Ocln), and cadherin 1 (Cdh1) in bronchial brushes from mice infected with P. aeruginosa for 24 h were detected by qPCR; all results were normalized to Hprt mRNA. (H) Bacterial loads in BALF of wild-type and bronchial epithelial Tet2-deficient mice infected with P. aeruginosa 24 h earlier. Black bars, wild-type (Tet2^fl/fl) mice; open bars, bronchial epithelial Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice. Data are means ± SEM, n = 8. Differences between groups were not significant.

DISCUSSION

Epithelial cells are the sentinels in the lung that initiate and regulate pulmonary responses against bacterial pathogens and form a physical barrier to prevent bacterial invasion and dissemination (11). The role of Tet2 in the reprogramming of myeloid and lymphoid cells induced by infection has been well studied (6, 7, 18, 28). In this study, we explored the role of Tet2 in bronchial epithelial cells during pneumonia induced by acute P. aeruginosa infection. We here show that deficiency of Tet2 in bronchial epithelial cells reduced mRNA expression of tight junction protein 1 and occludin in bronchial brushes, which was associated with perturbed barrier function at the early stage of P. aeruginosa pneumonia. In addition, while bronchial epithelial Tet2 deficiency reduced expression of Cxcl1, Cxcl2, and Ccl20 in bronchial brushes, it did not influence lung inflammatory responses or bacterial clearance during P. aeruginosa pneumonia.

Respiratory epithelial cells are required for adequate host defense during P. aeruginosa infection. Indeed, several previous studies documented the role of proinflammatory signaling in the respiratory epithelium in the clearance of Pseudomonas from the airways (14–17). Epithelial cells are a major cellular source for Cxcl1 and Cxcl2, which are important for recruiting neutrophils to the bronchoalveolar space (29). Inflammatory cytokines and chemokines produced by macrophages are negatively regulated by Tet2, whose deletion leads to enhanced Cxcl1 and Cxcl2 expression (8). In contrast, our data suggest that deficiency of Tet2 in epithelial cells has an opposite effect, as indicated by decreased expression of Cxcl1, Cxcl2, and Ccl20 in bronchial brushes from Tet2^fl/fl Cc10^Cre mice relative to brushes from control mice upon infection with P. aeruginosa. While the function of Tet2 as a methylcytosine dioxygenase regulating DNA methylation has been well documented (30), recent studies have shown that Tet2 can regulate gene expression in both DNA methylation-dependent and -independent manners (6, 18). In macrophages and dendritic cells, Tet2 deficiency increased lipopolysaccharide-induced expression of proinflammatory cytokines through histone deacetylase-mediated histone deacetylation (6, 31); thus far, investigations linking altered DNA (de)methylation in Tet2-deficient macrophages to modified cytokine production have not been reported. However, several studies showed that the expression of genes encoding inflammatory cytokines and chemokines in epithelial cells may be regulated by DNA methylation levels at their regulatory regions. Promoter hypomethylation of the TLR2 gene in cystic fibrosis bronchial epithelium is associated with an increased proinflammatory response induced by stimulation of the TLR2 pathway (32). Furthermore, inhibition of DNA methylation achieved by pretreatment with the DNA methyltransferase inhibitor 5-azacytidine increased CXCL1 and CCL20 production by epithelial cells (33, 34). Therefore, our data suggest that epithelial Tet2 may regulate epithelial chemokine expression possibly through an effect on DNA methylation. DNA methylation levels in isolated bronchial epithelial cells should be evaluated to address this hypothesis.

Leukocyte recruitment to the site of infection is important for the clearance of P. aeruginosa (1, 35). This process is promoted by chemotactic factors produced by epithelial cells and alveolar macrophages after sensing the invading microbe (10). Although epithelial Tet2 depletion led to downregulation of the genes encoding the chemokines Cxcl1, Cxcl2, and Ccl20 in bronchial epithelial cells, corresponding protein concentrations in BALF were not changed, which consequently resulted in an unaltered neutrophil recruitment. Likely, other cellular sources like macrophages and neutrophils compensated for the reduced epithelial cell chemokine expression in Tet2^fl/fl Cc10^Cre mice. Considering the eminent role of neutrophils in lung inflammation and in eliminating P. aeruginosa (36), these data collectively explain that epithelial Tet2 deficiency did not influence these responses.

The barrier formed by epithelial cells provides the first line of defense preventing bacterial invasion (23). P. aeruginosa interacts with epithelium at sites of multicellular junctions (37), disrupting these through virulence factors such as type III toxins, leading to bacterial transmigration across polarized airway epithelial monolayers and lung injury (23, 38–42). Tets have been documented to regulate tight junctions in intestinal epithelial cells. Tet1 deficiency in intestinal epithelial cells broke barrier junctions and increased intestinal permeability (43), while Tet2 deficiency in these cells had no effect on intestinal permeability (44). However, our data showed that bronchial epithelial Tet2 deficiency decreased the expression of Tjp1 and Ocln and increased protein leakage into the alveolar space at the early phase of P. aeruginosa infection, indicating that Tet2 contributes to maintaining intracellular connections between bronchial epithelial cells during bacterial infection. The epithelium provides a physical barrier that limits bacterial dissemination from the lungs to extrapulmonary organs. However, the model used is not associated with the spread of Pseudomonas outside the lungs in wild-type mice and therefore is less suitable to study the impact of reduced barrier function (17, 21), although one can conclude that the epithelial defect in Tet2^fl/fl Cc10^Cre mice does not result in bacterial dissemination.

In summary, this study showed for the first time a functional role of Tet2 in bronchial epithelial cells during airway infection. Bronchial epithelial Tet2 deficiency during P. aeruginosa-induced acute pneumonia was associated with reduced epithelial expression of genes encoding chemokines and junction proteins and an impaired epithelial barrier function. The role of Tet2 was transient, as indicated by the fact that differences between mice with or without bronchial epithelial Tet2 deficiency were no longer present during late-stage infection. Taken together with earlier investigations reporting enhanced expression of genes encoding proinflammatory proteins in Tet2-deficient myeloid cells (6), these results provide new insight into possible cell-specific functions of Tet2 during early-stage bacterial infection.

MATERIALS AND METHODS

Animals.

Homozygous Tet2^fl/fl mice (19) were crossed with Cc10^Cre mice (20) (Jackson Laboratory, Bar Harbor, ME) to generate bronchial epithelial cell-specific Tet2-deficient (Tet2^fl/fl Cc10^Cre) mice. Tet2^fl/fl Cre-negative littermates were used as controls in all experiments. We previously showed that Cre activity is detected exclusively in bronchioles of Cc10^Cre mice (20). All genetically modified mice were backcrossed at least eight times to a C57BL/6 background and age and sex matched when used in experiments. Mice were used at 8 to 12 weeks of age. All mouse experiments were approved by the Institutional Animal Care and Use Committee of the University of Amsterdam.

Induction of pneumonia and sampling of organs.

Pneumonia was induced by intranasal inoculation with a nonlethal dose of P. aeruginosa PAO1 at 5 × 10⁶ CFU (17). Mice were euthanized 6 or 24 h after infection by injection anesthesia with ketamine/medetomidine and heart puncture (16 per group for the 6-h experiment; 8 per group for the 24-h experiment) as described before (17). For bronchoalveolar lavage (BAL), the trachea was exposed through a midline incision; after cannulation of the trachea and occlusion of the left main bronchus with suture thread, lavage of the right lung was performed by instilling 2 times of 0.5 ml of sterile phosphate-buffered saline (PBS). Bronchial brushing was performed to collect epithelial cells as described previously (45) and stored in RA1 cell lysis buffer (Bioke, Leiden, The Netherlands) for RNA isolation. The numbers of CFU in BAL fluid (BALF) were determined by serial dilutions and plating on blood agar plates. BALF was spun down at 500 × g for 10 min at 4°C, and pelleted cells were resuspended in cold PBS; supernatants were stored at – 80°C until use. Total cell counts in BALF were determined using a hemocytometer (Beckman Coulter, Fullerton, CA).

Flow cytometry.

Differential cell counts in BALF were determined by flow cytometry as described previously (46). Briefly, BALF cells were resuspended FACS buffer (5% bovine serum albumin [BSA], 0.35 mM EDTA, 0.01% NaN₃). Cell staining was performed according to the manufacturer’s recommendations using eFluor 780 fixable viability dye, rat anti-mouse CD16/CD32 (clone 93), rat anti-mouse CD45 phycoerythrin (PE)-eFluor610 (30-F11), hamster anti-mouse CD11c peridinin chlorophyll protein (PerCP)-Cy5-5 (clone HL3), rat anti-mouse CD11b PE-Cy7 (clone M1/70), rat anti-mouse Siglec-F Alexa Fluor 647 (clone E50-2440), rat anti-mouse Ly-6C Alexa Fluor 700 (clone AL-21) (all from BD Biosciences), and rat anti-mouse Ly-6G fluorescein isothiocyanate (FITC) (clone 1A8; Biolegend, San Diego, CA). Flow cytometry was performed using a FACSCanto II (Becton, Dickinson, Franklin Lakes, NJ), and data were analyzed using FlowJo software (Becton, Dickinson, Franklin Lakes, NJ). The gating strategy is showed in Fig. S4 in the supplemental material. Macrophages were defined as CD45⁺ SiglecF⁺ CD11c⁺; neutrophils were defined as CD45⁺ Ly6G⁺.

Assays.

Murine C-X-C motif ligand 1 (Cxcl1), Cxcl2, C-C motif ligand 20 (Ccl20), interleukin 1β (IL-1β), IL-6, tumor necrosis factor alpha (TNF-α), and myeloperoxidase (Mpo) were measured by specific ELISAs (R&D Systems, Minneapolis, MN) according to the manufacturer’s description. Total protein was measured using a bicinchoninic acid (BCA) protein assay kit (ThermoFisher Scientific, Waltham, MA).

qRT-PCR.

Quantitative reverse transcription-PCR (qRT-PCR) was performed and reported according to the MIQE guidelines (47). Total RNA from mouse bronchial brushes was isolated with NucleoSpin columns (Bioke, Leiden, The Netherlands) according to the manufacturer’s recommendations. All RNA samples were quantified by spectrophotometry and stored at –80°C until further analysis. cDNA was prepared using avian myeloblastosis virus (AMV) reverse transcriptase (Promega, Leiden, The Netherlands) according to the manufacturer’s instructions. Expression of barrier function-related and epithelial cell-derived chemokine genes was analyzed using a Roche LightCycler 480 with a SensiFAST real-time PCR kit (Bioline, London, UK). The cell composition of bronchial brushes was assessed by measuring the expression of Epcam (Cd326, pan-epithelial cell marker) and Scgb1a1 (Cc10, marker for cube cells); cube cells represent the major epithelial cell type in the murine airway from the trachea down to terminal bronchioles (10). Expression of Ptprc (Cd45, pan-leukocyte marker) was used as a control. Data were analyzed with LinRegPCR based on PCR efficiency values derived from amplification curves (48). Hprt expression was used as an endogenous control for normalization. All primers are listed in Table 1.

TABLE 1.

Primers used for qRT-PCR

Gene	Forward primer	Reverse primer
Hprt	AGTCAAGGGCATATCCAACA	CAAACTTTGCTTTCCGGGT
Cxcl1	CCACTGCACCCAAACCGAAG	TCCGTTACTTGGGGACACCT
Cxcl2	CACTCTCAAGGGCGGTCAA	TCTTTGGTTCTTCCGTTGAGG
Ccl20	AGACAGATGGCCGATGAAGC	CTGCTTTGGATCAGCGCACA
Ptprc	TCCCCACTGTTTTGTTTACTCTTAC	ACACACGCCACATAAGCAAAG
Epcam	GTCCGAAGAACCGACAAGGA	TGATGGTCGTAGGGGCTTTC
Scgb1a1	CAGACACCAAAGCCTCCAAC	ATCCTGGGCAGATGTCCGAA
Tet2	AGCTGATGGAAAATGCAAGC	AAGGTGCCTCTGGAGTGTTG

IHC staining.

Immunohistochemistry (IHC) staining was performed as previously described (49). Briefly, lung tissues from uninfected mice were fixed in formalin and embedded in paraffin. Lung tissues were then cut into 4-μm sections, stained with primary mouse anti-Tet2 monoclonal antibody (ab94580; Abcam Cambridge, MA), and visualized with 3,3-diaminobenzidine (DAB; Immunologic, Duiven, Netherlands); hematoxylin was applied as a counterstain.

Statistical analysis.

All statistical analyses were performed using GraphPad Prism 8 software (GraphPad Software, San Diego, CA). Significance was evaluated using two-tailed unpaired t tests or Mann-Whitney U tests where appropriate. Results with a P value of less than 0.05 were considered significant. Data from the 6-h time point were pooled from two independent experiments.