Skip to main content
PLOS One logoLink to PLOS One
. 2021 Mar 4;16(3):e0247135. doi: 10.1371/journal.pone.0247135

Construction of engineered RuBisCO Kluyveromyces marxianus for a dual microbial bioethanol production system

Dung Minh Ha-Tran 1,2,3, Rou-Yin Lai 2, Trinh Thi My Nguyen 2, Eugene Huang 4, Shou-Chen Lo 2,*, Chieh-Chen Huang 2,5,*
Editor: Muhammad Aamer Mehmood6
PMCID: PMC7932148  PMID: 33661900

Abstract

Ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) genes play important roles in CO2 fixation and redox balancing in photosynthetic bacteria. In the present study, the kefir yeast Kluyveromyces marxianus 4G5 was used as host for the transformation of form I and form II RubisCO genes derived from the nonsulfur purple bacterium Rhodopseudomonas palustris using the Promoter-based Gene Assembly and Simultaneous Overexpression (PGASO) method. Hungateiclostridium thermocellum ATCC 27405, a well-known bacterium for its efficient solubilization of recalcitrant lignocellulosic biomass, was used to degrade Napier grass and rice straw to generate soluble fermentable sugars. The resultant Napier grass and rice straw broths were used as growth media for the engineered K. marxianus. In the dual microbial system, H. thermocellum degraded the biomass feedstock to produce both C5 and C6 sugars. As the bacterium only used hexose sugars, the remaining pentose sugars could be metabolized by K. marxianus to produce ethanol. The transformant RubisCO K. marxianus strains grew well in hydrolyzed Napier grass and rice straw broths and produced bioethanol more efficiently than the wild type. Therefore, these engineered K. marxianus strains could be used with H. thermocellum in a bacterium-yeast coculture system for ethanol production directly from biomass feedstocks.

Introduction

The thermotolerant yeast Kluyveromyces marxianus is a promising candidate for fuel ethanol production as it possesses several advantageous characteristics for biotechnological applications such as the faster growth rate relative to Kluyveromyces lactis [1] or Saccharomyces cerevisiae [2], the ability to assimilate a wide range of sugars [3], thermotolerance [46], secretion of lytic enzymes and the ability to produce ethanol at elevated temperatures [7]. Specifically, K. marxianus can grow on both hexoses and pentoses over a wide range of pH (pH 2.5–9), tolerate high temperature (up to 46°C) and toxin (furaldehyde) [8]. The tolerance of high temperature makes K. marxianus a good partner for co-culturing with other cellulolytic thermophilic microorganisms as the optimal temperatures for their growth in co-culture systems are not widely different. A wide range of carbon source utilization of K. marxianus leverages itself when co-culturing with a robust lignocellulose-degrading bacterium such as Hungateiclostridium thermocellum ATCC 27405 since the bacterium can only use cellodextrins, which are glucose polymers of various lengths (G2-G5), as its favored carbon sources. When lignocellulosic biomass is used as a feedstock, large amounts of pentose sugars (e.g., xylose, arabinose) remaining in the culture broths that cannot be used by H. thermocellum can be used as substrates by K. marxianus to produce valuable products [9]. In addition, weak glucose repression trait makes K. marxianus a good choice for mixed sugar medium like lignocellulose hydrolysate [10].

Ribulose 1,5 bis-phosphate carboxylase/oxygenase (RuBisCO, EC 4.1.1.39) is the key enzyme of the Calvin-Benson-Bassham cycle (CBB cycle), which is the most important mechanism of autotrophic CO2 fixation in nature [11]. In the first step of carbon fixation, RuBisCO catalyzes the addition of CO2 to ribulose-1,5-bisphosphate (RuBP), which is an intermediate of the pentose phosphate pathway (PPP), to form two molecules of 3-phosphoglycerate (3-PGA). The two resultant 3-PGA molecules can be converted to two molecules each of ethanol and CO2. Because of its important role, RuBisCO has been subjected to extensive studies, which included carbon assimilation to improve crop yield and investigation of the CO2 fixation pathways [1214]. In the nonsulfur purple bacterium Rhodopseudomonas palustris, the structural genes encoding the enzymes of the CBB cycle are organized into cbbI and cbbII operons [15]. Each operon contains genes encoding one of two distinct forms of RuBisCO. The genome of R. palustris consists of two active forms of RuBisCO. The form I RuBisCO includes cbbL (large subunit), cbbS (small subunit), cbbR (transcription regulator) and cbbRRS (atypical two-component systems) genes. The cbbL and cbbS genes are located at the distal end of the cbbI operon and the cbbRRS genes are found located between the cbbR and cbbLS genes. The form II RuBisCO comprises cbbM gene which is located at the distal end of the cbbII operon, followed by cbbA (fructose 1,6-bisphosphate aldolase), cbbT (transketolase), cbbP (phosphoribulokinase), and cbbF (fructose 1,6/sedoheptulose 1,7-bisphosphatase) genes. In the present study, the cbbL, cbbS, and cbbP genes were chosen to construct the form I RuBisCO cassette and the cbbM, cbbP genes were selected to construct the form II RuBisCO cassette to assemble into the K. marxianus 4G5 genome [16,17]. Form I RuBisCO is capable of fixing CO2 under CO2 limiting conditions and is responsible for providing cellular carbon [17]. This phenomenon is likely a response to carbon limitation and may be important for scavenging the low levels of dissolved CO2 to maintain cell growth. Form I RuBisCO has much higher affinity for CO2 over form II RuBisCO. The form II RuBisCO balances the intracellular redox potential under abundant carbon and electron conditions [18].

In a previous study, to enhance the CO2 fixation ability of R. palustris DH, Du et al. [19] transformed the recombinant plasmid pMG-CBBM carrying form II RuBisCO gene (cbbM) derived from R. palustris NO.7 into a R. palustris DH strain. More recently, Guadalupe-Medina et al. [20] transformed two genes encoding phosphoribulokinase (PRK) (derived from Spinacia oleracea) and form II RuBisCO (derived from Thiobacillus denitrificans) into the S. cerevisiae genome. The results showed a 90% reduction in glycerol production and a 10% increase in ethanol production in sugar-limited chemostat cultures using a mixture of glucose and galactose feed. In the study of Li et al. [13], a functional carbon dioxide-fixation pathway was constructed in S. cerevisiae cell to improve ethanol productivity via increasing the in-situ CO2 assimilation.

The present study sought to transform exogenous RuBisCO operons from R. palustris to the genome of K. marxianus for an improved CO2 utilization and a better intracellular redox balance. The wild-type (WT) K. marxianus 4G5 was used as the host cell for transforming form I RuBisCO and form II RuBisCO genes into its genome using the Promoter-based Gene Assembly and Simultaneous Overexpression (PGASO) method [21]. The inserted RuBisCO genes in the host genome were confirmed, the activities of RuBisCO genes at transcriptional and the specific enzyme activities were assessed. Moreover, the ability of the recombinant RuBisCO K. marxianus strains to grow on plant biomass broths or in the co-culture system with the cellulolytic bacterium H. thermocellum ATCC 27405 was also evaluated. Consequently, the RuBisCO K. marxianus strains exhibited their superiority in ethanol production over the WT. The results of this study could be applied for improving bioethanol production using plant biomass as feedstocks.

Materials and methods

Multiple-gene cassette construction

The PGASO method was developed to insert multiple exogenous genes into K. marxianus 4G5 genome [21]. Since the PGASO method was fundamentally based on site-specific homologous recombination, overhanging sequences were designed to link to the 5’-upstream sequence of a promoter, and to link to the 3’-downstream sequence of a terminator in order to facilitate an accurate gene cassette assembly into a host genome. Specifically, in the first gene cassette, a 1529 bp sequence, which is identical to the 3’ region of the K. lactis Lac4 promoter, was used as a promoter in the first gene cassette. In the last gene cassette, a 582 bp sequence, which is homologous to the 5’ region of K. lactis Lac4 promoter, was linked to the 3’ end of the terminator ScTTADHI. It is noteworthy that the identities between K. marxianus Lac4 promoter and K. lactis Lac4 promoter, at the 5’ region and at the 3’ region, are 99.8% and 97.9%, respectively. The other gene cassettes were constructed to contain two parts as follows: (1) a gene sequence, at its 5’ end, linked to a promoter, at its 3’ end, linked to a terminator, and (2) a 55 bp overhanging sequence at the 3’ end of the gene cassette that is homologous to a 5’ end of the promoter of its neighboring downstream gene cassette. Individual gene fragment of cbbL, cbbS, cbbM, and cbbP from the genome of R. palustris CGA009 were amplified by polymerase chain reaction (PCR). The amplified gene fragments cbbL, cbbS, cbbM, cbbP and G418 (kanamycin resistance gene) were then cloned into the predesignated cassette plasmids (Table 1) with their specific independent promoter and terminator as follows: ScPGapDH-cbbL-ScTTGap, KlPGapDH-G418-ScTTGap, KlPADHI-cbbS-ScTTGap, ScPADHI-cbbP-ScTTADHI, and KlPPGK-cbbM-ScTTPGK. Subsequently, gene cassettes for PGASO technique were amplified with KOD plus DNA polymerase kit (TOYOBO Biotech) with specific primers listed in the Table 1. The cloning procedure was performed using Escherichia coli strain DH5α cells and Luria-Bertani (LB) medium was used as a culture medium. The antibiotic ampicillin (50 μg/mL) was used to screen the cloned plasmids. The sizes of individual transgenes and gene cassettes were shown in the Table 2. In addition, specific primers for RT-qPCR were designed to confirm the transcriptional activities of the transgenes cbbS, cbbL, cbbM, and cbbP in the host cells. Importantly, to verify the sizes and the correct orders of the gene cassettes in their predesignated assemblage in the yeast genome, the combined gene cassettes were also amplified using PCR with the forward primer of the upstream gene cassette and the reverse primer of its adjacent downstream gene cassette (Table 1).

Table 1. Plasmids and primers used in the PGASO constructions and RT-qPCR experiments.

Plasmid Description
pUC18 Ampicillin resistant; multicopy plasmid with a ColE1 –type replicon
Cassette 1 pUC18-Kl PLac4 pUC18 derivative with a 1529 bp portion of Kluyveromyces lactis Lac4 promoter and K. lactis Lac4 terminator with a 55 bp sequence at 3’ end homologous to S. cerevisiae GapDH promoter
Cassette 2 pUC18-Sc PGapDH pUC18 derivative with S. cerevisiae GapDH promoter and TTGap terminator with a 55 bp sequence at 3’ end homologous to S. cerevisiae PGK promoter
Cassette 3 pUC18- Sc PPGK pUC18 derivative with S. cerevisiae PGK promoter and TTPGK terminator with a 55 bp sequence at 3’ end homologous to K. lactis GapDH promoter
Cassette 4 pUC18- Kl PGapDH pUC18 derivative with K. lactis GapDH promoter S. cerevisiae GapDH terminator with a 55 bp overhanging sequence at its 3’ region homologous to K. lactis PGK promoter
Cassette 5 pUC18-Kl PPGK pUC18 derivative with K. lactis PGK promoter and S. cerevisiae PGK terminator with a 55 bp sequence at 3’ end homologous to K. lactis ADHI promoter
Cassette 6 pUC18-Kl PADHI pUC18 derivative with K. lactis ADHI promoter and S. cerevisiae GapDH terminator with a 55 bp sequence at 3’ end homologous to S. cerevisiae ADHI promoter
Cassette 7 pUC18-Sc PADHI pUC18 derivative with S. cerevisiae ADHI promoter and ADHI terminator with a 582 bp sequence at 3’ end homologous to K. lactis Lac4 promoter
Cassette 2 pUC18-Sc PGapDH-cbbL Cassette 2 pUC18-Sc PGapDH derivative with cbbL
Cassette 6 pUC18-Kl PADHI-cbbS Cassette 6 pUC18-Kl PADHI derivative with cbbS
Cassette 5 pUC18-Kl PPGK-cbbM Cassette 5 pUC18-Kl PPGK derivative with cbbM
Cassette 7 pUC18-Sc PADHI-cbbP Cassette 7 pUC18-Sc PADHI derivative with cbbP
Cassette 4 pUC18- Kl PGapDH-G418 Cassette4 pUC18- KlPGapDH derivative with kanR from Lac4-KanMX cassette [21]
Cassette Primer Sequence
KlPLac4-KlTTLac4 KlPLac4-3’ 5’-CCGCGGGGATCGACTCATAAAATAG-3’
KlTTLac4_ScPGapDH 5’-CTACTATTAATTATTTACGTATTCTTTGAAATGGCAGTATTGATAATGATAAACTTATACAACATCGAAGAAGAGTCT-3’
ScPGapDH-cbbL-ScTTGapDH ScPGapDH 5’-AGTTTATCATTATCAATACTGCCAT-3’
ScTTGap_ScPGK 5’-GGACTCCAGCTTTTCCATTTGCCTTCGCGCTTGCCTGTACGGTCGTTACCATACTTGGCGGAAAAAATTCATTTGTAA-3’
ScPPGK-ScTTPGK ScPGK 5’- ACTGTAATTGCTTTTAGTTGTGTAT-3’
ScTTPGK_KlPGapDH 5’-GGACTCCAGCTTTTCCATTTGCCTTCGCGCTTGCCTGTACGGTCGTTACCATACTAAGCTTTTTCGAAACGCAGAATTTTCG-3’
KlPGapDH-G418-ScTTGapDH Kl-PGapDH 5’-AGTATGGTAACGACCGTACAGGCAA-3’
ScTTGap_KlPGK 5’-TACCTTTGATACCATAAAAACAAGCAAATATTCTTACTTCAAACACACCCGTGGCGGAAAAAATTCATTTGTAAACT-3’
KlPPGK-cbbM-ScTTPGK KlPGK 5’-CGGGTGTGTTTGAAGTAAGAATATT -3’
ScTTPGK_KlPADHI 5’-AGGTAAGTATGGTAACGACCGTACAGGCAAGCGCGAAGGCAAATGGAAAAGCTGGAAGCTTTTTCGAAACGCAGAATTTT-3’
KlPADHI-cbbS-ScTTGapDH KlPADHI 5’-CCAGCTTTTCCATTTGCCTTCGCGCTTGCC-3’
ScTTGap_ScPADHI 5’-GGAATCCCGATGTATGGGTTTGGTTGCCAGAAAAGAGGAAGTCCATATTGTACACTGGCGGAAAAAATTCATTTGTAA-3’
ScPADH1-cbbP-ScTTADH1 ScPADHI 5’-GTGTACAATATGGACTTCCTCTTTTC-3’
ScTTADHI_KlPLac4-5’End 5’-GAAATTTAGGAATTTTAAACTTG-3’
Primers used for cloning
Phosphorobulokinase (PRK) cbbP-F’ 5’-CCGCCTAGGATGTCCCGTAAGCATCCG-3’
cbbP-R’ 5’-CATGCCATGGTTACTTCATGCTTCGTTTGCGGTC-3’
Form I RuBisCO small subunit cbbS-F’ 5’-CCGCCTAGGATGCGACTGACCCAAGGC-3’
cbbS-R’ 5’-CATGCCATGGTCAGCCTCCGTAGCGTCG-3’
Form I RuBisCO large subunit cbbL-F’ 5’-CCGCCTAGGATGAACGAAGCAGTCACC-3’
cbbL-R’ 5’-CATGCCATGGTTAGACCGAGACCGACGG-3’
Form II RuBisCO cbbM-F’ 5’-CCGCCTAGGATGGACCAGTCGAACC-3’
cbbM-R’ 5’-CCTTAATTAATTACGCCGCCTGC-3’
Primers used for RT-qPCR
Phosphorobulokinase (PRK) r-cbbP-F’ 5’-GCCGATGAATCGATGGTGG-3’
r-cbbP-R’ 5’-TTCATGCTTCGTTTGCGGTC-3’
Form I RuBisCO small subunit r-cbbS-F’ 5’-TGACCCAAGGCTGTTTCTCG-3’
r-cbbS-R’ 5’-TTCAGTTCCATCATCACGCC-3’
Form I RuBisCO large subunit r-cbbL-F’ 5’-CCGGCGTGATGGAATACAAG-3’
r-cbbL-R’ 5’-ATACTTCTCCGCCGCAGTCA-3’
Form II RuBisCO r-cbbM-F’ 5’-ATGATCGCCTCGTTCCTGAC-3’
r-cbbM-R’ 5’-TTGATGATGGTGCCGACGAT-3’
Actin 4G5 actin F 5’-GGGCTTCGGTCAACAAAC-3’
4G5 actin R 5’-TGGTCGGTATGGGTCAAAAGG-3’
Primers to confirm gene cassettes order in K. marxianus genome
Cassette (1 + 2 cbbL) 1–2 F 5’-CCGCGGGGATCGACTCATAAAATAG-3’
1–2 R 5’-GGACTCCAGCTTTTCCATTTGCCTTCGCGCTTGCCTGTACGGTCGTTACCATACTTGGCGGAAAAAATTCATTTGTAA-3’
Cassette (2 cbbL + 3) 2–3 F 5’-AGTTTATCATTATCAATACTGCCAT-3’
2–3 R 5’-GGACTCCAGCTTTTCCATTTGCCTTCGCGCTTGCCTGTACGGTCGTTACCATACTAAGCTTTTTCGAAACGCAGAATTTTCG-3’
Cassette (3 + 4 G418) 3–4 F 5’- ACTGTAATTGCTTTTAGTTGTGTAT-3’
3–4 R 5’-TACCTTTGATACCATAAAAACAAGCAAATATTCTTACTTCAAACACACCCGTGGCGGAAAAAATTCATTTGTAAACT-3’
Cassette (4 G418 + 5) 4–5 F 5’-AGTATGGTAACGACCGTACAGGCAA-3’
4–5 R 5’-AGGTAAGTATGGTAACGACCGTACAGGCAAGCGCGAAGGCAAATGGAAAAGCTGGAAGCTTTTTCGAAACGCAGAATTTT-3’
Cassette (5 + 6 cbbS) 5–6 F 5’-CGGGTGTGTTTGAAGTAAGAATATT -3’
5–6 R 5’-GGAATCCCGATGTATGGGTTTGGTTGCCAGAAAAGAGGAAGTCCATATTGTACACTGGCGGAAAAAATTCATTTGTAA-3’
Cassette (6 cbbS + 7 cbbP) 6–7 F 5’-CCAGCTTTTCCATTTGCCTTCGCGCTTGCC-3’
6–7 R 5’-GAAATTTAGGAATTTTAAACTTG-3’

Table 2. Sizes of individual RuBisCO genes, gene cassettes used in the PGASO constructions.

Cassette Promoter-Terminator (bp) RubisCO gene (bp) Promoter-Gene-Terminator (bp) Primers
1 2347 - KlPLac4- KlTTLac4 (2347) F-KlPLac4-3’
R-KlTTLac4_ScPGapDH
2 1102 cbbL (1457) ScPGapDH-cbbL-ScTTGap (2559) F-ScPGapDH
R-ScTTGap_ScPGK
3 1294 - ScPPGK-ScTTPGK (1294) F-ScPGK
R-ScTTPGK_KlPGapDH
4 1145 G418 (810) KlPGapDH-G418-ScTTGap (1955) F-Kl-PGapDH
R-ScTTGap_KlPGK
5 1291 cbbM (1386) KlPPGK-cbbM-ScTTPGK (2677) F-KlPGK
R-ScTTPGK_KlPADHI
6 1301 cbbS (425) KlPADHI-cbbS-ScTTGap (1726) F-KlPADHI
R-ScTTGap_ScPADHI
7 2068 cbbP (876) ScPADHI-cbbP-ScTTADHI (2944) F-ScPADHI
R-ScTTADHI_KlPLac4-5’End

K. marxianus 4G5 transformation

For the transformation of foreign gene into K. marxianus genome, we followed the protocol described by Chang et al. [21]. Briefly, fifty μL of K. marxianus 4G5 strain was inoculated into a 20-mL flask having 5 mL of liquid YPD-20 medium, which contained in one liter the following: 10 g of yeast extract (MDBio, Inc, Taiwan), 20 g of peptone (BD), and 20 g of glucose (Showa, Japan). The flask was capped with foam stopper and incubated at 30°C and 200 rpm for 12–16 h. The target gene cassettes in a 5 μL volume with an equal molar ratio of each fragment were mixed with 40 μL of competent cells. The electroporation was carried out (1 kV, 400 Ω, 25 μF) using Gene Pluser Xcell TM Electroporation system (Bio-Rad, USA) with an aluminum cuvette (2 mm). The cells were spread onto YNBD (6.7 g of yeast nitrogen base without amino acids (Difco, USA) and 10 g of glucose in 1L) agar plates containing G418 (200 μg/mL). In the following culture experiments, YPD medium without glucose was called YPD-0, YPD medium with 8 g/L glucose was called YPD-8 and the standard YPD with 20 g/L glucose was named YPD-20.

Plant biomass substrates

One-year old Napier grass cultivated in Taiwan was used in this study and in our previous study, the composition of dried Napier grass contains 38% hemicellulose, 44% cellulose and 8% lignin [22]. Fresh Napier grass was collected from the field, and then dried in a Benchtop shaking incubator TS-1450 (Florida 33130, USA) at 65°C for 7 days. The leaves and stems were separately ground into a fine powder using a RT-N08 pulverizing machine (Taichung City, Taiwan) and then sieved through a 420-μm screen. The powders obtained from stems and leaves were mixed in the ratio of 1:1 (w/w) before the mixture was used in the experiments. Serum bottles were loaded with the substrates and autoclaved at 121°C for 20 min. Rice straw of TNG67 variety was kindly provided by Professor Chang-Sheng Wang, Department of Agronomy, National Chung Hsing University, Taiwan. According to Amnuaycheewa et al. [23], rice straw comprises 34.6% cellulose, 29.7% hemicellulose, 15.3% lignin and 10.0% ash. Rice straw was dried in the Benchtop shaking incubator TS-1450 (Florida 33130, USA) at 65°C for 3 days and then grown into fine powder. The powder was sieved through a 420-μm screen before use.

Culture medium

One liter of modified GS-2 medium contained 1.5 g KH2PO4, 2.9 g K2HPO4, 3 g sodium citrate tribasic dihydrate (Na3C6H5O7), 2.1 g urea, 5 g 3-(N-morpholino) propanesulfonic acid (MOPS), 2 mg resazurin, 1 g L-cysteine. A 100 mL of 10-fold trace salt solution contained 26 mg MgCl2, 11.3 mg CaCl2, 0.125 mg FeSO4·7H2O. A 100 mL of 100-fold vitamin solution contained 2 mg pyridoxine hydrochloride, 0.2 mg biotin, 0.4 mg p-aminobenzoic acid, and 0.2 mg vitamin B12 [24]. All solutions were prepared with distilled water obtained with an EcoQ Combo (LionBio, Taiwan). Trace salt and vitamin solutions were sterilized using 0.22-μm filter (StarTech, Taiwan). The pH of the GS-2 medium was adjusted to 7.2 using 5M NaOH and was purged extensively with pure nitrogen gas to create an anaerobic environment. Finally, GS-2 medium was autoclaved at 121°C for 20 min. To maintain an anaerobic environment during fermentation process, serum bottles were strictly sealed with butyl rubber stoppers and aluminum seals. The sterilized medium GS-2 was cooled to 50°C and aseptically supplemented with 1% (v/v) trace salt solution and 1% (v/v) vitamin solution.

Biomass fermentation broths

For inoculum preparation, H. thermocellum ATCC 27405 was grown in modified GS-2 medium supplemented with cellobiose (5 g/L) until the stationary phase (OD660 ~ 0.7) and then inoculated 1% (v/v) to modified GS-2 medium containing 100 g/L Napier grass or 100 g/L rice straw powder. Cells were grown in batch culture at 60°C in 250-mL serum bottles containing 100 mL of the modified GS-2 medium. At the end of the fermentation (6th day), the fermentation broths were filtered through filter paper (6 μm) (Advantec® No. 1 90 mm, Japan), and then centrifuged at 12,800 rpm for 10 min (Hermle Z326K, Germany) to remove the remaining substrate. The pH of the culture broth was adjusted to 7.0 with 2 M NaOH and the culture broth was sterilized using 0.22-μm filter (StarTech, Taiwan) before the addition of the K. marxianus inocula. Seed inocula of WT, form I RuBisCO and form II RuBisCO were prepared by culturing in YPD-8 medium (with 8 g/L glucose) for 24 h to reach OD660 ~ 1.1. One mL each of yeast culture was collected, centrifuged at 12,000 x g for 10 min at 4°C using a Hitachi Tabletop centrifuge CT15RE (Hitachi Koki Co., Ltd, Japan) to remove the supernatant. The pellet was washed twice with phosphate-buffered saline (PBS) solution to remove the background and then inoculated 1% (v/v) into Napier grass or rice straw medium. One liter of PBS solution contained 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, 0.24 g KH2PO4, 0.133 g CaCl2.2H2O, and 0.1 g MgCl2.6H2O. The semi-anaerobic batch culture was performed in a 250 mL-serum bottle with 100 mL Napier grass or rice straw broth at 37°C for 48 h.

Co-culture fermentation

H. thermocellum was grown in modified GS-2 medium supplemented with cellobiose (5 g/L) until the stationary phase was reached (OD660 ~ 0.7) and then inoculated 1% (v/v) into GS-2 medium containing 100 g/L Napier grass or 100 g/L rice straw powder. Cells were grown in batch culture at 60°C in 250-mL serum bottles containing 100 mL of the modified GS-2 medium. This was the first step for plant biomass solubilization and bioconversion using H. thermocellum ATCC 27405. After 144 h, the culture stopped producing H2 and CO2, indicating the end of metabolic activities. One day prior to the end of the H. thermocellum culture, seed inocula of K. marxianus strains WT, form I RuBisCO and form II RuBisCO were prepared by culturing in YPD-8 medium (with 8 g/L glucose) for 24 h to reach OD660 ~ 1.1. One mL each of the yeast cultures was collected, centrifuged at 12,800 x g for 10 min at 4°C using a Hitachi Tabletop centrifuge CT15RE (Hitachi Koki Co., Ltd, Japan) to remove the supernatant. The pellets were washed twice with phosphate-buffered saline (PBS) solution to remove the residual media components and then inoculated 1% (v/v) to Napier grass- or rice straw-containing serum bottles for the co-culture study. The temperature of co-culture system was decreased to 37°C to suit the growth temperature of K. marxianus. The co-culture process lasted for 48 h when 1 mL each of the fermentation broth was collected, centrifuged 12,800 x g for 10 min at 4°C, filtered with 0.22-μm filter (StarTech, Taiwan). The final ethanol concentration was measured by GC at the end of the fermentation process, CO2 production was measured every 24 h using GC Agilent 7890A (Agilent Technologies, USA).

Ethanol and gas measurement

The major fermentation end-products were determined by the GC Agilent 7890A equipped with a J&W 122–3232: 30 m x 250 μm x 0.25 μm DB-FFAP column, with a flame ionization detector (FID) for ethanol and a thermal conductivity detector (TCD) for CO2, with nitrogen as the carrier gas at a flow rate of 30 mL/min. For ethanol measurement, the front inlet was used, the detector was kept at 225°C and the oven operated from 50°C to 150°C, 50–100°C at a ramp rate of 30°C/min, and 100–150°C at a ramp rate of 20°C/min. For H2 and CO2 measurements, the back inlet was used, the detector was kept at 225°C and the oven operated isothermally at 50°C. In the calculations of the results, the weight of 1.84 mg/cm3 of CO2 at 25°C under standard atmospheric pressure and its molecular weight 44 g/mol were used.

Reducing sugar and protein measurement

The total reducing sugars remaining in biomass broths were measured using the 3,5-dinitrosalicylic acid (DNS) method (Miller, 1959) [25] in which the standard curve was prepared using 5-fold serial dilutions of a pure chemical sample. Protein in the broth culture supernatant was determined by the Bradford Assay with Coomassie Brilliant Blue G-250 (Merck KGaA, USA) and Bovine Serum Albumin (BSA) (Merck KGaA, USA) as the standard.

RT-qPCR analysis

The WT and RuBisCO strains were cultured in the YPD-8 medium for 12 h at 30°C, 200 rpm. One mL of each culture broth was collected, centrifuged at 5,000 rpm for 1 min. The supernatant was discarded, and 100 mL of the fresh YPD-8 medium was added to the Eppendorf tube to suspend the pellet. The tube was quickly immersed in liquid nitrogen for 3 s, and then transferred to the 37°C water bath B206-T1 (Firstek, Taiwan). This step was repeated 3 times to effectively break down the cell wall. One mL of TRIzol (R) Reagent was added to the Eppendorf tube and the total mRNA was isolated using RNAqueous™ Total RNA Isolation Kit (Thermo Fisher Scientific, USA) according to the instruction manual. DNA-freeTM kit (Ambion, Thermo Fisher Scientific, USA) was used to remove the contaminating DNA. Purified RNA was quantified at A260/A280 ratio using a Nano-100 Micro Spectrophotometer (Medclub Scientific Co., LTD, Taiwan). cDNA was synthesized using ImProm-IITM Reverse Transcription System (Promega, USA). RT-qPCR was performed using Corbett Research Rotor-Gene 3000 (Mortlake 2137, Australia) with FastStart Universial SYBR(R) Green Master (ROX) kit (Roche, USA). The thermal cycling program consisted of an activation step (95°C, 10 min) followed by 40 cycles of denaturing (95°C, 10 sec), annealing (60°C, 10 sec). The relative expression levels of the RuBisCO genes were normalized to that of the Actin gene and calculated using the 2−ΔΔCt method [26].

Activity assay of RubisCO

RuBisCO activity measurement was performed based on the continuous spectrophotometric rate determination method described in [14,27] with some modifications. The crude cell lysate was prepared using the glass bead lysis as described by Mukherjee et al. [28]. Briefly, the yeast strains were grown semi-anaerobically in 250-mL serum bottles containing YPD-8 medium for 12 h. Cells were harvested by centrifuging at 12,800 x g, 10 min at 4°C, washed twice with sterile distilled water, and then resuspended in 350 μL of lysis buffer containing 50 mM Tris-HCl buffer, pH 7.5, with 2 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride (PMSF), 0.1 mM DTT, 3 mM MgCl2, 10 mM NaCl. The cells in the glass bead tube were vortexed in a cyclomixer for 4 times at 2,500 rpm for 15 s each, immersing the cell suspension in ice for 15 s between 2 vortexing cycles. The cell suspension was centrifuged at 5,000 x g for 10 min at 4°C to collect the supernatant and the supernatant was used as the crude cell lysate for enzymatic assay. The reaction mixture containing cell lysate, 50 mM HEPES buffer (pH 8), 1 mM Ribulose 1,5-bisphosphate (RuBP), 20 mM MgCl2, 5 mM DTT, 20 mM NaHCO3, 5 mM ATP, 0.15 mM NADH, 5 U/mL 3-phosphoglycerate kinase, 6 U Glyceraldehyde 3-phosphate dehydrogenase was prepared. Specifically, 20 μL cell lysate was added to 180 μL of reaction mixture. To initiate the reaction, 7 μL of 33 mM RuBP was added to the reaction mixture to reach a final concentration of 1 mM. The absorbance at 340 nm (A340) was then recorded every 20 s for 30 min using Beckman Coulter—PARADIGM™ microplate reader (Beckman Coulter, USA) and the rate of decrease in A340 was then converted to the rate of NADH oxidation. RuBisCO activity was calculated from the rate of NADH oxidation. The millimolar extinction coefficient of NADH at 340 nm was used to determine the rate of NAD+ production. Total protein concentration in the cell-free extracts was measured by the Bradford protein assay (Bio-Rad Protein Assay).

Formula for RuBisCO enzyme activity calculation:

nmolmin1mgprotein1=(ΔA340/minTestΔA340/minBlank)xTotalvolumeofassay(mL)2x6.22x0.6xmgoflysateused(mg)
ΔA340:InitialA340FinalA340

2: 2 μmoles of β-NADH are oxidized for each μmole of D-Ribulose 1,5-diphosphate used.

6.22: Millimolar extinction coefficient (mmol-1 cm-1) for β-NADH at 340 nm.

0.6: Optical path length (cm) in an ELISA well with 200 μL reaction volume.

Statistical analysis

Analysis of variance (Anova) was performed in ethanol and gas measurement to verify the differences between K. marxianus WT and RuBisCO strains. The probability was set at p < 0.05 and each experiment was repeated three times. All data analyses and most of graphics were performed using R software (ver. 3.6.1). Some other graphics such as representative fermentation procedures were performed using CorelDRAW X7 version (Corel Corporation).

Results and discussion

Construction of form I and form II RuBisCO gene cassettes

Gene cassettes were designed using the method described in Materials and Methods. Each gene cassette contained a specific promoter and a terminator. Specifically, the form I RuBisCO cbbL gene fragment (2559 bp) was linked with promoter GapDH (glyceraldehyde 3-phosphate dehydrogenase gene from S. cerevisiae) in the gene cassette 2 ScPGapDH. The selection gene neomycin phosphotransferase G418 (1955 bp) essential for kanamycin resistance was linked with promoter GapDH (glyceraldehyde 3-phosphate dehydrogenase gene from K. lactis) in the gene cassette 4 KlPGapDH. Form I RuBisCO cbbS gene fragment (1726 bp) was linked with promoter ADHI (alcohol dehydrogenase gene from K. lactis) in the gene cassette 6 KlPADHI and gene encoding phosphoribulokinase (cbbP) gene fragment (2944 bp) was driven by promoter ADHI (alcohol dehydrogenase gene from S. cerevisiae) in the cassette 7 (Fig 1A). The PCR products of gene cassettes in the form I RuBisCO construction (Left panel) and the combined amplified gene cassettes (Right panel) were displayed in Fig 1B. Similarly, gene G418 fragment (1955 bp) was linked with promoter GapDH from K. lactis in the gene cassette 4 KlPGapDH and form II RuBisCO cbbM gene fragment (2267 bp) was driven by promoter PGK from K. lactis in the gene cassette 5 KlPGK. Finally, the phosphoribulokinase cbbP gene fragment (2948 bp) was driven by promoter ADHI from S. cerevisiae in the cassette 7 (Fig 1C). It should be noted that all the promoters used in the present study had approximately 40–55% sequence identity between each other in their 5’ end regions. In PGASO method, the low sequence identity of promoters is of importance in preventing the unexpected recombination events where multi-genes could be integrated into similar regions in the host genome. The PCR products of gene cassettes in the form II RuBisCO construction (Left panel) and the combined gene cassette fragments (right panel) were displayed in Fig 1D.

Fig 1. The constructions of form I and form II RuBisCO, PCR products of individual gene cassette and the combined gene cassettes.

Fig 1

(A) The designated gene cassettes of form I RuBisCO genes. Each of the four gene cassettes contains its independent promoter, a gene fragment coding region, a terminator, and a 46 bp fragment at the 3’ end of the gene cassette that is homologous to its neighboring gene cassette. After the electroporation, the gene cassettes are assembled in the predesignated order. (B) PCR products of RuBisCO gene cassettes in form I RuBisCO (left panel) were shown as follows: M, DNA ladder; 1, Cassette 1 (2347 bp); 2, Cassette 2-cbbL (2559 bp); 3, Cassette 3 (1294 bp); 4, Cassette 4-G418 (1955 bp); 5, Cassette 5 (1291 bp); 6, Cassette 6-cbbS (1726 bp); 7, Cassette 7-cbbP (2944 bp). PCR products of the combined gene cassettes (right panel) were shown as follows: M, DNA ladder; A, (cassette 1 + cassette 2 cbbL) (4906 bp); B, (cassette 2 cbbL + cassette 3) (3853 bp); C, (cassette 3 + cassette 4 G418) (3249 bp); D, (cassette 4 G418 + cassette 5) (3246 bp); E, (cassette 5 cbbM + cassette 6 cbbS) (3017 bp); F, (cassette 6 cbbS + cassette 7 cbbP) (4670 bp); M, DNA ladder. (C) The designated gene cassettes of form II RuBisCO genes. Each of the three gene cassettes possesses an independent promoter, a gene fragment, a terminator, and a 46 bp fragment homologous to its neighboring cassette. After the electroporation, the gene cassettes are assembled in the predesignated order. (D) PCR products of RuBisCO gene cassettes in form II RuBisCO (left panel) were shown as follows: M, DNA ladder; 1, Cassette 1 (2347 bp); 2, Cassette 2 (1102 bp); 3, Cassette 3 (1294 bp); 4, Cassette 4-G418 (1955 bp); 5, Cassette 5-cbbM (2677 bp); 6, Cassette 6 (1301 bp); 7, Cassette 7-cbbP (2948 bp). PCR products of the combined gene cassettes (right panel) were shown as follows: M, DNA ladder; A, (cassette 1 + cassette 2) (3349 bp); B, (cassette 2 + cassette 3) (2396 bp); C, (cassette 3 + cassette 4 G418) (3249 bp); D, (cassette 4 G418 + cassette 5 cbbM) (4632 bp); E, (cassette 5 cbbM + cassette 6) (3978 bp); F, (cassette 6 + cassette 7 cbbP) (4245 bp); M, DNA ladder.

Relative gene expression levels of RuBisCO genes in the engineered K. marxianus strains

After the incorporation of the form I RuBisCO and form II RuBisCO gene cassettes into K. marxianus genome, the two recombinant K. marxianus strains were cultured in YPD-8 to evaluate their function via transcriptional patterns (Fig 2).

Fig 2. RT-qPCR results.

Fig 2

(A) Relative transcriptional levels of RuBisCO genes in the engineered form I RuBisCO strain. (B) Relative transcriptional levels of RuBisCO genes in the engineered form II RuBisCO strain.

The transcriptional levels of RuBisCO genes in the engineered RuBisCO strains grown in YPD-8 medium at 12 h were evaluated by RT-qPCR (Fig 2). The results showed that, in the engineered form I RuBisCO strain, the transcriptional level of cbbS gene was the highest (Fig 2A). The promoter KlPADHI, which drives the cbbS gene was a glucose-inducible promoter as described in the study of Mazzoni et al. [29], exhibited its potent function in regulating cbbS gene activity. In their study, Mazzoni and colleagues found that the alcohol dehydrogenase 1 (KlADH1) gene in K. lactis was preferentially expressed in glucose-grown cells in respect of ethanol-grown cells. The low expression of cbbL gene, which was driven by the ScPGapDH promoter, is worthy of further examination since the reason behind the extreme low transcriptional level of this gene remains unknown. Based on the considerations from our previous study [30], gene cassette arrangements within the PGASO constructions and appropriate promoter strength probably resulted in the improvement of gene expression levels, and subsequently reduced the cell burden and the competition for transcription factors. Therefore, an arrangement of gene cassettes and/or a new, stronger promoter should be taken into consideration to enhance the expression of the cbbL gene in further study. In the meantime, the cbbP gene remained the moderate expression level in the form I RuBisCO strain. The transcriptional patterns of cbbM and cbbP genes in the form II RuBisCO strain were maintained at elevated levels in the YPD-8 medium (Fig 2B). As the key enzyme of the reductive pentose phosphate cycle, the cbbP gene encoding PRK enzyme is responsible for the conversion of ribose-5-phosphate (R5P) to RuBP. RuBisCO, in turn, uses RuBP as its substrate to form two molecules of 3-PGA. The results confirm that the RuBisCO genes were properly inserted into the host genome and function well in both form I and form II RuBisCO yeast strains.

Specific enzyme activity of RuBisCO

The RuBisCO assay was performed to evaluate the functions of RuBisCO gene cassettes in the engineered strains at translational level. The data displayed in Fig 3 revealed that RuBisCO enzymes were appropriately synthesized in the engineered RuBisCO strains and these enzymes functioned properly in converting RuBP to 3-PGA, the first major step of a CO2 fixation. The specific enzyme activities of RuBisCO in the present study, however, were quite low as compared to the previous study [14]. This might be due to the lack of purification step in cell lysis procedure that prevented us from obtaining the best possible yield and purity of enzymes. However, the results of RuBisCO assay were in accordance with the lower accumulated CO2 levels released from the form I and form II RuBisCO strains as compared to those released from the WT. These results also explained the higher ethanol titers of the engineered strains relative to the WT.

Fig 3. Specific RuBisCO enzyme activity.

Fig 3

The line plot represents the decrease in A340 absorbance, indicating NADH oxidation throughout the RuBisCO assay. The table displays specific RuBisCO activity of form I and form II RuBisCO.

Growth profiles and ethanol production of K. marxianus on glucose-free medium YPD-0 and on high glucose concentration medium YPD-20

As shown in the Fig 4A and 4B, in the YPD-0 medium where no additional carbon source was supplemented into the medium, all K. marxianus strains exhibited the poor growth and low ethanol yield. However, ethanol produced by engineered RuBisCO strain was significantly greater than that of the WT. In contrast, in the YPD-20 medium, all strains of K. marxianus grew fast and produced the highest ethanol concentrations compared to those in other media (Fig 4C and 4D). The positive correlation between fermentable sugar and ethanol concentration was obviously observed. After 24 h of fermentation, most glucose was consumed as shown in the Fig 4E. However, there was no statistically significant difference in ethanol concentrations produced by WT and RuBisCO strains (p > 0.05). It was likely that in the excess of carbon source condition, RuBisCO genes only played a negligible role in recombinant K. marxianus strains. This finding is in agreement with Joshi et al. [17] who found that form I RuBisCO is the most common form of RuBisCO under CO2 limiting condition and responsible for providing cellular carbons. They hypothesized that this was a response of microorganisms to carbon limitation and may be important for scavenging the low levels of dissolved CO2 to maintain growth and CO2 fixation. In contrast, in YPD-0 when the growth of K. marxianus only based on amino acids and perhaps a trace amount of sugar, the engineered RuBisCO yeast strains grew faster and produced significantly higher ethanol concentration compared to the WT (Fig 4A and 4B). In Fig 4D, ethanol reached the highest concentration at 48 h and then gradually decreased in harmony with sugar depletion. The decrease in ethanol concentrations after 48 h could be explained by the reversible characteristics of alcohol dehydrogenase enzyme that could catalyze the conversion of ethanol back into acetaldehyde, especially when sugar depletes in the medium. In a previous study, two alcohol dehydrogenase enzymes KmAdh3 and KmAdh4 from K. marxianus GX-UN120, which were heterologously expressed in E. coli, exhibited the ability to catalyze the oxidation reaction of ethanol to acetaldehyde but not the reduction reaction of acetaldehyde to ethanol [31]. In addition, in a growth medium where ethanol was used as the sole carbon source, cell activates gluconeogenesis genes to shift to non-fermentative growth on C2 and C3 carbon sources. In S. cerevisiae, ScGPM1 gene encoding phosphoglycerate mutase 1 showed the highest expression in this condition [32]. As phosphoglycerate mutase 1 gene KmGPM1 (accession number KLMA_20098) in K. marxianus is homologous to ScGPM1 with 87% identity, the use of ethanol to generate ATP and sugar phosphates for nucleotide biosynthesis, cell wall construction and storage carbohydrate biosynthesis should be taken into consideration under carbon depletion. The finding also suggested that with the ethanol fermentation conditions described above, ethanol distillation should not be carried out later than 48 hours of fermentation as its concentration is the highest at 48 h and might decrease soon. This is of importance in industrial ethanol production as it not only saves time but also reduces the operating cost. Regarding CO2 production during the fermentation, it may be expected that CO2-fixing enzymes function well to incorporate more CO2 into the central carbon metabolism of the engineered strains. Although CO2 produced by WT was slightly greater than those of form I RuBisCO and form II RuBisCO strains, there was no statistically significant difference between 3 strains (p > 0.05). Specifically, in YPD-20 medium, the WT produced 0.44 ± 0.094 mmol CO2/mmol glucose, followed by form II RuBisCO with 0.4 ± 0.138 mmol CO2/mmol glucose and CO2 produced by form I RuBisCO strain was the least with 0.35 ± 0.11 mmol of CO2/mmol of glucose consumed. The results confirm the role of form I RuBisCO gene in CO2 fixation and in agreement with previous reports as engineered RuBisCO E. coli [33] and RuBisCO S. cerevisiae [34] harboring RuBisCO genes released less CO2 compared to the control.

Fig 4.

Fig 4

(A) Growth profiles of WT and RuBisCO K. marxianus strains in YPD-0 medium. (B) Ethanol concentrations of WT and RuBisCO K. marxianus strains in YPD-0 medium. (C) Growth profiles of WT and recombinant K. marxianus strains in YPD-20 medium. (D) Ethanol produced by WT and RuBisCO K. marxianus strains in YPD-20 medium. (E) Residual reducing glucose at the end of the fermentation in YPD-20 medium. (F) Accumulated carbon dioxide during the fermentation in YPD-20 medium.

K. marxianus cultured in plant biomass hydrolysates

The WT, form I and form II RuBisCO K. marxianus strains were cultured in Napier grass and rice straw hydrolysates that were collected from the fermentation broths of H. thermocellum ATCC 27405 grown on Napier grass or rice straw powder. These hydrolysates were the end-products of the solubilization and bioconversion of plant biomass using the cellulolytic bacterium. (Note: The term hydrolysate and fermentation broth, therefore, were used interchangeably in this study). The schematic diagram presented in Fig 5 illustrated the general information regarding biomass powder preparation, co-culture H. thermocellum-K. marxianus system, and ethanol fermentation using biomass hydrolysates as substrates.

Fig 5.

Fig 5

Schematic diagram of the present study (A) The procedure of substrate preparation (from field to powder). (B) The coculturing of H. thermocellum and K. marxianus. (C) The semi-anaerobic culturing of K. marxianus in Napier grass hydrolysate or rice straw hydrolysate.

The ethanol, reducing sugar, and protein concentrations in the hydrolysate were determined as described in Materials and Methods section. At the end of the 6 days of fermentation by H. thermocellum, the collected Napier grass fermentation broth contained 940 mg/L ethanol, 8.1 g/L reducing sugar, and 10.3 mg/L protein. Similarly, the rice straw fermentation broth contained 970 mg/L ethanol, 7.4 g/L reducing sugar, and 8.8 mg/L protein. The reducing sugar yield in our Napier grass fermentation broth was similar to the value observed in the study of Amnuaycheewa et al. [23] (8.1 g/L vs. 7.66 g/L) in which pretreated Napier grass powder was used as a starting material.

On Napier grass and rice straw broth (with comparable amounts of reducing sugar and protein in the broth), the WT and engineered RuBisCO K. marxianus strains exhibited similar growth patterns (Fig 6A). In addition to the ethanol produced by H. thermocellum (940 mg/L in Napier grass hydrolysate and 970 mg/L in rice straw hydrolysate), the WT produced 670 mg/L and 710 mg/L ethanol, accounting for 41.6% and 42.1% increase in the final ethanol concentrations in Napier grass broth and rice straw broth, respectively. In addition, the ethanol yields achieved from RuBisCO strains were significantly greater than those from the WT (p < 0.01). In Napier grass broth, the additional amounts of ethanol produced by form I and form II RuBisCO strains was 880 mg/L and 850 mg/L, contributing 48.4% and 47.6% increase in the total ethanol production, respectively (Fig 6B).

Fig 6.

Fig 6

(A) Growth profiles of K. marxianus strains on Napier grass hydrolysate, rice straw hydrolysate and YPD-8. (B) Ethanol production of the WT, form I and form II RuBisCO K. marxianus strains grown on Napier grass hydrolysate. (C) Ethanol production of WT, form I and form II RuBisCO K. marxianus strains grown on rice straw hydrolysate. (D) Ethanol production of WT, form I, form II RuBisCO strains grown on YPD-8 medium.

In rice straw broth, similar pattern could be observed as form I and form II RuBisCO strains generated 780 mg/L and 860 mg/L extra ethanol, accounting for 44.4% and 47.0% increase to the final ethanol yields (Fig 6C). Although the starting soluble reducing sugars in both plant biomass broths are comparable, the composition of sugars might be different, resulting in slight differences in final ethanol yields. In Napier grass broth, form I RuBisCO strain produced approximately 11.2% higher ethanol than the WT did, and form II RuBisCO strain generated about 9.9% higher ethanol compared to the WT. In rice straw broth, the contribution of RuBisCO strains in enhancing ethanol yield was not as well as they did in Napier grass broth. The transformant form I and form II RuBisCO strains only produced 4.0% and 8.3% more ethanol relative to the WT, respectively (Fig 6C). In general, RuBisCO genes allowed the improvement of ethanol yields, suggesting their roles in CO2 fixation and/or redox balance might contribute to ethanol production in the yeast cells during fermentation. In the YPD-8 where glucose, the favored carbon source of K. marxianus, was used, much faster growth patterns of all K. marxianus strains were observed compared to those in biomass hydrolysates (Fig 6D). In addition, the amount of bioethanol produced by the engineered RuBisCO strains was statistically greater than that produced by the WT.

To date, as effective consolidated bioprocessing (CBP) organisms remain to be developed, the two-step ethanol fermentation in the present study demonstrated its advantages. In the separate hydrolysis and fermentation (SHF) process, appropriate temperatures for hydrolytic enzymes and fermentation could be optimized independently. Moreover, as the hydrolysate solution could be sterilized, the risk of contamination could be reduced. The SHF process, however, requires longer time and the capital cost is higher than that for the simultaneous saccharification and fermentation (SSF) process [35].

Efficiency in the utilization of complex sugars

After the fermentation process and the removal of the alcohol-producing microorganism, the recovered liquid composes water, ethanol, residual sugars, proteins and small amounts of organic acids [36]. In addition, a potent ability to take up and metabolize a wide range of sugars is especially important in an industrial process using plant biomass as the starting materials. However, in this study, a large amount of reducing sugars remained in the Napier grass broths (Fig 7).

Fig 7. Residual reducing sugar concentration profiles in the fermentation process.

Fig 7

The left panel shows the reducing sugars in the co-culture system (H. thermocellum + K. marxianus) in modified GS-2 medium supplemented with 100g/L Napier grass. The middle panel shows the residual reducing sugars in the Napier grass broth. The right panel shows the residual glucose in YPD-8 medium.

Similar pattern was observed in the rice straw broth. This finding demonstrates that the efficiency of complex sugar utilization was not impressive and needs to be improved for a better ethanol production. The low capability in sugar consumption could be explained by the lack of a robust sugar transport system and/or by the physiological/metabolic inhibition caused by toxic chemicals generated during the solubilization of biomass substrates [37]. The transformation of robust exogenous cellodextrin transporters, therefore, is of importance to facilitate the use of complex sugars in biomass broths as proved in previous studies [38,39]. In contrast, in the YPD-8 medium that was supplied with purified glucose (8 g/L), all K. marxianus strains grew much faster and metabolized sugar much more effectively than those grown in plant biomass broths. After 24 h of culture, most of glucose in the YPD-8 medium was consumed as shown in the Fig 7 (right panel). Consequently, the biomass of all yeast strains and ethanol yield in YPD-8 medium were much greater than those grown in the biomass hydrolysates. Regarding CO2 production during the fermentation, it may be expected that CO2-fixing enzymes function well to incorporate more CO2 into the central carbon metabolism of the engineered strains. Although CO2 produced by WT was slightly greater than those of form I RuBisCO and form II RuBisCO strains, there was no statistically significant difference between 3 strains (p > 0.05). Specifically, in YPD-8 medium, the WT produced 0.44 ± 0.094 mmol CO2/ mmol glucose, followed by form II RuBisCO with 0.4 ± 0.138 mmol CO2/mmol glucose and CO2 produced by form I RuBisCO strain was the least with 0.35 ± 0.11 mmol of CO2/mmol of glucose consumed. Similar trend in the decrease of CO2 emission was observed in RuBisCO strains grown in biomass hydrolysates, i.e., little lower than CO2 generated by the WT but not statistically significant different (p > 0.05). The results confirm the role of form I RuBisCO gene in CO2 fixation and in agreement with previous reports as engineered RuBisCO E. coli [33] and RuBisCO S. cerevisiae [32] harboring RuBisCO genes released less CO2 compared to the control.

Co-culturing K. marxianus and H. thermocellum using Napier grass and rice straw powders as the substrates

Overall, the amount of ethanol generated by the co-culture fermentation system using K. marxianus and H. thermocellum was lower than that in the biomass broths. Specifically, the WT strain growth on Napier grass and rice straw powders generated 235 and 412 mg/L extra ethanol, contributing 20.0% and 29.8% to the final ethanol concentrations, respectively (Fig 8). On Napier grass substrate, recombinant form I and form II RuBisCO strains contributed 558 mg/L (37.3%) and 614 (39.6%) mg/L extra ethanol to the final ethanol concentrations, respectively (Note: The numbers in parentheses represent the percentage of contribution to the final ethanol concentrations). Similarly, on rice straw substrate, form I RuBisCO K. marxianus produced 496 mg/L (33.8%) and form II RuBisCO generated 576 mg/L (37.2%). In general, the RuBisCO strains produced ethanol better than the WT with 4.02–7.44% higher on rice straw and 17.3–19.5% higher on Napier grass.

Fig 8. Ethanol production in the co-culture H. thermocellum-K. marxianus system.

Fig 8

(A) Ethanol production with Napier grass powder as the substrate. (B) Ethanol production with rice straw powder as the substrate.

The lower ethanol yields in co-culture system may be due to the nutrient competitions between ethanol producer and plant biomass degrader although H. thermocellum entered the stationary phase (after 144 h of culture) prior to the inoculation of K. marxianus into the co-culture vials. Moreover, low pH value of H. thermocellum culture broth (pH ~ 5.7), caused by the production of acetic acids via metabolic pathway of H. thermocellum itself and from the deacetylation of hemicellulose [40], might have inhibitory effects on kefir yeast growth and its metabolic functions. The plant biomass broths, in contrast, were thoroughly filtered to remove the bacterium H. thermocellum after the process of biomass solubilization. Furthermore, to optimize K. marxianus growth conditions, the broths were neutralized to pH 7.0. However, despite the suboptimal conditions for ethanol producer, co-culture system exhibits many advantages over monoculture by saving time and chemicals for culture broth collecting, filtering and neutralizing. It should be reminded that we only used unpretreated Napier grass and rice straw powder as starting material for bioconversion process to achieve similar results obtained in the study of Amnuaycheewa et al. [23] (8.08 g/L vs 7.66 g/L). These authors used pretreated Napier grass as a starting material, however, the hydrolysis step was performed using commercial cellulase enzymes (e.g., Celluclast (R) and Novozyme 188) instead of using a robust cellulolytic bacterium as ours. Our approach reduces the investment for facilities and environmental burden caused by chemicals used in the pretreatment process. However, it may negatively affect the conversion rate of plant biomass, resulting in low concentration of fermentable sugars released into the medium. In addition, toxic chemicals generated from biomass pretreatment, hydrolysis, and end-product formation may also negatively affect the growth and physiology of microorganism of interest for consolidated bioprocessing (CBP) [4143].

Conclusions

An economical cellulosic biofuel production system should meet three criteria, namely being an efficient process, a good biofuel producer and a good cellulolytic enzyme system [38]. In the present study, the use of a robust biomass-degrading bacterium for Napier grass and rice straw solubilization was proved efficient as it took advantage of hydrolytic machinery in H. thermocellum to decompose recalcitrant unpretreated plant biomass powders. The bioconversion of plant biomass not only released fermentable sugars for K. marxianus, but also produced more bioethanol, thus remarkably contributing to the final ethanol concentration. When growing in plant biomass hydrolysates, K. marxianus could use fermentable sugars left after the removal of H. thermocellum to synthesize 44–48% additional ethanol. In semi-anaerobic co-culturing fermentation system, may be due to the nutrient competition and/or suboptimal growth conditions, the contribution of K. marxianus to the final ethanol concentrations was approximately 20–39%. In terms of carbon utilization, except in YPD-20 medium, the RuBisCO yeast strains always exhibited better ethanol productivity than the WT, suggesting the important roles of RuBisCO genes in CO2 fixation and/or in redox balancing.

Supporting information

S1 Raw images

(PDF)

Acknowledgments

The authors would like to deeply acknowledge Dr. Nhuan Nghiem, Adjunct Professor, Biosystems Engineering Program, Department of Environmental Engineering and Earth Sciences, Clemson University, South Carolina 29636, USA for his careful English editing and valuable comments.

Abbreviations

3-PGA

3-phosphoglycerate

ADHI

Alcohol dehydrogenase

DNS

3,5-dinitrosalicylic acid

RuBisCO

Ribulose-1,5-bisphosphate carboxylase/oxygenase

GapDH

Glyceraldehyde 3-phosphate dehydrogenase

PBS

Phosphate-buffered saline

PGASO

Gene Assembly and Simultaneous Overexpression

PGK

3-phosphoglycerate kinase

PMSF

Phenylmethylsulfonyl fluoride

PRK

Phosphoribulokinase

R5P

Ribose-5-phosphate

RuBP

Ribulose 1,5-biphosphate

Data Availability

All relevant data are within the paper.

Funding Statement

The design of the study and collection, analysis, and interpretation of data were supported by the Ministry of Science and Technology (https://www.most.gov.tw/) [104-2621-M-005-003-MY3, 107-2621-M-005-007- MY3, 107-2321-B-005-004, and 108-2321-B-005-009 to CCH and 107-2621-M-005-001 to SCL.

References

  • 1.Karim A.; Gerliani N.; Aider M. Kluyveromyces Marxianus: An Emerging Yeast Cell Factory for Applications in Food and Biotechnology. Int. J. Food Microbiol. 2020, 333, 1–24, 10.1016/j.ijfoodmicro.2020.108818 [DOI] [PubMed] [Google Scholar]
  • 2.Fonseca G.; de Carvalho N.; Gombert A. Growth of the Yeast Kluyveromyces Marxianus CBS 6556 on Different Sugar Combinations as Sole Carbon and Energy Source. Appl. Microbiol. Biotechnol. 2013, 97, 5055–5067, 10.1007/s00253-013-4748-6 [DOI] [PubMed] [Google Scholar]
  • 3.Beniwal A.; Saini P.; Kokkiligadda A.; Vij S. Physiological Growth and Galactose Utilization by Dairy Yeast Kluyveromyces Marxianus in Mixed Sugars and Whey during Fermentation. 3 Biotech 2017, 7, 1–13, 10.1007/s13205-016-0582-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Anderson P.; McNeil K.; Watson K. High Efficiency Carbohydrate Fermentation to Ethanol at Temperature above 40oC by Kluyveromyces Marxianus Var. Marxianus Isolated from Sugar Mills. Appl. Environ. Microbiol. 1986, 51, 1314–1320. 10.1128/AEM.51.6.1314-1320.1986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kourkoutas Y.; Dimitropoulou S.; Kanellaki M.; Marchant R.; Nigam P.; Banat I.; et al. High-Temperature Alcoholic Fermentation of Whey Using Kluyveromyces Marxianus IMB3 Yeast Immobilized on Delignified Cellulosic Material. Bioresour. Technol. 2002, 82, 177–181. 10.1016/s0960-8524(01)00159-6 [DOI] [PubMed] [Google Scholar]
  • 6.Nonklang S.; Abdel-Banat B.; Cha-aim K.; Moonjai N.; Hoshida H.; Limtong S.; et al. High-Temperature Ethanol Fermentation and Transformation with Linear DNA in the Thermotolerant Yeast Kluyveromyces Marxianus DMKU3-1042. Appl. Environ. Microbiol. 2008, 74, 7514–7521, 10.1128/AEM.01854-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Suryawati L.; Wilkins M.; Bellmer D.; Huhnke R.; Maness N.; Banat I. Simultaneous Saccharification and Fermentation of Kanlow Switchgrass Pretreated by Hydrothermolysis Using Kluyveromyces Marxianus IMB4. Biotechnol. Bioeng. 2008, 101, 894–902, 10.1002/bit.21965 [DOI] [PubMed] [Google Scholar]
  • 8.Chang J.; Ho C.; Mao C.; Barham N.; Huang Y.; Ho F.; et al. A Thermo- and Toxin-Tolerant Kefir Yeast for Biorefinery and Biofuel Production. Appl. Energy 2014, 132, 465–474, 10.1016/j.apenergy.2014.06.081. [DOI] [Google Scholar]
  • 9.Signori L.; Passolunghi S.; Ruohonen L.; Porro D.; Branduardi P. Effect of Oxygenation and Temperature on Glucose-Xylose Fermentation in Kluyveromyces Marxianus CBS712 Strain. Microb. Cell Factories 2014, 13, http://www.microbialcellfactories.com/content/13/1/51. 10.1186/1475-2859-13-51 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Rodrussamee N.; Lertwattanasakul N.; Hirata K.; Suprayogy; Limtong S.; Kosaka T.; et al. Growth and Ethanol Fermentation Ability on Hexose and Pentose Sugars and Glucose Effect under Various Conditions in Thermotolerant Yeast Kluyveromyces Marxianus. Appl. Microbiol. Biotechnol. 2011, 90, 1573–1586, 10.1007/s00253-011-3218-2 [DOI] [PubMed] [Google Scholar]
  • 11.Andersson I.; Backlund A. Structure and Function of Rubisco. Plant Physiol. Biochem. 2008, 46, 275–291, 10.1016/j.plaphy.2008.01.001 [DOI] [PubMed] [Google Scholar]
  • 12.Gourion B.; Delmotte N.; Bonaldi K.; Nouwen N.; Vorholt J.; Giraud E. Bacterial RuBisCO Is Required for Efficient Bradyrhizobium/Aeschynomene Symbiosis. PLoS ONE 2011, 6, 10.1371/journal.pone.0021900 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Li Y.; Wang M.; Chen Y.; Wang M.; Fan L.; Tan T. Engineered Yeast with a CO2-Fixation Pathway to Improve the Bio-Ethanol Production from Xylose-Mixed Sugars. Sci. Rep. 2017, 7, 10.1038/srep43875 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Tseng I.-T.; Chen Y.-L.; Chen C.-H.; Shen Z.-X.; Yang C.-H.; Li S.-Y. Exceeding the Theoretical Fermentation Yield in Mixotrophic Rubisco-Based Engineered Escherichia Coli. Metab. Eng. 2018, 47, 445–452, 10.1016/j.ymben.2018.04.018. [DOI] [PubMed] [Google Scholar]
  • 15.Romagnoli S.; Tabita F. A Novel Three-Protein Two-Component System Provides a Regulatory Twist on an Established Circuit To Modulate Expression of the CbbI Region of Rhodopseudomonas Palustris CGA010. J. Bacteriol. 188, 2780–2791, 10.1128/JB.188.8.2780-2791.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Paoli G.; Morgan N.; Tabita F.; Shively J. Expression of the CbbLcbbS and CbbM Genes and Distinct Organization of the Cbb Calvin Cycle Structural Genes of Rhodobacter Capsulatus. Arch. Microbiol. 1995, 164, 396–405. [PubMed] [Google Scholar]
  • 17.Joshi G.; Romagnoli S.; VerBerkmoes N.; Hettich R.; Pelletier D.; Tabita F. Differential Accumulation of Form I RubisCO in Rhodopseudomonas Palustris CGA010 under Photoheterotrophic Growth Conditions with Reduced Carbon Sources. J. Bacteriol. 2009, 191, 4243–4250, 10.1128/JB.01795-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jouanneau Y.; Tabita F. Independent Regulation of Synthesis of Form I and Form II Ribulose Bisphosphate Carboxylase-Oxygenase in Rhodopseudomonas Sphaeroides. J. Bacteriol. 1986, 165, 620–624. 10.1128/jb.165.2.620-624.1986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Du C.; Zhou J.; Wang J.; Yan B.; Lu H.; Hou H. Construction of a Genetically Engineered Microorganism for CO2 Fixation Using a Rhodopseudomonas/Escherichia Coli Shuttle Vector. FEMS Microbiol. Lett. 2003, 225, 69–73, 10.1016/S0378-1097(03)00482-8 [DOI] [PubMed] [Google Scholar]
  • 20.Guadalupe-Medina V.; Wisselink H.; Luttik M.; de Hulster E.; Daran J.; Pronk J.; et al. Carbon Dioxide Fixation by Calvin-Cycle Enzymes Improves Ethanol Yield in Yeast. Biotechnol. Biofuels 2013, 6, http://www.biotechnologyforbiofuels.com/content/6/1/125. 10.1186/1754-6834-6-125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chang J.; Ho C.; Ho F.; Tsai T.; Ke H.; Wang C.; et al. PGASO: A Synthetic Biology Tool for Engineering a Cellulolytic Yeast. Biotechnol. Biofuels 2012, 5, http://www.biotechnologyforbiofuels.com/content/5/1/53. 10.1186/1754-6834-5-53 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Chang J.; Lin J.; Ho C.; Chin W.; Huang C. Establishment of Rumen-Mimic Bacterial Consortia: A Functional Union for Bio-Hydrogen Production from Cellulosic Bioresource. Int. J. Hydrog. Energy 2010, 35, 13399–13406, 10.1016/j.ijhydene.2009.11.119 [DOI] [Google Scholar]
  • 23.Amnuaycheewa P.; Rodiahwati W.; Sanvarinda P.; Cheenkachorn K.; Tawai A.; Sriariyanun M. Effect of Organic Acid Pretreatment on Napier Grass (Pennisetum Purpureum) Straw Biomass Conversion. Appl. Sci. Eng. Prog. 2017, 10, 107–117, 10.14416/j.ijast.2017.06.001 [DOI] [Google Scholar]
  • 24.Johnson E.; Madia A.; Demain A. Chemically Defined Minimal Medium for Growth of the Anaerobic Cellulolytic Thermophile Clostridium Thermocellum. Appl. Environ. Microbiol. 1981, 41. 10.1128/AEM.41.4.1060-1062.1981 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Miller G. Use of Dinitrosalicylic Acid Reagent for Determination of Reducing Sugar. Anal. Chem. 1959, 31. [Google Scholar]
  • 26.Livak K.; Schmittgen T. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408, 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 27.Gerard V.; Driscoll T. A Spectrophotometric Assay for RUBISCO Activity: Application to the Kelp Laminaria Saccharina and Implications for Radiometric Assays. J. Phycol. 1996, 32, 880–884, 10.1111/j.0022-3646.1996.00880.x [DOI] [Google Scholar]
  • 28.Mukherjee M.; Nandi A.; Chandra K.; Saikia S.; Jana C.; Das N. Protein Extraction from Saccharomyces Cerevisiae at Different Growth Phases. J. Microbiol. Methods 2020, 172, 10.1016/j.mimet.2020.105906 [DOI] [PubMed] [Google Scholar]
  • 29.Mazzoni C.; Saliola M.; Falcone C. Ethanol-Induced and Glucose-Insensitive Alcohol Dehydrogenase Activity in the Yeast Kluyveromyces Lactis. Mol. Microbiol. 1992, 6, 2279–2286. 10.1111/j.1365-2958.1992.tb01403.x [DOI] [PubMed] [Google Scholar]
  • 30.Chang J.; Lin Y.; Lay C.; Thia C.; Wu Y.; Hou Y.; et al. Constructing a Cellulosic Yeast Host with an Efficient Cellulase Cocktail. Biotechnol. Bioeng. 2017, 115, 10.1002/bit.26507 [DOI] [PubMed] [Google Scholar]
  • 31.Liang J.; Zhang M.; Ding M.; Mai Z.; Wu S.; Du Y.; et al. Alcohol Dehydrogenases from Kluyveromyces Marxianus: Heterologous Expression in Escherichia Coli and Biochemical Characterization. BMC Biotechnol. 2014, 14, 1–10, http://www.biomedcentral.com/1472-6750/14/45. 10.1186/1472-6750-14-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Papini M.; Nookaew I.; Scalcinati G.; Siewers V.; Nielsen J. Phosphoglycerate Mutase Knock-out Mutant Saccharomyces Cerevisiae: Physiological Investigation and Transcriptome Analysis. Biotechnol. J. 2010, 5, 1016–1027, 10.1002/biot.201000199 [DOI] [PubMed] [Google Scholar]
  • 33.Zhuang Z.; Li S. Rubisco-Based Engineered Escherichia Coli for in Situ Carbon Dioxide Recycling. Bioresour. Technol. 2013, 150, 79–88, 10.1016/j.biortech.2013.09.116 [DOI] [PubMed] [Google Scholar]
  • 34.Xia P.; Zhang G.; Walker B.; Seo S.; Kwak S.; Liu J.; et al. Recycling Carbon Dioxide during Xylose Fermentation by Engineered Saccharomyces Cerevisiae. ACS Synth. Biol. 2017, 6, 276–283, 10.1021/acssynbio.6b00167 [DOI] [PubMed] [Google Scholar]
  • 35.Ishizaki H.; Hasumi K. Ethanol Production from Biomass. In Research Approaches to Sustainable Biomass Systems; Tojo S., Hirasawa T., Eds.; Academic Press, 2014; pp. 243–258 ISBN 978-0-12-404609-2. [Google Scholar]
  • 36.Aroujalian A.; Belkacemi K.; Davids S.; Turcotte G.; Pouliot Y. Effect of Residual Sugars in Fermentation Broth on Pervaporation Flux and Selectivity for Ethanol. Desalination 2006, 193, 103–108, 10.1016/j.desal.2005.06.058 [DOI] [Google Scholar]
  • 37.Verbeke T.; Garcia G.; Elkins J. The Effect of Switchgrass Loadings on Feedstock Solubilization and Biofuel Production by Clostridium Thermocellum. Biotechnol. Biofuels 2017, 10, 1–9, 10.1186/s13068-016-0693-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Chang J.; Ho F.; Ho C.; Wu Y.; Hou Y.; Huang C.; et al. Assembling a Cellulase Cocktail and a Cellodextrin Transporter into a Yeast Host for CBP Ethanol Production. Biotechnol. Biofuels 2013, 6, http://www.biotechnologyforbiofuels.com/content/6/1/19. 10.1186/1754-6834-6-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Galazka J.; Tian C.; Beeson W.; Martinez B.; Glass N.; Cate J. Cellodextrin Transport in Yeast for Improved Biofuel Production. Science 2010, 330, 84–86, 10.1126/science.1192838 [DOI] [PubMed] [Google Scholar]
  • 40.Kim J.; Choi G. Pyrolysis of lignocellulosic biomass for biochemical production. In Waste Biorefinery-Potential and Perspectives; Bhaskar T., Pandey A., Mohan S., Lee D., Khanal S., Eds.; Elsevier, 2018; pp. 323–348 ISBN 978-0-444-63992-9. [Google Scholar]
  • 41.Palmqvist E.; Hahn-Hagerdal B. Fermentation of Lignocellulosic Hydrolysates. I: Inhibition and Detoxification. Bioresour. Technol. 2000, 74, 17–24, 10.1016/S0960-8524(99)00160-1 [DOI] [Google Scholar]
  • 42.Linville J.; Rodriguez M. Jr; Land M.; Syed M.; Engle N.; Tschaplinski T.; et al. Industrial Robustness: Understanding the Mechanism of Tolerance for the Populus Hydrolysate-Tolerant Mutant Strain of Clostridium Thermocellum. Plos ONE 2013, 8, 1–16, doi:e78829. 10.1371/journal.pone.0078829 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Linville J.; Rodriguez M. Jr; Brown S.; Mielenz J.; Cox C. Transcriptomic Analysis of Clostridium Thermocellum Populus Hydrolysate-Tolerant Mutant Strain Shows Increased Cellular Efficiency in Response to Populus Hydrolysate Compared to the Wild Type Strain. BMC Microbiol. 2014, 14, 1–17, http://www.biomedcentral.com/1471-2180/14/215. 10.1186/s12866-014-0215-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Muhammad Aamer Mehmood

30 Nov 2020

PONE-D-20-34570

Construction of engineered RuBisCO Kluyveromyces marxianus for a dual microbial bioethanol production system

PLOS ONE

Dear Dr. Chieh-Chen Huang

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jan 14 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Muhammad Aamer Mehmood, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Authors have expressed two variants of Rubiscos (Form I and Form II) to enhance the CO2 fixation and ultimately the ethanol production using these engineered strains. Authors report an extensive metabolic engineering of these pathways in a yeast K. marxianus strain KY3 in a hope to make the strain more efficient under CO2-limiting growth conditions. There are around seven genes/cassettes used for each form of the rubisco present in Rhodopseudomonas palustris. The authors do not show: a) that the cassettes were actually integrated into the yeast genome, b) each of the cassette/gene was expressed in the cells, c) whether the functional forms of Rubisco were actually assembled, and d) activity of recombinant rubiscos in CO2-limiting as well as non-limiting CO2 conditions . At present the results are based on the assumptions that recombinant Rubsicos were successfully assembled and that they were in a biochemically active conformation. Unless, this part of the paper is addressed, the paper cannot be accepted in its present form.

Reviewer #2: In this article, K. marxianus was used as a host for the transformation of form I and form II RubisCO genes derived from the nonsulfur purple bacterium R. palustris. H. thermocellum was used to degrade Napier grass and rice straw to generate soluble fermentable sugars. The RuBisCO expression of two engineered K. marxianus was analyzed. Growth profiles, ethanol production, and residual reducing glucose/carbon dioxide were also detected and compared in different conditions about WT and engineered strains. This research is very close to industrial applications, but this study is still relatively primary. I’d like to encourage the authors to address the following concerns.

Major:

1. Please clarify the definitions of form I and form II RubisCO genes in the Introduction.

2. In Materials and Methods, how to efficiently clone amplified gene fragments into the designated cassettes? And how to insert multiple exogenous genes into K. marxianus genome. Please give details.

3. In Figure 2B, there are doubts about the corresponding relationship between the electrophoresis bands and the sizes. Eg: left 4 and right 2.

4. Please explain the reason why the expression is lower than 1.0 in Figure 3B.

5. To make the article more logical and clearer, the section “Growth Profiles and Ethanol ….Medium YPD-20” should not be arranged at the end of this manuscript.

Minor:

1. Line 103, there is a lack of punctuation at the end of the sentence.

2. Line 162, “FeSO4.7H20” should be changed to “FeSO4·7H2O”. Line 190 is the same.

3. Line 121, “ antibiotics” should be changed to “antibiotic”.

4. Line 180 and 186, unify the speed unit (rpm/x g). “12.800” should be changed to “12,800”. Please handle similar errors as well.

5. The OD of H. thermocellum is far greater than K. marxianus, can changing temperature overcome growth advantages (60℃-37℃)?

6. “After 144 h, the culture stopped producing H2 and CO2, indicating the end of metabolic activities.” The measurement of hydrogen is not mentioned in this paper. Please explain how to know the H2 production ceased.

7. The size of letters should be constant in Figures 4 and 7. Especially for Figure 7, some words are too small to read.

8. Ethanol concentration should use “g/L” as a unit.

9. Is there any special reason to choose Box plot for ethanol production? Why not use a line plot like residue sugar. Actually, sugar and ethanol can be put into one figure.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Niaz Ahmad

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Mar 4;16(3):e0247135. doi: 10.1371/journal.pone.0247135.r002

Author response to Decision Letter 0


29 Jan 2021

Dear Reviewer 1

We appreciate your constructive comments on our work. We have carefully considered the comments and have addressed points by points in the reply. Furthermore, some parts of the manuscript have been added or modified in response to your suggestion and comments.

Reviewer #1: Authors have expressed two variants of Rubiscos (Form I and Form II) to enhance the CO2 fixation and ultimately the ethanol production using these engineered strains. Authors report an extensive metabolic engineering of these pathways in a yeast K. marxianus strain KY3 in a hope to make the strain more efficient under CO2-limiting growth conditions. There are around seven genes/cassettes used for each form of the rubisco present in Rhodopseudomonas palustris. The authors do not show:

a) That the cassettes were actually integrated into the yeast genome

Response: The results showed in the Figure 1B and the Figure 1D were PCR products of the combined gene cassettes that were amplified from the engineered RuBisCO yeast genome (e.g., cassette 1 + cassette 2, cassette 2 + cassette 3, etc.). The gel images confirmed that the RuBisCO gene cassettes were integrated into the host genome in a predesignated order as described in the manuscript and were illustrated in the Figure 1A, 1C. Furthermore, the RT-qPCR data showed in the Figure 2 revealed that the RuBisCO genes were appropriately inserted into the K. marxianus genome and functioned well. We already revised and corrected this in the revised manuscript.

b) Each of the cassette/gene was expressed in the cells

Response: In this study, we confirmed the genes integration into the host genome and the transcription levels of these RuBisCO genes as mentioned above. Moreover, the RuBisCO activities were confirmed, and the phenotypes such as G418 resistance trait and the elevated ethanol production of the engineered RuBisCO strains compared to the WT strain help to confirm the presence of transgenes and their expected functions in the host genome.

c) Whether the functional forms of Rubisco were actually assembled?

Response: Although we did not purify the assembled Rubisco to confirm the functional form of RuBisCO from the host cells, we demonstrated the RuBisCO enzymatic activities as described in the revised manuscript.

d) Activity of recombinant RuBisCO in CO2-limiting as well as non-limiting CO2 conditions. At present the results are based on the assumptions that recombinant RuBisCO were successfully assembled and that they were in a biochemically active conformation.

Response: As the culture media contained organic carbon sources, and the CO2 was generated from metabolic activities of microorganism, it is hard to determine whether the condition was CO2-limiting or CO2 non-limiting. However, the activities of RuBisCO were confirmed. Here is the added paragraph to the Materials and Methods. This paragraph was highlighted in the revised manuscript using Track Changes. The assay showed evidence that the RuBisCO genes function well in the K. marxianus cells and the RuBisCO enzyme was synthesized.

Activity assay of RubisCO

RuBisCO activity measurement was performed based on the continuous spectrophotometric rate determination method described in [14,27] with some modifications. The crude cell lysate was prepared using the glass bead lysis as described by Mukherjee et al. [28]. Briefly, the yeast strains were grown semi-anaerobically in 250-mL serum bottles containing YPD-8 medium for 12 h. Cells were harvested by centrifuging at 12,800 x g, 10 min at 4oC, washed twice with sterile distilled water, and then resuspended in 350 µL of lysis buffer containing 50 mM Tris-HCl buffer, pH 7.5, with 2 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride (PMSF), 0.1 mM DTT, 3 mM MgCl2, 10 mM NaCl. The cells in the glass bead tube were vortexed in a cyclomixer for 4 times at 2,500 rpm for 15 s each, immersing the cell suspension in ice for 15 s between 2 vortexing cycles. The cell suspension was centrifuged at 5,000 x g for 10 min at 4oC to collect the supernatant and the supernatant was used as the crude cell lysate for enzymatic assay. The reaction mixture containing cell lysate, 50 mM HEPES buffer (pH 8), 1 mM Ribulose 1,5-bisphosphate (RuBP), 20 mM MgCl2, 5 mM DTT, 20 mM NaHCO3, 5 mM ATP, 0.15 mM NADH, 5 U/mL 3-phosphoglycerate kinase, 6 U Glyceraldehyde 3-phosphate dehydrogenase was prepared. Specifically, 20 µL cell lysate was added to 180 µL of reaction mixture. To initiate the reaction, 7 µL of 33 mM RuBP was added to the reaction mixture to reach a final concentration of 1 mM. The absorbance at 340 nm (A340) was then recorded every 20 s for 30 min using Beckman Coulter - PARADIGM™ microplate reader (Beckman Coulter, USA) and the rate of decrease in A340 was then converted to the rate of NADH oxidation. RuBisCO activity was calculated from the rate of NADH oxidation. The millimolar extinction coefficient of NADH at 340 nm was used to determine the rate of NAD+ production. Total protein concentration in the cell-free extracts was measured by the Bradford protein assay (Bio-Rad Protein Assay).

Formula for RuBisCO enzyme activity calculation:

ΔA340: Initial A340 – Final A340

2: 2 µmoles of β-NADH are oxidized for each µmole of D-Ribulose 1,5-diphosphate used.

6.22: Millimolar extinction coefficient (mmol-1 cm-1) for β-NADH at 340 nm.

0.6: Optical path length (cm) in an ELISA well with 200 μL reaction volume.

Dear Reviewer 1

We hope that our responses and correction are satisfactory to you, and that it is now suitable for publication in PLOS ONE Journal.

Dr. Chieh-Chen Huang

On behalf of all authors

Dear Reviewer 2

First of all, we would like to appreciate your constructive comments and suggestions on our work. We have carefully considered the comments and have clearly addressed in the reply. Parts of the manuscript have been modified in response to your suggestion and comments.

Reviewer #2: In this article, K. marxianus was used as a host for the transformation of form I and form II RubisCO genes derived from the nonsulfur purple bacterium R. palustris. H. thermocellum was used to degrade Napier grass and rice straw to generate soluble fermentable sugars. The RuBisCO expression of two engineered K. marxianus was analyzed. Growth profiles, ethanol production, and residual reducing glucose/carbon dioxide were also detected and compared in different conditions about WT and engineered strains. This research is very close to industrial applications, but this study is still relatively primary. I’d like to encourage the authors to address the following concerns.

Major:

1. Please clarify the definitions of form I and form II RubisCO genes in the Introduction.

Response: We added a new paragraph to the Introduction to clarify the definitions of form I and form II RubisCO cassettes as your request. The added paragraph was highlighted using the “Track Changes” function in Microsoft Word. In addition, the Figure 1A and Figure 1C illustrated the form I and form II RubisCO cassette constructions as described in the PGASO method.

“The genome of R. palustris consists of two active forms of RuBisCO. The form I RuBisCO includes cbbL (large subunit), cbbS (small subunit), cbbR (transcription regulator) and cbbRRS (atypical two-component systems) genes. The cbbL and cbbS genes are located at the distal end of the cbbI operon and the cbbRRS genes are found located between the cbbR and cbbLS genes. The form II RuBisCO comprises cbbM gene which is located at the distal end of the cbbII operon, followed by cbbA (fructose 1,6-bisphosphate aldolase), cbbT (transketolase), cbbP (phosphoribulokinase), and cbbF (fructose 1,6/sedoheptulose 1,7-bisphosphatase) genes. In the present study, the cbbL, cbbS, and cbbP genes were chosen to construct the form I RuBisCO cassette and the cbbM, cbbP genes were selected to construct the form II RuBisCO cassette [14,15]”

2. In Materials and Methods, how to efficiently clone amplified gene fragments into the designated cassettes? And how to insert multiple exogenous genes into K. marxianus genome. Please give details.

Response: The PGASO method used in this paper relies on the use of overlapping gene fragments and it could be applicable to any host that can undergo homologous recombination. Each gene cassette contains a specific promoter, gene fragment, and a terminator. In the first gene cassette, the 1529 bp sequence identical to the 3’ region sequence of K. lactis Lac4 promoter was used as a promoter, and at the 3’ end of the terminator (TTLac), a 55 bp sequence was designed to be homologous to the 5’ end of the promoter ScPGapDH in the gene cassette 2. The terminator ScTTGap of the gene cassette 2, in turn, had 55 bp overhanging sequence at its 3’ end that was homologous to the 5’ end of the promoter ScPGK in the gene cassette 3, and so on. We hope that the illustration in the Figure 1A and Figure 1C make the PGASO concept clearer to the readers.

In addition, the PGASO method in Materials and Methods was also rewritten to make it easier to understand. This paragraph was highlighted using Track Changes.

“Multiple-gene cassette construction

The PGASO method was developed to insert multiple exogenous genes into K. marxianus 4G5 genome [21]. Since the PGASO method was fundamentally based on site-specific homologous recombination, overhanging sequences were designed to link at the 5’-upstream sequence of a promoter, and to link at the 3’-downstream sequence of a terminator in order to facilitate an accurate gene cassette assembly into a host genome. Specifically, in the first gene cassette, a 1529 bp sequence, which is identical to the 3’ region of the K. lactis Lac4 promoter, was used as a promoter in the first gene cassette. In the last gene cassette, a 582 bp sequence, which is homologous to the 5’ region of K. lactis Lac4 promoter, was linked with the 3’ end of the terminator ScTTADHI. It is noteworthy that the identities between K. marxianus Lac4 promoter and K. lactis Lac4 promoter, at the 5’ region and at the 3’ region, are 99.8% and 97.9%, respectively. The other gene cassettes were constructed to contain two parts as follows: (1) a gene sequence, at its 5’ end, linked to a promoter, at its 3’ end, linked to a terminator, and (2) a 55 bp overhanging sequence at the 3’ end of the gene cassette that is homologous to a 5’ end of the promoter of its downstream neighboring gene cassette. Individual gene fragment of cbbL, cbbS, cbbM, and cbbP from the genome of R. palustris CGA009 were amplified by polymerase chain reaction (PCR). The amplified gene fragments cbbL, cbbS, cbbM, cbbP and G418 (kanamycin resistance gene) were then cloned into the predesignated cassette plasmids (Table 1) with their specific independent promoter and terminator as follows: ScPGapDH-cbbL¬-ScTTGap, KlPGapDH-G418-ScTTGap, KlPADHI-cbbS-ScTTGap, ScPADHI-cbbP-ScTTADHI, and KlPPGK-cbbM-ScTTPGK. Subsequently, gene cassettes for PGASO technique were amplified with KOD plus DNA polymerase kit (TOYOBO Biotech) with specific primers listed in the Table 1. The cloning procedure was performed using Escherichia coli strain DH5α cells and Luria-Bertani (LB) medium was used as a culture medium. The antibiotic ampicillin (50 μg/mL) was used to screen the cloned plasmids. The sizes of individual transgenes and gene cassettes were shown in the Table 2. In addition, specific primers for RT-qPCR were designed to confirm the transcriptional activities of the transgenes cbbS, cbbL, cbbM, and cbbP in the host cells. Importantly, to verify the sizes and the correct orders of the gene cassettes in their predesignated assemblage in the yeast genome, the combined gene cassettes were also amplified using PCR with the forward primer of the upstream gene cassette and the reverse primer of its adjacent downstream gene cassette (Table 1).

Table 1. Plasmids and primers used in the PGASO constructions and RT-qPCR experiments.

Plasmid Description

pUC18 Ampicillin resistant; multicopy plasmid with a ColE1 – type replicon

Cassette 1 pUC18-Kl PLac4 pUC18 derivative with a 1529 bp portion of Kluyveromyces lactis Lac4 promoter and K. lactis Lac4 terminator with a 55 bp sequence at 3’ end homologous to S. cerevisiae GapDH promoter

Cassette 2 pUC18-Sc PGapDH pUC18 derivative with S. cerevisiae GapDH promoter and TTGap terminator with a 55 bp sequence at 3’ end homologous to S. cerevisiae PGK promoter

Cassette 3 pUC18- Sc PPGK pUC18 derivative with S. cerevisiae PGK promoter and TTPGK terminator with a 55 bp sequence at 3’ end homologous to K. lactis GapDH promoter

Cassette 4 pUC18- Kl PGapDH pUC18 derivative with K. lactis GapDH promoter S. cerevisiae GapDH terminator with a 55 bp overhanging sequence at its 3’ region homologous to K. lactis PGK promoter

Cassette 5 pUC18-Kl PPGK pUC18 derivative with K. lactis PGK promoter and S. cerevisiae PGK terminator with a 55 bp sequence at 3’ end homologous to K. lactis ADHI promoter

Cassette 6 pUC18-Kl PADHI pUC18 derivative with K. lactis ADHI promoter and S. cerevisiae GapDH terminator with a 55 bp sequence at 3’ end homologous to S. cerevisiae ADHI promoter

Cassette 7 pUC18-Sc PADHI pUC18 derivative with S. cerevisiae ADHI promoter and ADHI terminator with a 582 bp sequence at 3’ end homologous to K. lactis Lac4 promoter

Cassette 2 pUC18-Sc PGapDH-cbbL Cassette 2 pUC18-Sc PGapDH derivative with cbbL

Cassette 6 pUC18-Kl PADHI-cbbS Cassette 6 pUC18-Kl PADHI derivative with cbbS

Cassette 5 pUC18-Kl PPGK-cbbM Cassette 5 pUC18-Kl PPGK derivative with cbbM

Cassette 7 pUC18-Sc PADHI-cbbP Cassette 7 pUC18-Sc PADHI derivative with cbbP

Cassette 4 pUC18- Kl PGapDH-G418 Cassette4 pUC18- KlPGapDH derivative with kanR from Lac4-KanMX cassette [21]

Cassette Primer Sequence

KlPLac4-KlTTLac4 KlPLac4-3’ 5’-CCGCGGGGATCGACTCATAAAATAG-3’

KlTTLac4_ScPGapDH 5’-CTACTATTAATTATTTACGTATTCTTTGAAATG

GCAGTATTGATAATGATAAACTTATACAACATCG

AAGAAGAGTCT-3’

ScPGapDH-cbbL-ScTTGapDH ScPGapDH 5’-AGTTTATCATTATCAATACTGCCAT-3’

ScTTGap_ScPGK 5’-GGACTCCAGCTTTTCCATTTGCCTTCGCGCTT

GCCTGTACGGTCGTTACCATACTTGGCGGAAAA

AATTCATTTGTAA-3’

ScPPGK-ScTTPGK ScPGK 5’- ACTGTAATTGCTTTTAGTTGTGTAT-3’

ScTTPGK_KlPGapDH 5'-GGACTCCAGCTTTTCCATTTGCCTTCGCGCTT

GCCTGTACGGTCGTTACCATACTAAGCTTTTTCG

AAACGCAGAATTTTCG-3’

KlPGapDH-G418-ScTTGapDH Kl-PGapDH 5’-AGTATGGTAACGACCGTACAGGCAA-3’

ScTTGap_KlPGK 5'-TACCTTTGATACCATAAAAACAAGCAAATATTCT

TACTTCAAACACACCCGTGGCGGAAAAAATTCATTTGTAAACT-3’

KlPPGK-cbbM-ScTTPGK KlPGK 5’-CGGGTGTGTTTGAAGTAAGAATATT -3’

ScTTPGK_KlPADHI 5’-AGGTAAGTATGGTAACGACCGTACAGGCAAG

CGCGAAGGCAAATGGAAAAGCTGGAAGCTTTT

TCGAAACGCAGAATTTT-3’

KlPADHI-cbbS-ScTTGapDH KlPADHI 5’-CCAGCTTTTCCATTTGCCTTCGCGCTTGCC-3’

ScTTGap_ScPADHI 5’-GGAATCCCGATGTATGGGTTTGGTTGCCAGA

AAAGAGGAAGTCCATATTGTACACTGGCGGAA

AAAATTCATTTGTAA-3’

ScPADH1-cbbP-ScTTADH1 ScPADHI 5’-GTGTACAATATGGACTTCCTCTTTTC-3’

ScTTADHI_KlPLac4-5’End 5’-GAAATTTAGGAATTTTAAACTTG-3’

Primers used for cloning

Phosphorobulokinase (PRK) cbbP-F’ 5’-CCGCCTAGGATGTCCCGTAAGCATCCG-3’

cbbP-R’ 5’-CATGCCATGGTTACTTCATGCTTCGTTTGCGGTC-3’

Form I RuBisCO small subunit cbbS-F’ 5’-CCGCCTAGGATGCGACTGACCCAAGGC-3’

cbbS-R’ 5’-CATGCCATGGTCAGCCTCCGTAGCGTCG-3’

Form I RuBisCO large subunit cbbL-F’ 5’-CCGCCTAGGATGAACGAAGCAGTCACC-3’

cbbL-R’ 5’-CATGCCATGGTTAGACCGAGACCGACGG-3’

Form II RuBisCO cbbM-F’ 5’-CCGCCTAGGATGGACCAGTCGAACC-3’

cbbM-R’ 5’-CCTTAATTAATTACGCCGCCTGC-3’

Primers used for RT-qPCR

Phosphorobulokinase (PRK) r-cbbP-F’ 5’-GCCGATGAATCGATGGTGG-3’

r-cbbP-R’ 5’-TTCATGCTTCGTTTGCGGTC-3’

Form I RuBisCO small subunit r-cbbS-F’ 5’-TGACCCAAGGCTGTTTCTCG-3’

r-cbbS-R’ 5’-TTCAGTTCCATCATCACGCC-3’

Form I RuBisCO large subunit r-cbbL-F’ 5’-CCGGCGTGATGGAATACAAG-3’

r-cbbL-R’ 5’-ATACTTCTCCGCCGCAGTCA-3’

Form II RuBisCO r-cbbM-F’ 5’-ATGATCGCCTCGTTCCTGAC-3’

r-cbbM-R’ 5’-TTGATGATGGTGCCGACGAT-3’

Actin 4G5 actin F 5’-GGGCTTCGGTCAACAAAC-3’

4G5 actin R 5’-TGGTCGGTATGGGTCAAAAGG-3’

Primers to confirm gene cassettes order in K. marxianus genome

Cassette (1 + 2 cbbL) 1-2 F 5’-CCGCGGGGATCGACTCATAAAATAG-3’

1-2 R 5’-GGACTCCAGCTTTTCCATTTGCCTTCGCGCTT

GCCTGTACGGTCGTTACCATACTTGGCGGAAAA

AATTCATTTGTAA-3’

Cassette (2 cbbL + 3) 2-3 F 5’-AGTTTATCATTATCAATACTGCCAT-3’

2-3 R 5'-GGACTCCAGCTTTTCCATTTGCCTTCGCGCTT

GCCTGTACGGTCGTTACCATACTAAGCTTTTTCG

AAACGCAGAATTTTCG-3’

Cassette (3 + 4 G418) 3-4 F 5’- ACTGTAATTGCTTTTAGTTGTGTAT-3’

3-4 R 5'-TACCTTTGATACCATAAAAACAAGCAAATATTCT

TACTTCAAACACACCCGTGGCGGAAAAAATTCATTTGTAAACT-3’

Cassette (4 G418 + 5) 4-5 F 5’-AGTATGGTAACGACCGTACAGGCAA-3’

4-5 R 5’-AGGTAAGTATGGTAACGACCGTACAGGCAAG

CGCGAAGGCAAATGGAAAAGCTGGAAGCTTTT

TCGAAACGCAGAATTTT-3’

Cassette (5 + 6 cbbS) 5-6 F 5’-CGGGTGTGTTTGAAGTAAGAATATT -3’

5-6 R 5’-GGAATCCCGATGTATGGGTTTGGTTGCCAGA

AAAGAGGAAGTCCATATTGTACACTGGCGGAA

AAAATTCATTTGTAA-3’

Cassette (6 cbbS + 7 cbbP) 6-7 F 5’-CCAGCTTTTCCATTTGCCTTCGCGCTTGCC-3’

6-7 R 5’-GAAATTTAGGAATTTTAAACTTG-3’

Table 2. Size of individual RuBisCO genes, gene cassettes used in the PGASO constructions.

Cassette Promoter-Terminator (bp) RubisCO gene (bp) Promoter-Gene-Terminator (bp) Primers

1 2347 - KlPLac4- KlTTLac4 (2347) F-KlPLac4-3’

R-KlTTLac4_ScPGapDH

2 1102 cbbL (1457) ScPGapDH-cbbL-ScTTGap (2559) F-ScPGapDH

R-ScTTGap_ScPGK

3 1294 - ScPPGK-ScTTPGK (1294) F-ScPGK

R-ScTTPGK_KlPGapDH

4 1145 G418 (810) KlPGapDH-G418-ScTTGap (1955) F-Kl-PGapDH

R-ScTTGap_KlPGK

5 1291 cbbM (1386) KlPPGK-cbbM-ScTTPGK (2677) F-KlPGK

R-ScTTPGK_KlPADHI

6 1301 cbbS (425) KlPADHI-cbbS-ScTTGap (1726) F-KlPADHI

R-ScTTGap_ScPADHI

7 2068 cbbP (876) ScPADHI-cbbP-ScTTADHI (2944) F-ScPADHI

R-ScTTADHI_KlPLac4-5’End

3. In Figure 2B, there are doubts about the corresponding relationship between the electrophoresis bands and the sizes. E.g.: left 4 and right 2.

Response: You are right. This was our mistake when using the wrong gel images. We already carefully revised them and displayed the correct gel images in the Figure 1B and Figure 1D.

4. Please explain the reason why the expression is lower than 1.0 in Figure 2.

Response: We used actin as the calibrator gene, thus the gene expression levels of RuBisCO were calculated relatively based on the Ct value of the actin gene. Although the expression level of cbbL was low, the RuBisCO activity, however, could be determined. We already checked the RT-qPCR results again and displayed the new results in the Figure 2.

5. To make the article more logical and clearer, the section “Growth Profiles and Ethanol ….Medium YPD-20” should not be arranged at the end of this manuscript.

Response: We already rearranged the section as your request. It is now placed between the RuBisCO assay and the K. marxianus cultured in plant biomass hydrolysates part.

Minor:

1. Line 103, there is a lack of punctuation at the end of the sentence.

Response: We already corrected it.

2. Line 162, “FeSO4.7H20” should be changed to “FeSO4·7H2O”. Line 190 is the same.

Response: This is the typo, we already corrected it.

3. Line 121, “ antibiotics” should be changed to “antibiotic”.

Response: We already corrected this word as your request.

4. Line 180 and 186, unify the speed unit (rpm/x g). “12.800” should be changed to “12,800”. Please handle similar errors as well.

Response: We changed 12.800 to 12,800 based on your comment.

5. The OD of H. thermocellum is far greater than K. marxianus, can changing temperature overcome growth advantages (60℃-37℃)?

Response: We decreased the culture temperature from 60oC (for H. thermocellum) to 37oC for K. marxianus after H. thermocellum entered its decline phase. In other word, after 6 days of culture, H. thermocellum finished the biomass hydrolysis step and only maintained its low activity. Subsequently, the decrease in culture temperature to 37oC was suitable for the K. marxianus growth. By this way, we tried to prevent the potent competition between two species in the co-culturing system.

6. “After 144 h, the culture stopped producing H2 and CO2, indicating the end of metabolic activities.” The measurement of hydrogen is not mentioned in this paper. Please explain how to know the H2 production ceased.

Response: We measured H2 production at the same time with CO2 using the same GC protocol. We already modified this part to make it clearer.

7. The size of letters should be constant in Figures 4 and 7. Especially for Figure 7, some words are too small to read.

Response: We already redrew all the graphics with bigger font size as your request

8. Ethanol concentration should use “g/L” as a unit.

Response: We agree with the reviewer that ethanol concentration should be displayed as g/L, but we also think mg/L is acceptable. Therefore, we decided to use this unit consistently in this paper.

9. Is there any special reason to choose Box plot for ethanol production? Why not use a line plot like residue sugar. Actually, sugar and ethanol can be put into one figure.

Response: In the case of residual sugar, we measured sugar concentrations at different timepoints from the beginning of the culture (0 h), intermediate timepoints to the end of the process (24 h, 48 h, and 72 h) to observe the patterns of sugar consumption by K. marxianus. Therefore, line plot is a suitable way to describe the data. Ethanol measurement, in contrast, was only carried out at the end of the fermentation and the ANOVA was calculated based on the raw data collected from biological triplicates. In addition, boxplot is a useful way to show the contribution of data, their central values, and their variability. The use of boxplot is preferable to the barplot (with mean and standard deviation) when the data are not strictly symmetrically distributed.

Dear Reviewer 2

We hope that our responses and correction are satisfactory to you, and that it is now suitable for publication in PLOS ONE Journal.

Dr. Chieh-Chen Huang

On behalf of all authors

Attachment

Submitted filename: Responses-to-Reviewer-2-28-1-2021-SL-Final.docx

Decision Letter 1

Muhammad Aamer Mehmood

2 Feb 2021

Construction of engineered RuBisCO Kluyveromyces marxianus for a dual microbial bioethanol production system

PONE-D-20-34570R1

Dear Dr. Chieh-Chen Huang,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Muhammad Aamer Mehmood, Ph.D.

Academic Editor

PLOS ONE

Acceptance letter

Muhammad Aamer Mehmood

9 Feb 2021

PONE-D-20-34570R1

Construction of engineered RuBisCO Kluyveromyces marxianus for a dual microbial bioethanol production system

Dear Dr. Huang:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Muhammad Aamer Mehmood

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Raw images

    (PDF)

    Attachment

    Submitted filename: Responses-to-Reviewer-2-28-1-2021-SL-Final.docx

    Data Availability Statement

    All relevant data are within the paper.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES