Assessing POR and CYB5R1 oxidoreductase-mediated oxidative rupture of PUFA in liposomes

Summary

Lipid peroxidation of polyunsaturated fatty acid (PUFA) phospholipids induces necrotic cell death through compromised cell membrane integrity during ferroptosis. We established assays to investigate oxidoreductase-mediated oxidative rupture, specifically via NADPH-cytochrome P450 reductase (POR) and NADH-cytochrome b5 reductase (CYB5R1), of PUFA phospholipids in artificially generated protein-free liposomes. Liposome breakage was detected via Tb³⁺ liposome release and electron microscopy liposome morphology imaging. This protocol was also applied to other oxidoreductases with analogous functions and investigation of ferroptotic membrane damage in cell-free systems.

For complete details on the use and execution of this protocol, please refer to Yan et al. (2020).

Graphical abstract

Highlights

• •Protocol for POR/CYB5R1-mediated liposome rupture
• •Two methods for accessing liposome membrane damage
• •Tips on how to use POR/CYB5R1 for oxidative membrane damage

Lipid peroxidation of polyunsaturated fatty acid (PUFA) phospholipids induces necrotic cell death through compromised cell membrane integrity during ferroptosis. We established assays to investigate oxidoreductase-mediated oxidative rupture, specifically via NADPH-cytochrome P450 reductase (POR) and NADH-cytochrome b5 reductase (CYB5R1), of PUFA phospholipids in artificially generated protein-free liposomes. Liposome breakage was detected via Tb³⁺ liposome release and electron microscopy liposome morphology imaging. This protocol was also applied to other oxidoreductases with analogous functions and investigation of ferroptotic membrane damage in cell-free systems.

Before you begin

The protocol below describes a method for detecting lipid peroxidation induced liposome damage by oxidoreductases POR and CYB5R1; mediated through a series of redox reactions. Moreover, this method is applicable to liposome damage by other triggers, such as pore-forming mixed lineage kinase domain like pseudokinase (MLKL) proteins (Wang et al., 2014) and gasdermin proteins (Ding et al., 2016) induced membrane leakage without any chemical reactions.

Purification of recombinant POR and CYB5R1 from bacterium

Timing: 2 days

• 1.Generate recombinant vectors for the expression of oxidoreductases POR and CYB5R1 in the bacterium pET28c vector. Delete the transmembrane domains of POR (aa 2–42) and CYB5R1 (aa 2–28) to facilitate purification. The vectors are termed hereafter as pET28a-Δ2-42 POR and pET28a-Δ2-28 CYB5R1. Generate specific point mutations of POR variants (Y178D; A284P; R454H; V489E; C566Y; V605F) by site-directed mutagenesis. All vectors are available upon request from Yan et al. (2020). Vectors were transfected into E.coli strain JM109 (DE3) and plated for the growth of single clones.

CRITICAL: The deletion of the transmembrane domain of POR/CYB5R1 is critical for high-efficiency expression and purification of both proteins.

• 2.Pick Single clones and culture in 50 mL of Luria-Bertani (LB) medium containing 50 μg/mL kanamycin for 16 h.
• 3.Inoculate 10 mL of cultured bacterium into 1 L of kanamycin resistant LB medium in 2.5 L flasks at 37°C to reach an optical density (OD) value of 0.8. Then, add 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and 100 μM riboflavin into the LB media for further culture at 15°C for ∼20 h. Handle a total of 5 L of LB side-by-side.

CRITICAL: Riboflavin is required for the purification of functional POR/CYB5R1, as it is essential for the enzymatic biosynthesis of flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN). Both POR and CYB5R1 are flavoproteins, and FAD and FMN are cofactors of POR and FAD is a cofactor of CYB5R1.

Note: The optimal OD value of bacterium is between 0.6 and 1.0 when adding IPTG in order to achieve higher protein expression.

• 4.Harvest the bacterium by centrifugation for 30 min at 4,000 × g and lysed in buffer I (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 15 mM imidazole) in the presence of Protease Inhibitor Cocktail (Roche) and Phenylmethylsulfonyl fluoride (PMSF). The solution is then French pressed at 60,000 psi, twice.
• 5.
  Discard cell debris by centrifugation for 30 min at 20,000 × g. Then load the soluble proteins on a Nickel column. Wash the non-specifically bound proteins extensively.

  • a.
    Wash the column by 10× volume of buffer II (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 15 mM imidazole, 0.5% Triton X-100), twice.
  • b.
    Second, wash the column by 10× volume of buffer III (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 15 mM imidazole, 0.5% Triton X-100), twice.
  • c.
    Third, wash the column by 20× volume of buffer I to eliminate detergent.
• 6.Elute proteins with buffer IV (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 300 mM imidazole). Discard imidazole and any remaining detergent in a 30 kDa cut-off concentrate tube (for POR) or a 10 kDa cut-off concentrate tube (for CYB5R1). Store the proteins in buffer V (20 mM Tris-HCl, pH 8.0, 150 mM NaCl) and froze proteins under −80°C.

Note: The protein exhibits a yellow color due to the binding of FMN and/or FAD.

Note: The buffers were stored at 4°C until use.

CRITICAL: The proteins were aliquoted (10 μL per tube, 10 μM) to avoid repeated freezing/thawing cycles.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Bacterial and virus strains
JM109 (DE3)	TransGen Biotech	CD601
Biological samples
Soy phospholipid mixture	Avanti	690050P
Cardiolipin solution from bovine heart	Sigma-Aldrich	SRE0029
1,2-Dipalmitoyl-sn-glycero-3-phosphocholine (16:0 PC, DPPC)	Avanti	850355P; CAS: 63-89-8
1-Stearoyl-2-Arachidonoyl-sn-glycero-3-phosphoethanolamine (18:0-20:4 PE, SAPE)	Avanti	850804C; CAS: 61216-62-4
Chemicals, peptides, and recombinant proteins
Ferrostatin-1 (Fer-1)	Selleck	S7243; CAS: 347174-05-4
Liproxstatin-1 (Lip-1)	Selleck	S7699; CAS: 950455-15-9
Terbium (III) chloride	Sigma-Aldrich	451304; CAS: 10042-88-3
Dipicolinic acid (DPA)	Sigma-Aldrich	P63808; CAS: 499-83-2
Ni-NTA agarose	QIAGEN	30230
Uranyl acetate dihydrate	Thermo Fisher Scientific	15636950
PMSF	Merck	10837091001
Chloroform	Sigma-Aldrich	319988; CAS: 67-66-3
Ferric chloride	Sigma-Aldrich	451649; CAS: 7705-08-0
NADPH	Sigma-Aldrich	N5130; CAS: 100929-71-3
NADH	Sigma-Aldrich	N8129; CAS: 606-68-8
Riboflavin	Sigma-Aldrich	R4500; CAS: 83-88-5
His-Δ2-42 POR	This paper	N/A
His-Δ2-42 POR Y178D	This paper	N/A
His-Δ2-42 POR A284P	This paper	N/A
His-Δ2-42 POR R454H	This paper	N/A
His-Δ2-42 POR V489E	This paper	N/A
His-Δ2-42 POR C566Y	This paper	N/A
His-Δ2-42 POR V605F	This paper	N/A
His-Δ2-28 CYB5R1	This paper	N/A
Critical commercial assays
Fast Mutagenesis System	TransGen Biotech	FM111-02
Oligonucleotides
28c-NcoI(gi)-CYB5R1no28-F	ACTTTAAGAAGGAGATATACCATGTTGGTTCGGAG GTCCCGCCG	N/A
28c-NotI(gi)-CYB5R1-R	TCAGTGGTGGTGGTGGTGGTGGTAGGTGAATCG CATCTTTTG	N/A
28c-NcoI(gi)-PORno42-F	ACTTTAAGAAGGAGATATACCATGCTGTTCCGGAA GAAAAAAGAAG	N/A
28c-NotI(gi)-POR-R	TCAGTGGTGGTGGTGGTGGTGAGACCACACGTC CAGGCTG	N/A
POR-Y178D-F	TGGCCTGGGCAACAAGACCGACGAGCACTTCAACG	N/A
POR-Y178D-R	CGGTCTTGTTGCCCAGGCCAAACACGGCAAACTTC	N/A
POR-A284P-F	CCAAGAATCCCTTCCTGCCAGCCGTGACCACCAACA	N/A
POR-A284P-R	TGGCAGGAAGGGATTCTTGGCGTCGAATGGAGGCTT	N/A
POR-R454H-F	CTGCCTAGACTGCAGGCCCACTACTACTCTATCGCCA	N/A
POR-R454H-R	GTGGGCCTGCAGTCTAGGCAGCAGCTCGCACAGGTGAT	N/A
POR-V489E-F	GGCAGAATCAACAAAGGCGAGGCCACCAATTGGCT	N/A
POR-V489E-R	TCGCCTTTGTTGATTCTGCCGGCCTTTGTCTCGTATTC	N/A
POR-C566Y-F	CACTGCTGTACTACGGCTACAGAAGAAGCGACGAG	N/A
POR-C566Y-R	TAGCCGTAGTACAGCAGTGTCTCTCCCACTTCT	N/A
POR-V605F-F	CAGAGCCACAAAGTGTACTTCCAGCATCTGCTGAAG	N/A
POR-V605F-R	GAAGTACACTTTGTGGCTCTGTTCCCGGCTGAAG	N/A
Recombinant DNA
pET-28c-Δ2-42 POR-His	This paper	N/A
pET-28c-Δ2-42 POR Y178D -His	This paper	N/A
pET-28c-Δ2-42 POR A284P -His	This paper	N/A
pET-28c-Δ2-42 POR R454H -His	This paper	N/A
pET-28c-Δ2-42 POR V489E -His	This paper	N/A
pET-28c-Δ2-42 POR C566Y -His	This paper	N/A
pET-28c-Δ2-42 POR V605F -His	This paper	N/A
pET-28c-Δ2-28 CYB5R1-His	This paper	N/A
Software and algorithms
GraphPad Prism 8	GraphPad Software	https://www.graphpad.com/
Other
Buffer I	20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 15 mM imidazole	N/A
Buffer II	20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 15 mM imidazole, 0.5% Triton X-100	N/A
Buffer III	20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 15 mM imidazole, 0.5% Triton X-100	N/A
BUFFER IV	20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 300 mM imidazole	N/A
Buffer V	20 mM Tris-HCl, pH 8.0, 150 mM NaCl	N/A
Buffer H	20 mM HEPES, pH 7.4, 150 mM NaCl	N/A
Buffer L	20 mM HEPES, pH 7.4, 100 mM NaCl	N/A
Buffer TL	20 mM HEPES, pH 7.4, 100 mM NaCl, 50 mM sodium citrate, 15 mM TbCl3	N/A
10 kDa cut-off centrifugal filters	Millipore	UFC901024
30 kDa cut-off centrifugal filters	Millipore	UFC903096
100 kDa cut-off centrifugal filters	Millipore	UFC910096
Extruder set with holder/heating block	Avanti	610000-1Ea
Vacuum rotary evaporator	BUCHI	Rotavapor R-3
Plasma cleaner	HARRICK PLASMA	PDC-32G
EM grid	Beijing Zhongjingkeji Technology	4000019621
Tecnai T12 Transmission electron microscope	FEI	401838
Multimode plate reader (EnSpire)	PerkinElmer	N/A

Step-by-step method details

Preparation of liposomes for electron microscopy negative staining

Timing: 30 min

This section describes how to prepare liposome which do not enclose Tb³⁺ ions. These liposome was used as a substrate for POR mediated lipid peroxidation and the damage was detected by electron microscopy.

• 1.Dissolve the soy phospholipid mixture and bovine cardiolipins from heart in chloroform (10 mg/mL stock solution) under nitrogen and store them at −20°C. Add 80 μL of soy phospholipids and 20 μL bovine cardiolipins into 500 μL of chloroform in a round-bottomed flask (10 mL).

CRITICAL: The lipid should be carefully covered with nitrogen to protect from oxygen. Even a small amount of oxygen would cause oxidative damage to the lipids with time.

Optional: Argon could also be used to protect phospholipids from oxygen.

Note: As this protocol is used for testing lipid peroxidation of PUFA phospholipids mediated membrane damage, it is critical to make sure PUFA phospholipids are included in the lipid mixtures. In this protocol, PUFA phospholipids were included in the soy phospholipid mixture and bovine cardiolipins. However, when using other phospholipids for example PUFA contained phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, and phosphatidylserine are all optional. According to our previous research, when approximately 2% of membrane lipids are oxidatively damaged, the liposome membrane becomes permeabilized. Therefore, at least 2% of PUFA phospholipids should be incorporated into the liposomes. The higher the concentration of PUFA phospholipids, the more easily lipid peroxidation-mediated membrane damage occurred.

• 2.Evaporate the chloroform using a vacuum rotary evaporator (BUCHI) using gentle and continuous rotation (150 rpm) under a water bath at 30°C to form an evenly spaced phospholipid film.

CRITICAL: Gentle and continuous rotation of the flask is critical for the formation of an even lipid film.

• 3.Add 500 μL of buffer H (20 mM HEPES, pH 7.4, 150 mM NaCl) into the flask and the lipid film was detached by vortex.

Optional: Sonication of the flasks also helps the detachment of phospholipids from the glass wall.

Note: The buffer H was stored at 4°C until use.

• 4.The hydrated phospholipid was draw via syringe and subjected to extrusion through a polycarbonate membrane (100 nm) 30 times using a mini-extruder (Avanti) to generate morphologically uniform liposomes.

CRITICAL: The extrusion process must be slow and gentle, with an approximate speed of 100 μL per second.

Pause point: The liposomes can be stored at 4°C for approximately one week.

Note: Pre-warming of the mini-extruder on a 65°C block greatly facilitates the solubility of some phospholipids.

Inducing POR mediated oxidative breakage of liposomes

Timing: 2 h

This section describes how to perform POR catalyzed redox reactions with liposome as the substrate.

• 5.Add liposomes (100 μg/mL), POR (100 nM), and ferric chloride (120 μM) to buffer L (20 mM HEPES, pH 7.4, 100 mM NaCl) in 50 μL system in 1.5 mL tubes. Pass Oxygen (3 L/min) into the mixture via a thin needle for 10 s.

CRITICAL: The NaCl concentration in buffer H (inside the liposomes) is higher than in buffer L (outside the liposomes), which is critical for maintaining the morphology of liposome under electron microscopy.

Note: The addition of oxygen should be done carefully to avoid spilling the reaction mixture.

Note: The buffer L was stored at 4°C until use.

Note: Appropriate controls were made: a negative control group with eliminated POR protein, a group with an equivalent amount of the POR Y178D mutant variant, and a group including the lipid peroxidation inhibitor Fer-1 (10 μM).

• 6.Initiate the reaction with the addition of NADPH (50 μM) and reacted for 90 min at 15°C–25°C.

Negative staining of liposomes and imaging under electron microscopy

Timing: 2 h

This section describes the method for negative staining liposomes for transmission electron microscopy.

• 7.EM grid pre-treatment: the EM grid (ultra-thin carbon supporting films, 300 mesh) was discharged in a plasma cleaner (PDC-32G) with a current intensity of “Low” gear for 30 s.

CRITICAL: The pre-treatment of EM grid should be performed right before use and the grids are ready by the time the reaction (step 6) is done.

Optional: Any plasma cleaner and glow discharge plasma would work as alternatives.

• 8.Liposome adsorption: 5 μL of liposomes were added to the grid for 1 min to allow attachment. The remaining liquid was carefully removed by filter paper dabbing.

CRITICAL: The liposomes in the POR-free group can be difficult to attach to the EM grid. Glycerol (1% v/v) facilitate this process.

Optional: An equivalent level of BSA (100 nM) may also facilitate liposome grid binding in the POR-free group.

• 9.Gently wash off Loosely attached liposomes, or other reaction system components with distilled water for 20 s, twice. Discard water via a filter paper.
• 10.Stain the bound liposomes with 5 μL 2% uranyl acetate for 30 s, 2 times. Discard the remaining uranyl acetate via filter paper, and the sample was allowed to dry at 15°C–25°C.

Pause point: The stained EM grid can be stored for an extended period (several weeks) before electron microscopy imaging.

Note: Liposomes were stained twice with uranyl acetate, because the remaining water on the sample would decrease concentration of uranyl acetate in the first staining process, and, further, to increase the staining depth.

• 11.Normal or oxidatively damaged liposomes were imaged on a Tecnai T12 microscope (Thermo Fisher Scientific) at 120 kV. Take the photographs on a Gatan 4k × 4k CCD camera (nominal magnification 26,000×).

Optional: Any transmission electron microscope with a similar capacity would be a suitable alternative for imaging.

Preparation of liposomes for leakage detection by spectrophotometry

Timing: 3 h

This section describes how to prepare liposome enclosing Tb³⁺ ions. These liposomes were used as substrates for POR or CYB5R1 mediated lipid peroxidation, and the leakage of Tb³⁺ ions from the liposomes was detected via spectrophotometry.

• 12.Dissolve the soy phospholipid mixture, bovine cardiolipins, and synthesized PUFA SAPE (18:0–20:4 PE) or saturated fatty acid (SFA) DPPC (16:0 PC) in chloroform (10 mg/mL each) under nitrogen and stored at −20°C. Add 100 μL of individual phospholipid, or different ratios of SAPE and DPPC combined phospholipids, into 500 μL of chloroform in a 10 mL round-bottomed flask. The evaporation of chloroform was then performed as described in step 2.
• 13.To enclose Tb³⁺ ions, the phospholipid films were hydrated and detached in 500 μL of buffer TL (20 mM HEPES, pH 7.4, 100 mM NaCl, 50 mM sodium citrate, 15 mM TbCl₃). Liposomes were then prepared as described in step 4.

CRITICAL: Pre-warming of the mini-extruder on a 65°C block is required for the solubilization of phospholipids like DPPC.

Note: The buffer TL was freshly prepared and stored on ice until use.

• 14.Unencapsulated Tb³⁺ ions were removed by extensive washing with 8 cycles of 15 mL buffer L in 100 KD cut-off ultrafiltration tubes (Millipore) and centrifugation at 4 C, after which they were re-suspended in 500 μL of buffer L.

CRITICAL: The extensive washing of external Tb³⁺ ions are crucial to a low background in the following assays. The existence of external Tb³⁺ ions can be detected by the addition 50 μM of DPA in the flowthrough buffer L and a subsequent increase in fluorescence signal (λ_ex= 270/λ_em=620 nm) (see below).

Optional: Centrifugation of the liposomes at 100,000 × g for 30 min, then washing the pellet 3 times is also feasible for obtaining external Tb³⁺ ions free liposomes.

Pause point: The liposomes may be stored at 4°C for approximately one week.

Inducing POR/CYB5R1 mediated oxidative breakage of liposomes encapsulating Tb³⁺

Timing: 1 h

This section describes how to perform the POR and CYB5R1 catalyzed redox reactions on liposomes encapsulating Tb³⁺.

• 15.Dilute liposomes encapsulating Tb³⁺ (100 μg/mL), oxidoreductase (100 nM), ferric chloride (120 μM), and DPA (50 μM) into 100 μL of buffer L. Pass oxygen (3 L/min) into the mixture via a thin needle for 10 s. Add nicotinamide adenine dinucleotide phosphate (NADPH) or nicotinamide adenine dinucleotide (NADH) (50 μM) into the mixture to initiate the reaction.

Note: In the negative control groups, no oxidoreductase, NADPH, or ferric chloride were added. In some groups, WT or mutant POR proteins were included. When analyzing the additive effect of POR and CYB5R1, 100 nM each of the protein was added. In some groups, Fer-1 (1 μM) or Lip-1 (1 μM) were added.

Note: NADPH is an electron donor for POR, and NADH is an electron donor for CYB5R1. When analyzing the additive effect of POR and CYB5R1, both electron donors were included in the mixtures.

• 16.As soon as NADPH and/or NADH was added, the fluorescence signal (λ_ex= 270/λ_em=620 nm) was measured via microplate reader as Ft₀. Then, the fluorescence signals were recorded at 20 s intervals for about 120 times (about 40 min), after which 1 μL of Triton X-100 (0.1%, v/v) was added to the liposomes to completely release the Tb³⁺ ions. The fluorescence signal value achieved by Triton X-100 was recorded as Ft₁₀₀. At each time point (Ft), the percentage of liposome leakage was defined as: Leakage (t) % = [(Ft-Ft₀) / (Ft₁₀₀-Ft₀)] × 100.

CRITICAL: Previous research (Wang et.al., 2014) used emission wavelength λ_em=490 nm to detect the fluorescence signal of Tb³⁺/DPA chelates. NADPH has a strong signal under λ_em 490 nm but is not detected under λ_em 620 nm. Additionally, λ_em 620 nm gives a higher signal for Tb³⁺/DPA than λ_em 490 nm. Therefore we use λ_em 620 nm in this assay.

Expected outcomes

When observed by electron microscopy, liposomes will be a little heterogeneous, with sizes ranging from 50 to 200 nm in diameter. The morphology of liposomes will not always round, and “antenna” like structures are also common. The extent of “antenna” decorating liposomes varies depending on the different lipid compositions. In contrast with the intact liposomes in the control group (Figure 1A left), any liposomes with ruptured membranes (top right in Figure 1A right), fragmented morphology (lower left in Figure 1A right), or holes (lower right in Figure 1A right) were categorized as damaged liposomes. POR, but not POR Y178D mutant, mediated oxidative damage of liposomes will rupture and fragment the liposome membrane. Fer-1 will block the POR mediated oxidative damage of liposomes (Figures 1A and 1B).

Figure 1.

POR and CYB5R1 mediated liposome damage detected under electron microscopy

(A) Negative stain electron microscopy of liposomes treated with or without POR. White arrowheads indicated broken liposomes. The ratios of unbroken liposomes/total liposomes were calculated (n > 40 of liposomes in each group). Scale bars, 200 nm. Student’s t test (two-tailed, unpaired) with mean ± SD was used for the comparison of the indicated two groups: ∗∗∗p < 0.001.

(B) Transmission electron microscopy images of liposomes treated with POR or POR Y178D in the absence or presence of Fer-1. These data are from the original Figure 6 in Yan et al., 2020.

When assessed by spectrophotometry, POR/CYB5R1 will induce liposome leakage by increasing Tb³⁺/DPA fluorescence. POR mutants or Fer-1/Lip-1 will block these processes. POR mediated increase of Tb³⁺/DPA fluorescence signal will occur when any PUFA are present (soy phospholipid mixture, bovine cardiolipins, or SAPE). POR will not cause leakage when liposomes are totally comprised from SFA (DPPC) (Yan et al., 2020) (Figure 2).

Figure 2.

POR and CYB5R1 mediated liposome damage detected by spectrophotometry

(A) Time courses of liposome leakage. Asterisks indicated the time points when Triton X-100 was added to achieve complete the release of Tb³⁺.

(B) Fer-1 and Lip-1 blocked POR induced liposome leakage.

(C) The liposome leakage caused by POR, CYB5R1, or both proteins.

(D) The leakage levels of different ratios of SFA-phospholipids DPPC and PUFA phospholipids SAPE containing liposomes induced by POR.

(E) Time courses of liposome leakage induced by different POR variants (100 nM).

(F) Time courses of liposome leakage in the present of POR. Liposomes constituted from bovine heart cardiolipins.

These data are from the original Figure 6 and Figure S6 in Yan et al., 2020.

Limitations

• •The proteins used in this protocol are purified from bacterium. It is unclear whether the enzymatic activity of POR/CYB5R1 would be different when they are purified from mammalian cells.
• •The proteins used in this protocol are deficient in their transmembrane domain. It is unclear whether the transmembrane domain of POR/CYB5R1 would affect their function in these in vitro assays.
• •Special instruments are required (i.e., PLASMA CLEANER and electron microscope) to observe POR mediated membrane damage.
• •The pore size formed by POR/CYB5R1 is not assessed. Fluorescent labeled dextran with different molecular weights could be used as an encapsulated substrate to reflect pore size during oxidative membrane damage.
• •The types, ratio, and composition of lipids in this assay may not fully reflect the membrane lipid composition.
• •The liposomes used in this protocol are membrane protein free. The potential impact of membrane proteins on lipid peroxidation-mediated membrane damage is an unknown.

Troubleshooting

Problem 1

Enzyme-independent damage of liposomes in the presence of ferric chloride (step 1).

Potential solution

PUFA phospholipids are easily oxidized when exposed to oxygen, and oxidative damage in phospholipids can be amplified by iron in a non-enzymatic catalyzed manner. Therefore, phospholipids resolved in chloroform need to be carefully protected from oxygen by inert gas, such as nitrogen or argon, to lower the background.

Problem 2

Few liposomes attached into EM grid in the POR-free group (step 8).

Potential solution

Proteins in the reaction mixture facilitate the attachment of liposome to EM grid. In the blank control group where no POR protein is added, glycerol (1% v/v) or similar concentration of BSA (100 nM) can be added to increase the binding between the liposome and EM grid.

Problem 3

Insoluble of phospholipids during extrusion process (step 13).

Potential solution

Higher concentrations of phospholipids are not easy to fully solubilize. In particular, when only SFA DPPC is included it is extremely difficult to maintain solubility during extrusion. Pre-warming of the mini-extruder on a 65°C blocker greatly facilitates the solubility of DPPC. Moreover, lowering the concentration of DPPC (less than 2 mg/mL) facilitates the extrusion process.

Problem 4

High fluorescence background in the spectrophotometry assay (step 14).

Potential solution

Only a portion of the Tb³⁺ ions are encapsulated into liposomes during the extrusion processes, a great deal of Tb³⁺ ions remain outside of liposomes. It is important to ensure the external Tb³⁺ ions are absolutely washed out. Regularly checking for Tb³⁺ ions in the flowthrough fraction in the 100 KD cut-off concentrate tube by adding DPA is important. Ideally, the fluorescent signal of the flowthrough fraction is close to the value of buffer L plus DPA, indicating a low contamination of external Tb³⁺.

Problem 5

High fluorescence background caused by NADPH (step 16).

Potential solution

NADPH, or other components in your assay system, might give a high fluorescence background. Reducing the concentrations of contaminated fluorescence materials would decrease the background but sometimes this can cause inefficient enzymatic reactions. Another method is to re-scan the excitation and emission wavelength spectrum of the contaminated fluorescence material and the target, to achieve an optimal excitation and emission wavelength for the assay. A combination of these two methods is also viable.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Xiaodong Wang (wangxiaodong@nibs.ac.cn).

Materials availability

All recombinant vectors expressing WT or mutant POR proteins and CYB5R1 are available upon reasonable request from the lead contact without restriction.

Data and code availability

This study did not generate/analyze datasets/code.