Skip to main content
NCBI home page
Frontiers in Microbiology logoLink to Frontiers in Microbiology
. 2021 Feb 18;12:634555. doi: 10.3389/fmicb.2021.634555

Direct Detection of Viable but Non-culturable (VBNC) Salmonella in Real Food System by a Rapid and Accurate PMA-CPA Technique

Aifen Ou 1,†, Kan Wang 2,†, Yanrui Ye 3, Ling Chen 4, Xiangjun Gong 5, Lu Qian 5,*, Junyan Liu 6,*
PMCID: PMC7930388  PMID: 33679667

Abstract

Salmonella enterica is a typical foodborne pathogen with multiple toxic effects, including invasiveness, endotoxins, and enterotoxins. Viable but nonculturable (VBNC) is a type of dormant form preserving the vitality of microorganisms, but it cannot be cultured by traditional laboratory techniques. The aim of this study is to develop a propidium monoazide-crossing priming amplification (PMA-CPA) method that can successfully detect S. enterica rapidly with high sensitivity and can identify VBNC cells in food samples. Five primers (4s, 5a, 2a/1s, 2a, and 3a) were specially designed for recognizing the specific invA gene. The specificity of the CPA assay was tested by 20 different bacterial strains, including 2 standard S. enterica and 18 non-S. enterica bacteria strains covering Gram-negative and Gram-positive isolates. Except for the two standard S. enterica ATCC14028 and ATCC29629, all strains showed negative results. Moreover, PMA-CPA can detect the VBNC cells both in pure culture and three types of food samples with significant color change. In conclusion, the PMA-CPA assay was successfully applied on detecting S. enterica in VBNC state from food samples.

Keywords: Salmonella enterica, viable but non-culturable (VBNC), crossing priming amplification (CPA), propidium monoazide (PMA), rapid detection

Introduction

During food processing, food is frequently contaminated by foodborne bacteria, including Staphylococcus aureus, Salmonella enterica, and Escherichia coli O157 (Kirk et al., 2015; Miao et al., 2017a; Sharma et al., 2019). S. enterica is a typical foodborne pathogen with multiple toxic effects, including invasiveness, endotoxins, and enterotoxins (Eng et al., 2015). Various serotypes of Salmonella are implicated in foodborne infections and contaminate food products, including eggs, milk, poultry, meat, and vegetables. It is the main cause of human gastrointestinal and other related diseases (Bao et al., 2017a, b; Wen et al., 2020). Recently, studies confirmed that S. enterica is capable of entering into the viable but non-culturable state (VBNC) state under an adverse environment, which could include low-temperature, salt stress, and nutrient starvation (Roszak et al., 1984; Chmielewski and Frank, 1995; Gupte et al., 2003; Zeng et al., 2013; Morishige et al., 2017; Highmore et al., 2018). VBNC cells cannot be detected by traditional culture-based methods (Xu et al., 2011a; Lin et al., 2017; Miao et al., 2017a; Xie et al., 2017a). Therefore, it is urgent to develop a rapid and sensitive assay to detect S. enterica, especially in the VBNC state.

The molecular biological method, classified into polymerase chain reaction (PCR) and isothermal amplification, is a new strategy to detect pathogens (Xu et al., 2012; Xu et al., 2012a; Liu et al., 2019). PCR and PCR-based assays have been well developed in the last few decades (You et al., 2012; Zhong et al., 2013; Xu et al., 2016c). However, these assays require complicated procedures that may increase the uncertainty in result determination (Tada et al., 1992; Zhong et al., 2013; Xu et al., 2017a; Xie et al., 2017b; Jia et al., 2018). Quantitative real-time PCR can achieve the result interpretation by digital curve without electrophoresis but with lower detection limits (Xu et al., 2007; Miao et al., 2017b, c). Isothermal amplification assays include loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), and strand displacement amplification (SDA) (Fire and Xu, 1995; Zhao et al., 2009; Zhao et al., 2010a, b; Bao et al., 2017c; Xu et al., 2017b). Reverse transcription LAMP (RT-LAMP) or other isothermal amplification assays have been utilized to replace the PCR assay (Parida et al., 2005).

Cross Priming Amplification (CPA) is a novel isothermal method relying on five primers (2a/1s, 2a, 3a, 4s, and 5a) to amply the target nucleotide sequences (Xu et al., 2012). It does not require any special instrumentation and presents high rapidity, specificity, and sensitivity. Recently, CPA assays have been used for the detection of E. coli O157:H7, Listeria monocytogenes, Enterobacter sakazakii, Yersinia enterocolitica, and other pathogens (Wang et al., 2014; Zhang et al., 2015; Wang et al., 2018; Xu et al., 2020). Therefore, CPA is a potentially valuable tool for the rapid detection of foodborne pathogens, and the combination of propidium monoazide (PMA) may achieve the detection of VBNC state (Xu et al., 2010; Wang et al., 2011; Xu et al., 2011c).

Materials and Methods

Bacterial Strains

To standardize and evaluate the reaction system of CPA assay, non-S. enterica bacteria strains, including various species of Gram-negative and Gram-positive non-target strains, were used in this study (Table 1). Two standard S. enterica ATCC14028 and ATCC29629 were used as positive controls. All strains used in this study had been preliminarily identified in the Lab of Clinical Microbiology, Zhongshan Supervision Testing Institute of Quality and Metrology.

TABLE 1.

Reference strains and results of CPA assays.

Reference strain PCR CPA
Salmonella enterica ATCC29629 + +
Salmonella enterica ATCC14028 + +
Listeria monocytogenes ATCC19114 − −
Listeria monocytogenes ATCC19116 − −
Listeria monocytogenes ATCC19113 − −
Escherichia coli O157:H7 ATCC43895 − −
Escherichia coli O157:H7 E019 − −
Escherichia coli O157:H7 E020 − −
Escherichia coli O157:H7 E043 − −
Vibrio parahaemolyticus ATCC27969 − −
Vibrio parahaemolyticus ATCC17802 − −
Pseudomonas aeruginosa ATCC27853 − −
Pseudomonas aeruginosa C9 − −
Pseudomonas aeruginosa C40 − −
Staphylococcus aureus ATCC23235 − −
Staphylococcus aureus 10085 − −
Staphylococcus aureus 10071 − −
Lactobacillus casei − −
Lactobacillus acetotolerans BM-LA14527 − −
Lactobacillus plantarum BM-LP14723 − −
Open in a new tab

All bacteria were prepared for genomic DNA isolation after incubation in trypticase soy broth (TSB, Huankai Microbial, China) at 37°C at 200 rpm overnight. The genomic DNA was isolated by Bacterial DNA extraction Kit (Dongsheng Biotech, Guangzhou, China) according to the manufacturer’s protocol. The concentration and quality of the DNA were measured using Nano Drop 2000 (Thermo Fisher Scientific Inc., Waltham, MA, United States) at 260 and 280 nm. The isolated DNA was stored at −20°C for further use.

CPA Detection System Design

As a species specific gene in Salmonella, invA has been selected, and its specificity in Salmonella has been previously confirmed. The CPA primers were specifically designed for invA gene in S. enterica using Primer Premier 5, including five primers recognizing five distinct regions in the gene open reading frame sequence (Table 2). All primers were assessed for specificity by BLAST against the sequences in Genebank.

TABLE 2.

Primers sequence for detection of CPA.

Target gene Primers Sequence (5′–3′)
invA 4s CTGAGCGATAACAGCATT
5a TGCGTTACCCAGAAATAC
2a/1s TGATGATAGGTCGTTGGATGCGTGGTAAATTATTCGG
2a TGATGATAGGTCGTTGGAT
3a GCCAAAGGAAGCGACTTC
Open in a new tab

The PCR reaction was conducted to serve as a control in a total 25 μL volume with 12.5 μL 2× Taq PCR Master Mix (Dongsheng Biotech, Guangzhou, China), 3 μM each of forward and reverse primers, 2 μL of DNA template and the total volume was added up to 25 μL with nuclease-free water. The amplification procedure included a 5-min denaturation at 95°C, 32 cycles of amplification at 95°C for 30 s, 52°C 30 s, 72°C for 35 s, and final amplification at 72°C for 5 min. The PCR products were detected by electrophoresis on 1.5% agarose gels.

The CPA reaction system was performed using thermostatic equipment or a water bath in a 26 μL system, containing 20 mM Tris–HCl, 10 mM (NH4)2SO4, 10 mM KCl, 8.0 mM MgSO4, 0.1% Tween 20, 0.7 M betain (sigma), 1.4 mM dNTP (each), 8 U Bst DNA polymerase (NEB, United States), 1.0 μM primer of 2a/1s, 0.5 μM (each) primer of 2a and 3a, 0.6 μM (each) primer of 4s and 5a, 1 μL mixture chromogenic agent (mixture with calcein and Mn2+), 1 μL template DNA, and a volume of up to 26 μL of nuclease-free water. The mixed chromogenic agent consists of 0.13 mM calcein and 15.6 mM MnCl2⋅4H2O. And mixed reaction solution was incubated at 65°C for 60 min and heated at 80°C for 2 min to terminate the reaction. Nuclease-free water substituted target DNA was used as a negative control. Subsequently, the amplified products were analyzed by electrophoresis on 1.5% agarose gels and observed the color change by naked eyes.

CPA Detection System Optimization

The specificity of CPA was evaluated by amplifying the genomic DNA extracted from 2 standard S. enterica strains and 18 non-S. enterica strains.

To determine the sensitivity of the CPA assay, serial 10-fold dilutions of the genomic DNA of S. enterica ATCC14280 were prepared and used in the reaction. The sensitivity of the CPA method was compared with the PCR method. All the tests were performed in triplicate.

Application of CPA Assay in Food Products

The application of CPA assay in the detection of S. enterica was conducted in three rice products (Cantonese rice cake, steamed bread, and rice noodle purchased from Guangzhou Restaurant, Guangzhou, China). Different concentrations (from 108 CFU/mL to 10 CFU/mL) of S. enterica ATCC14028 were applied to contaminate food samples. Subsequently, genomic DNA was extracted from the contaminated food samples and subjected to CPA and PCR methods in triplicate (Xu et al., 2020).

VBNC State Induction

The VBNC state of S. enterica was induced by oligotrophic medium (sterile saline) at a low temperature. The bacterial overnight culture (∼108 CFU/mL) was washed three times and resuspended by sterile saline and then stored at −20°C. The culturable cell number was measured by plate counting method, and viable cells were determined by LIVE/DEAD® BacLight kitTM (ThermoFisher scientific, United States) with a fluorescence microscope after the cells were no longer culturable. The culturable and viable cell enumerations were performed every three days.

PMA-CPA Detection System

The PMA-CPA were developed to detect the VBNC cells of S. enterica with the observation of color change. The PMA-CPA was further applied in the detection of VBNC cells in contaminated rice food products (Cantonese rice cake, steamed bread, and rice noodle from Guangzhou Restaurant, Guangzhou, China).

Results

Development of CPA Assay

The CPA assays for the detection of invA gene were set up using S. enterica ATCC14028. The products were analyzed by 1.5% agarose gel electrophoresis, and the bands were observed under UV light (Figure 1A). The results of electrophoresis revealed that the amplicons of CPA are of various sizes, showing as a ladder pattern on agarose gel instead of a single band. The fluorescent dye (MgCl2 and calcein) changes the reaction system from orange to green in the reaction system (Figure 1B).

FIGURE 1.

FIGURE 1

Open in a new tab

Amplification products were visually detected both by 1.5% agarose gel electrophoresis under UV light (A) and observation at the color change by naked eye (B). M, DNA marker; lane 1, positive control; lane NC, negative products (A); tube 1, positive products; tube NC, negative control.

The evaluation of the specificity of CPA assay was performed in 2 S. enterica strains and 18 non-S. enterica reference strains. Results were recorded by 1.5% agarose gel electrophoresis and color change. Ladder pattern bands and orange to yellow color changes were only observed in the 2 S. enterica strains (Figure 2). It indicated that only the target S. enterica strains were detected with positive results, showing the high specificity of the CPA assay.

FIGURE 2.

FIGURE 2

Open in a new tab

Specificity of CPA assay for detection S. enterica strains with invA genes by 1.5% agarose gel electrophoresis and observation at the color change by naked eye; M-DNA marker; lane 1–2, S. enterica ATCC 29629 and ATCC 14028; lane 2–20, non-S. enterica strains. NG/21, negative control.

Detection of S. enterica in Food Products

The CPA assays were applied in the detection of S. enterica in three food samples (Cantonese rice cake, steamed bread, and rice noodle). The homogenized rice products (9 mL) were inoculated with 1 mL 10-fold serial dilution of pure S. enterica culture. The concentration of artificial contamination food samples ranging from 108 CFU/mL to 10 CFU/mL with 10-fold series dilutions was applied. All three food samples were included for the application. As expected, the LOD shows an insignificant difference among food samples, and the results are identical. Only the samples with a concentration higher than 103 CFU/mL were able to be detected (Figure 3). Thus, the detection limit of the CPA assay was 103 CFU/mL.

FIGURE 3.

FIGURE 3

Open in a new tab

Sensitivity of the CPA assay in food samples of S. enterica with invA genes by 1.5% agarose gel electrophoresis (A) and agent mixture (B); M-DNA marker; lane 1–8, 107 CFU/mL, 106 CFU/mL, 105 CFU/mL, 104 CFU/mL, 103 CFU/mL, 102 CFU/mL, 10 CFU/mL negative control.

Detection of VBNC Cells by PMA-CPA Assay

The PMA-CPA assay was established using VBNC cells of S. enterica. The PMA dye was added to either pure culture or flour samples with a final concentration of 5 μg/mL. After incubation at room temperature for 10 min in dark, the samples were exposed to a 650 W halogen lamp with a distance of 15 cm for 5 min, which inactivates unbinding PMA molecules rather than PMA-DNA molecules. All the dying process was performed in an ice bath to prevent DNA damage. Results showed that PMA-CPA can detect the VBNC cells both in pure culture and food samples with significant color change from orange to yellow (Figure 4). The samples with dead cells remain orange in both pure culture and food samples.

FIGURE 4.

FIGURE 4

Open in a new tab

Detection of VBNC state of S. enterica in pure cultures and food samples by PMA-CPA assay with observation at the color change by naked eye. 1 – VBNC cells in pure cultures; 2 – dead cells in pure cultures; 3 – VBNC cells in food samples; 4 – dead cells in food samples.

Discussion

Salmonella enterica is a common foodborne pathogen that may cause serve illness. The generation of S. enterica VBNC state occurs during the chlorination of wastewater or food (Oliver et al., 2005; Zeng et al., 2013). Non-ionic detergents and sanitizers can also induce S. enterica into VBNC state (Morishige et al., 2013; Purevdorj-Gage et al., 2018; Robben et al., 2018). Furthermore, a multi-stress environment in complex components of food and storage conditions may induce the VBNC state formation of foodborne pathogens (Lin et al., 2016; Miao et al., 2016; Xu et al., 2016a,b).

Various molecular techniques have been developed to identify microbes. PCR is a mature method to detect foodborne microbes, but it has low sensitivity and complex variable temperature programs (Kim et al., 1999). RT-PCR has been used to detect microbes compared with the method in ISO 21872-1:2007. RT-PCR achieved higher sensitivity but with long pre-enrichment and 24 h of complicate procedure. Although RT-PCR is able to show results via a digital curve, the sensitivity of this method is limited and the procedure is complicated (Xu et al., 2008a; Miao et al., 2018; Xu et al., 2018; Zhao et al., 2018a,b). RT-LAMP or other isothermal amplification has been used reported to replace RT-PCR to increase the detection limit (Xu et al., 2008b; Xu et al., 2009; Liu et al., 2018a,b; Lv et al., 2020). However, sophisticated equipment with these technologies has brought certain difficulties to rapid on-site testing (Xu et al., 2011b; Xu et al., 2012b). CPA technique is a new strategy to achieve rapid detection and can be performed under constant temperature using a simple water bath. Furthermore, with the improvement of fluorescence dye, results can be identified by the color change in the reaction tube by the naked eye. For VBNC and dead cells, they are both nonculturable. However, VBNC cells differ from dead cells in their intact cell membrane and thus could be differentiated via PMA, which is capable of differentiating viable and dead cells.

Therefore, the developed CPA method can successfully detect the S. enterica with high rapidity and sensitivity and can identify the VBNC cells in food samples when combining with PMA.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Author Contributions

JL conceived of the study and participated in its design and coordination. AO and KW performed the experimental work and collected the data. YY and XG organized the database. LC and LQ performed the statistical analysis. AO wrote the manuscripts. All authors contributed to manuscript revision, read, and approved the submitted manuscript.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Footnotes

Funding. This work was supported by the National Key Research and Development Program of China (2016YFD04012021).

References

  1. Bao X. R., Jia X. Y., Chen L. Q., Peters B. M., Lin C. W., Chen D. Q., et al. (2017c). Effect of Polymyxin Resistance (pmr) on Biofilm Formation of Cronobacter sakazakii. Microb. Pathog. 106 16–19. [DOI] [PubMed] [Google Scholar]
  2. Bao X. R., Yang L., Chen L. Q., Li B., Li L., Li Y. Y., et al. (2017b). Analysis on pathogenic and virulent characteristics of the Cronobacter sakazakii strain BAA-894 by whole genome sequencing and its demonstration in basic biology science. Microb. Pathog. 109 280–286. [DOI] [PubMed] [Google Scholar]
  3. Bao X. R., Yang L., Chen L. Q., Li B., Li L., Li Y. Y., et al. (2017a). Virulent and pathogenic features on the Cronobacter sakazakii polymyxin resistant pmr mutant strain s-3. Microb. Pathog. 110 359–364. [DOI] [PubMed] [Google Scholar]
  4. Chmielewski R. A., Frank J. F. (1995). Formation of viable but nonculturable Salmonella during starvation in chemically defined solutions. Lett. Appl. Microbiol. 20 380–384. [DOI] [PubMed] [Google Scholar]
  5. Eng S.-K., Pusparajah P., Ab Mutalib N.-S., Ser H.-L., Chan K.-G., Lee L.-H. (2015). Salmonella: a review on pathogenesis, epidemiology and antibiotic resistance. Front. Life Sci. 8:284–293. 10.1080/21553769.2015.1051243 [DOI] [Google Scholar]
  6. Fire A., Xu S. Q. (1995). Rolling replication of short DNA circles. Proc. Natl. Acad. Sci. U.S.A. 92 4641–4645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Gupte A. R., de Rezende C. L. E., Joseph S. W. (2003). Induction and resuscitation of viable but nonculturable Salmonella enterica serovar typhimurium DT104. Appl. Environ. Microbiol. 69 6669–6675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Highmore C. J., Warner J. C., Rothwell S. D., Wilks S. A., Keevil C. W. (2018). Viable-but-nonculturable Listeria monocytogenes and Salmonella enterica serovar thompson induced by chlorine stress remain infectious. mBio 9:e540–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Jia X. Y., Hua J. J., Liu L., Xu Z. B., Li Y. Y. (2018). Phenotypic characterization of pathogenic Cronobacter spp. strains. Microb. Pathog. 121 232–237. [DOI] [PubMed] [Google Scholar]
  10. Kim Y. B., Okuda J., Matsumoto C., Takahashi N., Hashimoto S., Nishibuchi M. (1999). Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR gene. J. Clin. Microbiol. 37:1173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kirk M. D., Pires S. M., Black R. E., Caipo M., Crump J. A., Devleesschauwer B., et al. (2015). World health organization estimates of the global and regional disease burden of 22 foodborne bacterial, protozoal, and viral diseases, 2010: a data synthesis. PLoS Med. 12:e1001921. 10.1371/journal.pmed.1001921 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kusumoto A., Asakura H., Kawamoto K. (2012). General stress sigma factor RpoS influences time required to enter the viable but non-culturable state in Salmonella enterica. Microbiol. Immunol. 56 228–237. [DOI] [PubMed] [Google Scholar]
  13. Lin S. Q., Li L., Li B., Zhang X. H., Lin C. W., Deng Y., et al. (2016). Development and evaluation of quantitative detection of N-epsilon-carboxymethyl-lysine in Staphylococcus aureus biofilm by LC-MS method. Basic Clin. Pharmacol. Toxicol. 118:33. [Google Scholar]
  14. Lin S. Q., Yang L., Chen G., Li B., Chen D. Q., Li L., et al. (2017). Pathogenic features and characteristics of food borne pathogens biofilm: Biomass, viability and matrix. Microb. Pathog. 111 285–291. [DOI] [PubMed] [Google Scholar]
  15. Liu L., Ye C., Soteyome T., Zhao X., Harro J. M. (2019). Inhibitory effects of two types of food additives on biofilm formation by foodborne pathogens. MicrobiologyOpen 8:e00853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Liu L. Y., Lu Z. R., Li L., Li B., Zhang X., Zhang X. M., et al. (2018a). Physical relation and mechanism of ultrasonic bactericidal activity on pathogenic E. coli with WPI. Microb. Pathog. 117 73–79. [DOI] [PubMed] [Google Scholar]
  17. Liu L. Y., Xu R. R., Li L., Li B., Zhang X., Zhang X. M., et al. (2018b). Correlation and in vitro mechanism of bactericidal activity on E. coli with whey protein isolate during ultrasonic treatment. Microb. Pathog. 115 154–158. [DOI] [PubMed] [Google Scholar]
  18. Lv X., Wang L., Zhang J., Zeng H., Chen X., Shi L., et al. (2020). Rapid and sensitive detection of VBNC Escherichia coli O157: H7 in beef by PMAxx and real-time LAMP. Food Control 115:107292. [Google Scholar]
  19. Miao J., Chen L. Q., Wang J. W., Wang W. X., Chen D. Q., Li L., et al. (2017a). Evaluation and application of molecular genotyping on nosocomial pathogen-methicillin-resistant Staphylococcus aureus isolates in Guangzhou representative of Southern China. Microb. Pathog. 107 397–403. [DOI] [PubMed] [Google Scholar]
  20. Miao J., Chen L. Q., Wang J. W., Wang W. X., Chen D. Q., Li L., et al. (2017c). Current methodologies on genotyping for nosocomial pathogen methicillin-resistant Staphylococcus aureus (MRSA). Microb. Pathog. 107 17–28. [DOI] [PubMed] [Google Scholar]
  21. Miao J., Liang Y., Chen L., Wang W., Wang J., Li B., et al. (2017a). Formation and development of Staphylococcus biofilm: with focus on food safety. J. Food Safety 37:e12358. [Google Scholar]
  22. Miao J., Liang Y. R., Chen L. Q., Wang W. X., Wang J. W., Li B., et al. (2017b). Formation and development of Staphylococcus biofilm: With focus on food safety. J. Food Safety 7:e12358. [Google Scholar]
  23. Miao J., Peters B. M., Li L., Li B., Zhao X. H., Xu Z. B., et al. (2016). Evaluation of ERIC-PCR for fingerprinting methicillin-resistant staphylococcus aureus strains. Basic Clin. Pharmacol. Toxicol. 118:33. [Google Scholar]
  24. Miao J., Wang W. X., Xu W. Y., Su J. Y., Li L., Li B., et al. (2018). The fingerprint mapping and genotyping systems application on methicillin-resistant Staphylococcus aureus. Microb. Pathog. 125 246–251. [DOI] [PubMed] [Google Scholar]
  25. Morishige Y., Fujimori K., Amano F. (2013). Differential resuscitative effect of pyruvate and its analogues on VBNC (viable but non-culturable) Salmonella. Microb. Environ. 28 180–186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Morishige Y., Koike A., Tamura-Ueyama A., Amano F. (2017). Induction of viable but nonculturable Salmonella in exponentially grown cells by exposure to a low-humidity environment and their resuscitation by catalase. J. Food Prot. 80 288–294. [DOI] [PubMed] [Google Scholar]
  27. Oliver J. D., Dagher M., Linden K. (2005). Induction of Escherichia coli and Salmonella typhimurium into the viable but nonculturable state following chlorination of wastewater. J. Water Health 3 249–257. [DOI] [PubMed] [Google Scholar]
  28. Parida M., Horioke K., Ishida H., Dash P. K., Saxena P., Jana A. M., et al. (2005). Rapid detection and differentiation of dengue virus serotypes by a real-time reverse transcription-loop-mediated isothermal amplification assay. J. Clin. Microbiol. 43:2895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Purevdorj-Gage L., Nixon B., Bodine K., Xu Q., Doerrler W. T. (2018). Differential effect of food sanitizers on formation of viable but nonculturable Salmonella enterica in poultry. J. Food Protect. 81 386–393. [DOI] [PubMed] [Google Scholar]
  30. Robben C., Fister S., Witte A. K., Schoder D., Rossmanith P., Mester P. (2018). Induction of the viable but non-culturable state in bacterial pathogens by household cleaners and inorganic salts. Sci. Rep. 8:15132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Roszak D. B., Grimes D. J., Colwell R. R. (1984). Viable but nonrecoverable stage of Salmonella enteritidis in aquatic systems. Can. J Microbiol. 30 334–338. [DOI] [PubMed] [Google Scholar]
  32. Sharma J., Kumar D., Hussain S., Pathak A., Shukla M., Prasanna Kumar V., et al. (2019). Prevalence, antimicrobial resistance and virulence genes characterization of nontyphoidal Salmonella isolated from retail chicken meat shops in Northern India. Food Control 102 104–111. [Google Scholar]
  33. Tada J., Ohashi T., Nishimura N., Shirasaki Y., Ozaki H., Fukushima S., et al. (1992). Detection of the thermostable direct hemolysin gene (tdh) and the thermostable direct hemolysin-related hemolysin gene (trh) of Vibrio parahaemolyticus by polymerase chain reaction. Mol. Cell. Probe. 6 477–487. [DOI] [PubMed] [Google Scholar]
  34. Wang L., Zhao X. H., Chu J., Li Y., Li Y. Y., Li C. H., et al. (2011). Application of an improved loop-mediated isothermal amplification detection of Vibrio parahaemolyticus from various seafood samples. African J. Microbiol. Res. 5 5765–5771. [Google Scholar]
  35. Wang Y., Wang Y., Ma A., Li D., Ye C. (2014). Rapid and sensitive detection of Listeria monocytogenes by cross-priming amplification of lmo0733 gene. FEMS Microbiol. Lett. 361 43–51. [DOI] [PubMed] [Google Scholar]
  36. Wang Y. X., Zhang A. Y., Yang Y. Q., Lei C. W., Cheng G. Y., Zou W. C., et al. (2018). Sensitive and rapid detection of Salmonella enterica serovar Indiana by cross-priming amplification. J. Microbiol. Methods 153 24–30. [DOI] [PubMed] [Google Scholar]
  37. Wen S. X., Feng D. H., Chen D. Q., Yang L., Xu Z. B. (2020). Molecular epidemiology and evolution of Haemophilus influenzae. Infect. Genet. Evol. 80:104205. [DOI] [PubMed] [Google Scholar]
  38. Xie J., Yang L., Peters B. M., Chen L., Chen D., Li B., et al. (2017a). A 16-year retrospective surveillance report on the pathogenic features and antimicrobial susceptibility of Pseudomonas aeruginosa isolated from Guangzhou representative of Southern China. Microb. Pathog. 110 37–41. [DOI] [PubMed] [Google Scholar]
  39. Xie J. H., Peters B. M., Li B., Li L., Yu G. C., Xu Z. B., et al. (2017b). Clinical features and antimicrobial resistance profiles of important Enterobacteriaceae pathogens in Guangzhou representative of Southern China, 2001-2015. Microb. Pathog. 107 206–211. [DOI] [PubMed] [Google Scholar]
  40. Xu G., Hu L., Zhong H., Wang H., Yusa S.-I., Weiss T. C., et al. (2012). Cross priming amplification: mechanism and optimization for isothermal DNA amplification. Sci. Rep. 2:246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Xu Z., Luo Y., Soteyome T., Lin C.-W., Xu X., Mao Y., et al. (2020). Rapid detection of food-borne Escherichia coli O157:H7 with visual inspection by crossing priming amplification (CPA). Food Anal. Methods 13 474–481. [Google Scholar]
  42. Xu Z. B., Gui Z. Y., Li L., Li B., Su J. Y., Zhao X. H., et al. (2012b). Expression and purification of gp41-gp36 Fusion protein and application in serological screening assay of HIV-1 and HIV-2. African J. Microbiol. Res. 6 6295–6299. [Google Scholar]
  43. Xu Z. B., Hou Y. C., Peters B. M., Chen D. Q., Li B., Li L. (2016b). Chromogenic media for MRSA diagnostics. Mol. Biol. Rep. 43 1205–1212. [DOI] [PubMed] [Google Scholar]
  44. Xu Z. B., Hou Y. C., Qin D., Liu X. C., Li B., Li L., et al. (2016a). Evaluation of current methodologies for rapid identification of methicillin-resistant staphylococcus aureus strains. Basic Clin. Pharmacol. Toxicol. 118:33. [Google Scholar]
  45. Xu Z. B., Li L., Alam M. J., Zhang L. Y., Yamasaki S., Shi L. (2008b). First confirmation of integron-bearing methicillin-resistant Staphylococcus aureus. Curr. Microbiol. 57 264–268. [DOI] [PubMed] [Google Scholar]
  46. Xu Z. B., Li L., Chu J., Peters B. M., Harris M. L., Li B., et al. (2012a). Development and application of loop-mediated isothermal amplification assays on rapid detection of various types of staphylococci strains. Food Res. Int. 47 166–173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Xu Z. B., Li L., Shi L., Shirliff M. E. (2011c). Class 1 integron in staphylococci. Mol. Biol. Rep. 38 5261–5279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Xu Z. B., Li L., Shirliff M. E., Peters B. M., Li B., Peng Y., et al. (2011b). Resistance class 1 integron in clinical methicillin-resistant Staphylococcus aureus strains in southern China, 2001-2006. Clin. Microbiol. Infect. 17 714–718. [DOI] [PubMed] [Google Scholar]
  49. Xu Z. B., Li L., Shirtliff M. E., Alam M. J., Yamasaki S., Shi L. (2009). Occurrence and characteristics of class 1 and 2 integrons in Pseudomonas aeruginosa Isolates from patients in Southern China. J. Clin. Microbiol. 47 230–234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Xu Z. B., Li L., Shirtliff M. E., Peters B. M., Peng Y., Alam M. J., et al. (2010). First report of class 2 integron in clinical Enterococcus faecalis and class 1 integron in Enterococcus faecium in South China. Diagn. Microbiol. Infect. Dis. 68 315–317. [DOI] [PubMed] [Google Scholar]
  51. Xu Z. B., Li L., Zhao X. H., Chu J., Li B., Shi L., et al. (2011a). Development and application of a novel multiplex polymerase chain reaction (PCR) assay for rapid detection of various types of staphylococci strains. African J. Microbiol. Res. 5 1869–1873. [Google Scholar]
  52. Xu Z. B., Liang Y. R., Lin S. Q., Chen D. Q., Li B., Li L., et al. (2016c). Crystal Violet and XTT assays on staphylococcus aureus biofilm quantification. Curr. Microbiol. 73 474–482. [DOI] [PubMed] [Google Scholar]
  53. Xu Z. B., Shi L., Alam M. J., Li L., Yamasaki S. (2008a). Integron-bearing methicillin-resistant coagulase-negative staphylococci in South China, 2001-2004. FEMS Microbiol. Lett. 278 223–230. [DOI] [PubMed] [Google Scholar]
  54. Xu Z. B., Shi L., Zhang C., Zhang L. Y., Li X. H., Cao Y. C., et al. (2007). Nosocomial infection caused by class 1 integron-carrying Staphylococcus aureus in a hospital in South China. Clin. Microbiol. Infect. 13 980–984. [DOI] [PubMed] [Google Scholar]
  55. Xu Z. B., Xie J. H., Peters B. M., Li B., Li L., Yu G. C., et al. (2017b). Longitudinal surveillance on antibiogram of important gram-positive pathogens in Southern China, 2001 to 2015. Microb. Pathog. 103 80–86. [DOI] [PubMed] [Google Scholar]
  56. Xu Z. B., Xie J. H., Yang L., Chen D. Q., Peters B. M., Shirtliff M. E. (2018). Complete sequence of pCY-CTX, a plasmid carrying a phage-like region and ISEcp1-mediated Tn2 element from Enterobacter cloacae. Microb. Drug Resist. 24 307–313. [DOI] [PubMed] [Google Scholar]
  57. Xu Z. B., Xu X. Y., Yang L., Li B., Li L., Li X. X., et al. (2017a). Effect of aminoglycosides on the pathogenic characteristics of microbiology. Microb. Pathog. 113 357–364. [DOI] [PubMed] [Google Scholar]
  58. You R., Gui Z. Y., Xu Z. B., Shirtliff M. E., Yu G. C., Zhao X. H., et al. (2012). Methicillin-resistance staphylococcus aureus detection by an improved rapid PCR assay. African J. Microbiol. Res. 6 7131–7133. [Google Scholar]
  59. Zeng B., Zhao G., Cao X., Yang Z., Wang C., Hou L. (2013). Formation and resuscitation of viable but nonculturable Salmonella typhi. BioMed. Res. Int. 2013:907170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zhang H., Feng S., Zhao Y., Wang S., Lu X. (2015). Detection of Yersinia enterocolitica in milk powders by cross-priming amplification combined with immunoblotting analysis. Int. J. Food Microbiol. 214 77–82. [DOI] [PubMed] [Google Scholar]
  61. Zhao X.,, Li Y., Wang L., You L., Xu* Z., Li L.,, et al. (2010a). Development and application of a loop-mediated isothermal amplification method on rapid detection Escherichia coli O157 strains from food samples. Mol. Biol. Rep. 37 2183–2188. 10.1007/s11033-009-9700-6 [DOI] [PubMed] [Google Scholar]
  62. Zhao X., Li Y., Chu J., Wang L., Shirtliff M. E., He X., et al. (2010b). Rapid detection of Vibrio parahaemolyticus strains and virulent factors by loop-mediated isothermal amplification assays. Food Sci. Biotechnol. 19 1191–1197. 10.1007/s10068-010-0170-3 [DOI] [Google Scholar]
  63. Zhao X., Wang L., Chu J., Li Y., Li L., Shirtliff M. E., He X., et al. (2009). Development and application of a rapid and simple loop-mediated isothermal amplification method for food-borne Salmonella detection. Food Sci. Biotechnol. 19 1655–1659. 10.1007/s10068-010-0234-4 [DOI] [Google Scholar]
  64. Zhao X. H., Li M., Xu Z. B. (2018b). Detection of foodborne pathogens by surface enhanced raman spectroscopy. Front. Microbiol. 9:1236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Zhao X. H., Yu Z. X., Xu Z. B. (2018a). Study the features of 57 confirmed CRISPR Loci in 38 strains of staphylococcus aureus. Front. Microbiol. 9:1591. 10.3389/fmicb.2018.01591 [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Zhong N. J., Gui Z. Y., Liu X., Huang J. R., Hu K., Gao X. Q., et al. (2013). Solvent-free enzymatic synthesis of 1, 3-Diacylglycerols by direct esterification of glycerol with saturated fatty acids. Lipids Health Dis. 12:65. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Articles from Frontiers in Microbiology are provided here courtesy of Frontiers Media SA

RESOURCES