Skip to main content
NCBI home page
Microbial Biotechnology logoLink to Microbial Biotechnology
. 2020 Nov 7;14(2):628–642. doi: 10.1111/1751-7915.13701

The membrane mucin Msb2 regulates aflatoxin biosynthesis and pathogenicity in fungus Aspergillus flavus

Ling Qin 1, Ding Li 1, Jiaru Zhao 1, Guang Yang 1, Yinchun Wang 1, Kunlong Yang 1, Elisabeth Tumukunde 1, Shihua Wang 1,✉, Jun Yuan 1,✉
PMCID: PMC7936294  PMID: 33159717

Msb2 is important for growth, conidia and sclerotia formation in Aspergillus flavus. Msb2 play negative roles in regulation of aflatoxins biosynthesis.

graphic file with name MBT2-14-628-g010.jpg

Summary

As a pathogenic fungus, Aspergillus flavus can produce carcinogenic aflatoxins (AFs), which poses a great threat to crops and animals. Msb2, the signalling mucin protein, is a part of mitogen‐activated protein kinase (MAPK) pathway which contributes to a range of physiological processes. In this study, the roles of membrane mucin Msb2 were explored in A. flavus by the application of gene disruption. The deletion of msb2 gene (Δmsb2) caused defects in vegetative growth, sporulation and sclerotia formation when compared to WT and complement strain (Δmsb2C) in A. flavus. Using thin‐layer chromatography (TLC) and high‐performance liquid chromatography (HPLC) analysis, it was found that deletion of msb2 down‐regulated aflatoxin B1 (AFB1) synthesis and decreased the infection capacity of A. flavus. Consistently, Msb2 responds to cell wall stress and osmotic stress by positively regulating the phosphorylation of MAP kinase. Notably, Δmsb2 mutant exhibited cell wall defect, and it was more sensitive to inhibitor caspofungin when compared to WT and Δmsb2C. Taking together, these results revealed that Msb2 plays key roles in morphological development process, stresses adaptation, secondary metabolism and pathogenicity in fungus A. flavus.

Introduction

Aspergillus flavus is a famous plant pathogenic fungus, which is notorious as the main producer of aflatoxins (AFs) (Amaike and Keller, 2011). A. flavus can contaminate many agricultural crops (such as maize, peanut, cotton and so on) causing huge economic losses (Wu et al., 2014). Studies have shown that food contaminated by low concentration of AFs may lead to hepatocellular carcinoma, while high concentration of AFs can be toxic, and in some cases could be fatal (Amare and Keller, 2014). A 70 kb gene cluster was identified for AFs biosynthesis which encodes about 25 enzymes and other key regulatory proteins in A. flavus (Bhatnagar et al., 2003). Previous studies have demonstrated that internal and external factors controlled the AF biosynthesis, such as developmental stage and hyperosmolarity (Tsitsigiannis and Keller, 2006; Zhang et al., 2018a, 2018b,2018a, 2018b). These outcomes have indicated that an appropriate respond to environmental changes is essential for AF biosynthesis in A. flavus.

Environmental stimuli beyond the physiological range can be a matter of life or death for all cells (Aguilera, 2002). Mitogen‐activated protein kinases (MAPKs) cascades are evolutionarily conserved signalling units that are utilized for signal transduction in diverse eukaryotic organisms (Chen et al., 2001). Five main MAPK signalling pathways have been identified and characterized in Saccharomyces cerevisiae, including the high osmolarity glycerol (HOG) pathway, the mating response pathway, filamentous and invasive growth (FIG) pathway, cell wall integrity (CWI) pathway and pheromone pathway (Saito and Posas, 2012). But in A. flavus, only three central MAP kinases orthologous to yeast, including SakA (Hog1), Slt2 (MPKA) and Fus3 (MPKB), have been described (Tumukunde et al., 2019; Zhang et al., 2020; Frawley et al., 2020). These MAP kinases have distinct functions in asexual sporulation, sclerotia formation and aflatoxin production. However, each MAPK module is activated by specific types of stimuli and received signalling by specific sensors (Free, 2013; Tanaka et al., 2014; Chow et al., 2019).

Signalling mucin protein Msb2, as one of the putative osmosensor in S. cerevisiae, initiates signalling response in the HOG pathway (Tatebayashi et al., 2007). Interestingly, the Msb2 homologue protein MsbA in Aspergillus fumigatus exhibits different functions, which are essential for stresses adaptation, and in resistance to antifungal drugs through modulating the gene expression of the CWI pathway (Gurgel et al., 2019). Also, the signalling mucin Msb2 protein activates the CEK1‐MAPK pathway in human fungal pathogen Candida albicans (Puri et al., 2012), Pmk1‐MAPK (homologous to Fus3 in S. cerevisiae) pathway in the rice blast Magnaporthe oryzae (Wang et al., 2015), and the CWI pathway in Aspergillus nidulans (Brow et al., 2014). Moreover, Msb2 protein has been extensively characterized as an external sensor activating Fmk1, a MAP kinase in FIG pathway, for cell growth in Fusarium oxysporum (Perez‐Nadales and Di Pietro, 2015).

Although the roles of Msb2 have been addressed in multiple filamentous fungi, such as involving in plant infection in F. oxysporum and Ustilago maydis, appressorium formation in M. oryzae, and hyphal growth in Histoplasma capsulatum (Pérez‐Nadales and Di Pietro, 2011; Wang et al., 2015; Rodriguez et al., 2019), the function of this protein in A. flavus was poorly understood. In this study, Aflmsb2 deletion and complement mutants were generated, and the results demonstrated that AflMsb2 functioned in fungal growth, asexual development and sclerotia formation in A. flavus. The results also showed that Aflmsb2 was crucial for osmotic adaptation and cell wall integrity. Notably, AflMsb2 was involved in keeping chitinase activity of A. flavus and contributed to the caspofungin resistance. Furthermore, this study also provided a first time report of the relationship between mucin protein AflMsb2 and aflatoxin biosynthesis in A. flavus.

Results

Identification and analysis of Msb2 in A. flavus

To identify orthologs of the S. cerevisiae Msb2 in A. flavus, the protein sequence of S. cerevisiae (NP_011528.3) was used with a basic local alignment search tool algorithm (BLAST), and an orthologs gene was identified in A. flavus named Aflmsb2 (AFLA_114450). Aflmsb2 was predicted to encode 959 amino acids that contains a conserved transmembrane region domain at the C‐terminal (Fig. 1A). The phylogenetic analysis of signalling mucin Aflmsb2 showed a high conservation to Msb2 orthologue proteins from different fungi (Fig. 1B). Among them, Msb2 protein sequence of A. flavus exhibited the strongest similarity to that of A. oryzae which has been identified as a transmembrane mucin.

Fig. 1.

Fig. 1

Open in a new tab

Bioinformatics analysis of the membrane mucin Msb2 proteins from 10 different fungi: A. flavus (XP_002385498.1), A. oryzae (OOO03851.1), A. nomious (XP_015401032.1), A. niger (XP_001400709.1), A. kawachii (GAA_87196.1), A. fumigatus (XP_746593.1), A. nidulans (EAA61687.1), B. cinerea (B0510_3063T1.1), N. crassa (XM_951053.3) and S. cerevisiae (NP_011528.3).

A. Domains from Msb2 proteins were identified using online tools SMART and visualized by dog2.0 software.

B. Phylogenetic relationship of Msb2 in the selected fungi was analysed and visualized by mega7.0.

Msb2 is involved in vegetative growth

To evaluate the function of Aflmsb2 in A. flavus, Aflmsb2 deletion (Δmsb2) and complement (Δmsb2C) mutants were constructed by homologous recombination. The transformants were confirmed by PCR analysis with three pairs of primers, and the results showed that the AP and BP fragments were contained in both Δmsb2 and Δmsb2C mutant strains, but absent in wild type (WT), indicating that the A. fumigatus pyrG gene had completely replaced the msb2 gene in A. flavus (Fig. 2A). Expression levels of msb2 in the WT, Δmsb2 and Δmsb2C were confirmed by RT‐PCR and qRT‐PCR respectively, and the results shown in Figure 2B and C proved that Aflmsb2 gene was existed in the WT and Δmsb2C, but was missing in Δmsb2. Ultimately, the deletion strain was further verified by Southern blot, which indicated that Aflmsb2 was successfully disrupted in the mutants (Fig. 2D). Colony morphology was observed after incubation at 37°C in dark for 4 days, and the result indicated a reduction in the growth rate of the Δmsb2 strains as compared to the WT and Δmsb2C strains in minimal medium (MM), complete medium (CM) and glucose minimal medium (GMM) (Fig. 2E and F), suggesting a defect in vegetative growth.

Fig. 2.

Fig. 2

Open in a new tab

Construction of the deletion (Δmsb2) and complement (Δmsb2C) mutant strains.

A. Verification of Δmsb2 and Δmsb2C mutant strains by PCR, using gDNA as template.

B. Confirmation of Δmsb2 and Δmsb2C mutant strains by RT‐PCR, using cDNA as template.

C. Expression levels of msb2 in WT, Δmsb2 and Δmsb2C mutant strains detected by qRT‐PCR.

D. Confirmation of the deletion mutant by Southern blot.

E. WT, Δmsb2 and Δmsb2C strains were grown on MM, GMM and CM plates, respectively, for 4 days.

F. Colony diameter of all the strains as in E was assayed. ND = Not detectable. **, denotes P < 0.01.

Msb2 is involved in conidiation

Conidia is produced at the hypha tip, which is one of the most important asexual reproduction in A. flavus (Amaike and Keller, 2011). For analysis of the function of Msb2 in conidiation, the WT and mutant strains were grown on PDA medium for 4 days. Following microscopic observations, Δmsb2 strain exhibited a growth reduction on PDA medium plates (Fig. 3A and B) and produced less and shorter conidiophores in comparison to the WT and Δmsb2C mutant strains (Fig. 3C). With respect to defect in conidiophores, we also found that the number of conidia was significantly decreased in Δmsb2 mutant, as compared to the WT and Δmsb2C strains (Fig. 3D). We further studied the expression levels of regulatory genes for conidial formation (brlA and abaA) and global regulator gene (veA), and the result showed that the expression levels of brlA, abaA and veA genes were all down‐regulated in the Δmsb2 strain in comparison to Δmsb2C and WT strains (Fig. 3E). All above results demonstrated that AflMsb2 is involved in conidial formation and vegetative growth in A. flavus.

Fig. 3.

Fig. 3

Open in a new tab

Phenotype and conidia production of strains.

A. WT, Δmsb2 and Δmsb2C strains of A. flavus were grown on PDA plates for 4 days.

B. Colony diameter in PDA medium was assayed.

C. Microscopic observation of conidiophores after 12 h incubation on PDA medium.

D. Conidia production of WT, Δmsb2 and Δmsb2C strains.

E. qRT‐PCR analysis of the expression levels of genes abaA, brlA and veA among WT, Δmsb2 and Δmsb2C strains. Bars = 200 μm. * and ** denotes P < 0.05 and P < 0.01, respectively.

Msb2 positively regulates sclerotia formation in A. flavus

Different to conidia, sclerotium is one of the alternative reproduction to survive in the adverse environments in A. flavus (Dyer and O'Gorman, 2012). To validate the function of Msb2 in formation of sclerotium, WT, Δmsb2 and Δmsb2C strains were cultured on sclerotia‐inducing WKM solid medium, at 37℃ under dark condition for 7 days. As shown in Figure 4A and B, Δmsb2 mutant barely able to generate sclerotium, whereas WT and Δmsb2C could produce similar amounts of sclerotia. In addition, we had detected the expression levels of nsdC and sclR genes, which are indispensable for sclerotia generation (Cary et al., 2012). As expected, the transcript levels of sclR and nsdC were both declined sharply in the Δmsb2 strain when compared to Δmsb2C and WT strains, and the expression level of global regulator veA gene had also decreased (Fig. 4C). All these observed results strongly indicated that Msb2 plays a key role in sclerotia production of A. flavus.

Fig. 4.

Fig. 4

Open in a new tab

Phenotype analysis of msb2 on sclerotia formation.

A. Phenotypes of WT, Δmsb2 and Δmsb2C grown on WKM plates in dark condition for 7 days.

B. The number of sclerotia production in WT, Δmsb2 and Δmsb2C strains respectively.

C. The expression levels of sclerotia production related genes (sclR and nsdC) and global regulator gene (veA) among WT, Δmsb2 and Δmsb2C strains, respectively. * and *** denotes P < 0.05 and P < 0.001, respectively.

Effect of msb2 on aflatoxin biosynthesis

A. flavus is notorious for its ability to produce aflatoxins (AFs), which are one of the most toxic and carcinogenic natural contaminants (Amare and Keller, 2014). In order to determine the specific function of Msb2 in AFs biosynthesis, WT, Δmsb2 and Δmsb2C strains were cultured in liquid YES medium for 7 days, and AF production was tested by TLC and HPLC, respectively. TLC results indicated that AFB1 production in Δmsb2 mutant strains was significantly decreased when compared to that of the WT and Δmsb2C mutants (Fig. 5A and C). Quantitative analysis by HPLC further confirmed that AFB1 production was down‐regulated in Δmsb2 mutants (Fig. 5B). Additionally, to explore the possible reasons for the resultant decrease in AF production in Δmsb2 mutant strain, we detected transcript levels of aflatoxin biosynthesis related genes (aflC, aflR and aflQ) and secondary metabolism regulator genes (veA and laeA) (Cary et al., 2015). The results revealed that the expression levels of aflC, aflR, aflQ, veA and laeA were all decreased significantly in Δmsb2 in comparison to Δmsb2C and WT strains (Fig. 5D). In overall, these data demonstrated that Msb2 was involved in the regulation of aflatoxin biosynthesis in A. flavus through dominating the transcription of global regulators and aflatoxin‐producing related genes.

Fig. 5.

Fig. 5

Open in a new tab

Analysis of aflatoxin production.

A. Aflatoxin was detected by TLC after 7 days incubation on YES liquid medium at 29°C in dark.

B. Analysis of aflatoxin production in WT, Δmsb2 and Δmsb2C strains by HPLC.

C. Quantification of AFB1 production as in (A).

D. Transcript levels of aflC, aflR, aflQ, veA and laeA genes from WT, Δmsb2 and Δmsb2C strains. ** and *** denotes P < 0.01 and P < 0.001, respectively.

Msb2 contributes to the pathogenicity

Since msb2 gene exhibited a variety of functions in growth, asexual conidia production, sclerotia formation and AFB1 biosynthesis, we anticipated that msb2 might influence strain colonization on plant seeds. So peanut seeds and Chinese chestnut were inoculated with the WT, Δmsb2 and Δmsb2C mutant strains. Visually, the WT and Δmsb2C strains showed stronger ability to infect and sporulate on peanut and Chinese chestnut surface in comparison to Δmsb2 mutant (Fig. 6A and B). Then, the amount of conidia in the infected seeds was measured, and we found that conidia number was significantly decreased in Δmsb2 mutant compared to Δmsb2C and WT (Fig. 6E). Further determination of AFB1 production from the infected seeds by TLC indicated that the AFB1 production in Δmsb2 mutant was also significant reduced as compared with the WT and Δmsb2C mutant (Fig. 6C, D and F). These data confirmed that msb2 is crucial for A. flavus maintaining full pathogenicity to plant seeds.

Fig. 6.

Fig. 6

Open in a new tab

Pathogenicity of the WT, Δmsb2 and Δmsb2C strains on plant seeds.

A. Morphology of all strains grown on peanuts seeds at 29°C for 6 days.

B. Morphology of all strains grown on Chinese chestnut at 29°C for 6 days.

C. TLC measurements of AFB1 extracted from peanuts seeds.

D. TLC measurements of AFB1 extracted from Chinese chestnut.

E. Conidia production on peanuts and Chinese chestnut shown in A and B.

F. Quantification analysis of AFB1 shown in C and D. **: P < 0.01. Std: standard AFB1.

Msb2 positive regulates phosphorylation of Hog1 in response to osmostress

Previous studies have reported Msb2 protein as a part of HOG‐MAPK pathway, played roles in various stress responses in fungi (Puri et al., 2012; Gurgel et al., 2019). Due to the osmosensor role of Msb2 in signal transduction in S. cerevisiae (Saito and Posas, 2012), we are especially interested in the role of AflMsb2 when facing hyperosmotic pressure. Then, osmotic stress (water activity, 0.95Aw and NaCl, 1.2M/L) were used in the YES solid medium, and the results showed that Δmsb2 mutant was more sensitive to the osmotic stress when compared to Δmsb2C mutant and WT (Fig. 7A and B). Furthermore, cell growth upon high osmotic stress was also significantly inhibited in Δmsb2 strain (Fig. 7C). After 4 h culture, defect in conidia germination was found in Δmsb2, and more severe situation appeared in the group which treated with NaCl (400× magnification). At 8 and 12 h, growth of Δmsb2 was also obviously inhibited upon high osmotic stress (Fig. 7C). To confirm the relationship between Aflmsb2 and HOG‐MAPK pathway, we detected the phosphorylation levels of Hog1 kinase in the WT and Δmsb2 mutant under osmotic stress (1.2 M l−1 NaCl) at different times (0, 10, 30, 60 min). The WT and Δmsb2 strains showed increased Hog1 phosphorylation after exposed to 1.2 M l−1 NaCl for 10 min. However, the phosphorylation level of Hog1 in Δmsb2 mutant was lower than that in the WT. At 30 min, phosphorylation levels of Hog1 were both decreased in the WT and Δmsb2 mutant as compared to 10 min, but the Hog1 phosphorylation in WT was still higher than that in the Δmsb2 mutant (Fig. 7D). The protein expression levels of Hog1 were determined in the WT and Δmsb2 mutant as well, and the result showed that Hog1 expressed no difference among these indicated strains under different conditions (Fig. 7D and E). In overall, these results suggested that AflMsb2 plays an important role in osmotic stress and involves in the phosphorylation of Hog1 in response to osmotic stress.

Fig. 7.

Fig. 7

Open in a new tab

Deletion of msb2 affects osmotic stress response in A. flavus.

A. Colony morphology of the WT, Δmsb2 and Δmsb2C strains cultured on YES medium under osmotic stress (0.95Aw and 1.2 M l−1 NaCl) at 37°C for 4 days.

B. Growth inhibition rate of WT, Δmsb2 and Δmsb2C strains was calculated based on A.

C. Microscopic observation of WT, Δmsb2 and Δmsb2C strains on YES liquid medium with osmotic stress (1.2 M l−1 NaCl) (bars = 50µm) .

D. Phosphorylation levels of Hog1 in strains were measured by phosphor‐p38 MAPK antibody under NaCl stress, while Hog protein was used as loading control.

E. Optical density semi‐quantitative analysis of the phosphorylation levels of Hog1 in the WT and Δmsb2 strains. **, denotes P < 0.01.

Msb2 involves in CWI pathway

CWI‐MAPK pathway was first discovered and identified in yeast, for it responses to cell wall stress maintaining normal life activities (Sanz et al., 2017). Slt2, MAP kinase, is the core component of CWI pathway which transmits a signal to the nucleus when cell surface sensors perceive the cell wall stress (Sanz et al., 2018). To explore the function of Msb2 in CWI, we cultured all strains on PDA media supplemented with cell wall‐damaging agent Congo red (CR) and cell membrane inhibitor Sodium Dodecyl Sulfate (SDS). The results showed that the growth inhibition rate of Δmsb2 mutant in different additive media was significantly increased as compared to that of the WT and Δmsb2C mutant (Fig. 8A and B). To test the phosphorylation level of Slt2, WT and Δmsb2 mutant were cultured in YES liquid media and treated with CR for 15 min. Western blotting results showed that the levels of phosphorylated Slt2 in indicated strains were significantly increased when induced by CR. However, there is a lower Slt2 phosphorylation level in Δmsb2 strain than that in the WT under the stress (Fig. 8C and D), suggesting that Msb2 is able to impact the phosphorylation of Slt2 and involves in CWI pathway.

Fig. 8.

Fig. 8

Open in a new tab

Deletion of msb2 affects cell wall stress response in A. flavus.

A. Colony morphology of WT, Δmsb2 and Δmsb2C strains cultured on PDA medium with stress agents (300 μg ml−1 CR and 100 μg ml−1 SDS) at 37°C for 4 days.

B. Inhibition rate of growth was calculated based on A.

C. Phosphorylation levels of Slt2 were measured under stress (300 μg ml−1 CR), while Slt2 protein was used as loading control.

D. Optical density semi‐quantitative analysis of the phosphorylation level of Slt2 in the WT and Δmsb2 strains. ** and *** denotes P < 0.01 and P < 0.001, respectively.

Msb2 mutant has cell wall defects

The cell wall components mainly contain β‐glucan and chitin in fungi (Gow et al., 2017). Δmsb2 mutant from A. flavus exhibits hypersensitivity to cell wall stress, so we suspected that Msb2 may have some effects on glucan synthase and chitinase activity. To test these hypotheses, all strains were cultured on YES liquid media supplemented with caspofungin which is an inhibitor of β‐1,3‐glucan synthase. As shown in Figure 9A, the Δmsb2 mutant was more sensitive to caspofungin when compare to the WT and Δmsb2C. Interestingly, the chitinase activity of Δmsb2 mutant was also significantly decreased (Fig. 9B). Then, the expression levels of two chitin synthase genes (AFLA_114760 and AFLA_060590) and one β‐glucan synthase gene (AFLA_023460) were quantified. Under CR stress, the expression levels of three relative genes in Δmsb2 mutant were markedly reduced in comparison with that in the WT and Δmsb2C (Fig. 9C). The aforementioned results suggested that Msb2 plays a crucial role in maintaining cell wall integrity.

Fig. 9.

Fig. 9

Open in a new tab

Deletion of msb2 defects the cell wall integrity in A. flavus.

A. WT, Δmsb2 and Δmsb2C strains were grown on YES liquid media with caspofungin (10 μg ml−1) and cultured at 37°C for 72 h.

B. Chitinase activity was measured in WT, Δmsb2 and Δmsb2C strains of A. flavus.

C. qRT‐PCR analysis of the expression levels of β‐1,3‐glucan and chitin synthase related genes (AFLA_023460 = Aflags1, AFLA_114760 = AflchsB, AFLA_060590 = AflchsG). * and ** denotes P < 0.05 and P < 0.01, respectively.

Discussion

MAPK cascades are essential for signal transduction in diverse eukaryotes including yeast and other fungi (Martínez‐Soto and Ruiz‐Herrera, 2017). HOG is one of the best understood MAPK pathways in yeast which play important roles in response to the stimuli from outside environments (Saito and Posas, 2012). The mucin‐like protein Msb2 is located on the cell membrane, acting as an osmosensor upstream the HOG pathway in S. cerevisiae (Tatebayashi et al., 2007). In the plant and animal pathogenic fungus A. flavus, our previous works suggested that three kinases of the HOG pathway play crucial roles in plant infection, aflatoxin biosynthesis and morphogenesis (Yuan et al., 2018; Tumukunde et al., 2019). But the role of AflMsb2 which has a typical transmembrane domain was yet to be identified (Fig. 1). In this study, we committed to investigate the biological function of Msb2 in A. flavus.

Msb2 is important for vegetative growth in many filamentous fungi. In A. fumigatus, MsbA is required for the conidiation and hyphal growth (Gurgel et al., 2019), and the homologous protein MsbA in A. nidulans regulates not only conidiation process but also vegetative growth (Brow et al., 2014). In Cryptococcus neoformans and C. albicans, Msb2 plays essential roles during vegetative growth (Román et al., 2009; So et al., 2018). The current study demonstrated retarded growth, and a substantial reduction in conidial production in Δmsb2 mutant in comparison to the WT. Following the similar trend, the expression levels of key regulator genes brlA and abaA, which control asexual development, were also markedly reduced. In addition to conidiation, Msb2 also engages in sclerotia formation that helps the fungus survival in adverse environments. The sharp decrease of sclerotia formation in Δmsb2 mutant was also verified by the down‐regulation of sclR and nsdC (Fig. 4). Interestingly, qRT‐PCR results also showed the decreased expression level of veA in ∆Aflmsb2 in different culture conditions. In filamentous fungus A. niger, veA regulated conidia production through the development gene brlA which mediates the budding growth of conidiophores (Zhang et al., 2018a, 2018b,2018a, 2018b). As a global regulator, veA is necessary for sclerotia formation in A. flavus (Cary et al., 2007; Duran et al., 2007). Therefore, it could be speculated that Msb2 regulates conidial and sclerotia formation related genes, further effluences the conidia and sclerotia production in A. flavus.

Secondary metabolites synthesis in filamentous fungi is complicated (Yu et al., 2004a, 2004b,2004a, 2004b). In S. cerevisiae, Msb2 regulated the activity of p21‐activated protein kinases (PAKs) Ste20 and Cla4 (Tanaka et al., 2014). Similarly, the report from previous study further verified that the loss of PAKs Aflste20 would lead to the impaired colonization and reduced AFB1 production (Li et al., 2019). It hints that genes in HOG pathway are important for AFB1 production in A. flavus. In this study, the AFB1 production was significantly decreased in ΔAflmsb2 mutant. To further study the mechanism of Aflmsb2 in AFB1 synthesis, we also detected the expression levels of structural genes (aflC and aflQ) and regulatory gene (aflR) in aflatoxin biosynthesis gene cluster, and we found that they were all down‐regulated in ΔAflmsb2 mutant (Fig. 5). Based on the functional genomics and transcriptome analysis of A. flavus, the results reveal that veA regulated secondary metabolite gene clusters (Cary et al., 2015, 2007). Especially, veA controls aflatoxin synthesis cluster and directly impact the aflR, aflD, aflM and aflP transcripts (Duran et al., 2007). Previous study also showed that both laeA and veA genes are required for AFB1 production in A. flavus (Kale et al., 2008). In this study, expression levels of laeA and veA in ∆Aflmsb2 were both significantly lower than that in WT. Therefore, we conclude that msb2 is involved in AFB1 production and regulation of aflatoxin synthesis gene expression in A. flavus, most likely through veA and laeA.

Plant infection is a complex process and changes in the composition of cell wall of pathogenic fungus can reduce its ability to penetrate plant tissues (Geoghegan et al., 2017). In A. flavus, pathogenicity defect of msb2 mutant occurred in seeds infection experiments, and the growth retardation and decreased conidiation in ΔAflmsb2 mutant could explain the defect of pathogenicity. On the other hand, the defective in cell wall integrity may strongly affect the infection ability of ΔAflmsb2. In A. fumigatus and A. nidulans, it also showed the greatest reduction in mortality rate of mice for msb2 deletion mutant compared to that for WT (Brow et al., 2014; Gurgel et al., 2019). msb2 deletion mutant of U. maydis showed reduced colonization and appressoria in the plant surface (Lanver et al., 2010). It also reported that the mucin protein Msb2 is a broad range protectant against antimicrobial peptides in C. albicans (Swidergall et al., 2013). All these results indicated the important roles of msb2 in self‐protection and pathogenicity in fungi.

In cells, genes change expression models to adapt the rapidly varying in environmental conditions (Karpinets and Foy, 2005). MAPK cascades regulate many biological processes and the most striking aspect is the role of MAP kinases (Lee et al., 2016). Msb2, as an osmosensor, was already identified in S. cerevisiae (Tanaka et al., 2014). In C. albicans, Msb2 can regulate adaptation to thermal stress, cell wall stress, oxidative stress and other stimuli (Román et al., 2009; Puri et al., 2012; Swidergall et al., 2013). Our results showed that under osmotic stress, Δmsb2 mutant became more sensitive and had decreased phosphorylation level of Hog1 than WT (Fig. 7). The similar results were also occurred in C. albican and F. oxysporum, but needs hyperosmotic stress (minimum 1.5 M l−1 NaCl) (Pérez‐Nadales and Di Pietro, 2011; Puri et al., 2012). We also noticed that the phosphorylation of Hog1 in C. neoformans msb2 deletion mutant was not affected when responding to osmotic shock (1 M l−1 NaCl). This outcome could be as a result that sho1 has an overlapping function with msb2 in C. neoformans HOG pathway (So et al., 2018). Surprisingly, at least five osmosensors (Msb2, Sho1, Sln1, Opy2 and Hkr1) were found to adapt hyperosmolarity in S. cerevisiae. There results suggested that Msb2 is important for full activation of the HOG pathway and positively regulate the Hog1 phosphorylation in A. flavus. But the exact role of Msb2 in the HOG pathway signal transduction needs further investigation.

The cell wall of fungi has a crucial role in cell division and hyphal development (Geoghegan et al., 2017). It has been reported that Msb2 homologues in A. nidulans, C. albican and F. oxysporum regulated the Slt2 (Mkc1) phosphorylation which was important for the cell wall biogenesis (Román et al., 2009; Brow et al., 2014; Perez‐Nadales and Di Pietro, 2015). Therefore, we are not surprised that ΔAflmsb2 mutant exhibited increased sensitivity to CR, SDS and caspofungin (Figs 8 and 9). As expected, the expression levels of cell wall chitin synthase genes and β‐glucan synthase gene were significantly decreased in ΔAflmsb2 mutant. The CR‐induced Slt2 phosphorylation level was also reduced in the ΔAflmsb2 mutant, indicating that AflMsb2 positively regulates the phosphorylation level of Slt2 in A. flavus. At the same time, our results also showed the reduced chitinase activity in ΔAflmsb2 mutant of A. flavus. Similarly, in A. fumigatus, MsbA positively modulates expression level of the chitin synthases (chsA, chsB), β‐1,3‐glucan synthase (fksA) and other related genes in the CWI pathway (Gurgel et al., 2019). MsbA interferences the chitin production in the cell wall and biofilm formation in A. nidulans (Brow et al., 2014). Interestingly, not only Δmsb2 mutant but also Δsho1 mutant has cell wall defects in C. albican. Collectively, AflMsb2 plays a positive role in the activation of the phosphorylation of Slt2 and is important for cell wall biogenesis.

Overall, these results lead us to understand the role of msb2 in reproduction, aflatoxins biosynthesis and pathogenicity in A. flavus. Our findings also provide a novel insight into the controlling of AF production and A. flavus in oil crops and food during storage.

Experimental procedures

Strains and media

Aspergillus flavus CA14 PTS (Δku70ΔpyrG, uracil auxotrophic) (Chang et al., 2010) was used as the parental strain for transformation. For pyrG auxotroph, the solid medium was supplied with uracil and uridine (1 g l−1 for each). The strains in this study were cultured on yeast extract‐sucrose (YES), minimal medium (MM), potato dextrose agar (PDA), glucose minimal medium (GMM) and complete medium (CM) for conidiation and mycelia growth assays, respectively (Ren et al., 2019). The sclerotia‐inducing Wickerham (WKM) medium was used for sclerotia assays. YES liquid medium was used for AFB1 assays. Each experiment was repeated at least 3 times.

Domain and phylogenetic tree analysis

BLAST was carried out with the S. cerevisiae Msb2 protein sequence (NP_011528.3) to obtain A. flavus Msb2 (XP_002385498.1) and other Aspergill sequence. mega 7.0 software was used to create the phylogenetic tree. The protein domains were predicted by smart (http://smart.embl‐heidelberg.de/) and drawn by ibs 2.0 software (http://dog.biocuckoo.org/).

Construction of mutant strains

The method of homologous recombination was used to construct msb2 knockout mutant (ΔAflmsb2). The primers used in this study were listed in Table 1. Double‐joint polymerase chain reaction (PCR) method (Yu et al., 2004a, 2004b,2004a, 2004b) was used to generate gene‐deletion cassettes which amplified by specialized primers. Then, overlap PCR products were transformed into the A. flavus CA14 PTS protoplasts. Positive transformants were screened by diagnostic PCR and Southern blot (Thermo Fisher Scientific, Waltham, MA, USA). To construct the ΔAflmsb2 complement strain (Δmsb2C), similar strategy was used and the pyrG marker was replaced by pyrithiamine resistance (prtA) marker. Then the gene complement cassettes were re‐introduced into ΔAflmsb2 protoplasts. The positive transformants were screened by PCR.

Table 1.

PCR primer sets used in this study.

Primer Sequence (5′–3′) Characteristics
msb2‐P1 TCCTCCAGGCACGCAACA

For amplifying

5′UTR of msb2 in Δmsb2

msb2‐P3 GGGTGAAGAGCATTGTTTGAGGC GACTCGGGGCGAAAGAGC
pyrG‐F GCCTCAAACAATGCTCTTCACCC

For amplifying

A. fumigatus pyrG

pyrG‐R GTCTGAGAGGAGGCACTGATGC
msb2‐P6

GCATCAGTGCCTCCTCTCAGAC

CTCTTTGGGACGAGGGTC

For amplifying

3′UTR of msb2 in Δmsb2

msb2‐P8 CTCGATGTGATCCACCTAC
msb2‐P2 GGAGATTGAAGCGGTGATA For fusion PCR of Δmsb2
msb2‐P7 CATGGTGAAATACTCGGGAC
msb2‐P9 GACTATCTCCATCAGCATCC For ORF verification
msb2‐P10 GCGACGGTAGCGATATAG
msb2‐qRT‐P9 CTCTGTTGTCCTCTATTCTGT
msb2‐qRT‐P10 GGATGCTGATGGAGATAGTC
pyrG‐907‐F ATGACGGCGATGTAGGGA For Δmsb2 mutant screening
pyrG‐919‐R CGACATCCTCACCGATTTCA
msb2‐C‐P1 TGACGCCAGCGGTATTT

For amplifying

5′UTR of Δmsb2C

msb2‐C‐P3 CGAGGTGCCGTAAAGCACTAA TTAGTTCCATCCGAGGGAGTTTT
Ptr‐F TTAGTGCTTTACGGCACCTCG

For amplifying

PtrA

Ptr‐R ACTTTATCCGCCTCCATCCAG
msb2‐C‐P6 CTGGATGGAGGCGGATAAAGT GCCTCAAACAATGCTCTTCACCC

For amplifying

3′UTR of msb2 in Δmsb2C

msb2‐C‐P8 GTCTGAGAGGAGGCACTGATGC
msb2‐C‐P2 TCGTTGCTCACTCCCTCA For fusion PCR ofΔmsb2 C
msb2‐C‐P7 ACTTGCCGCATACTCTGG
msb2‐C‐AP‐F CAGTGGTGTCGTTCCTTC For Δmsb2 Cmutant screening
msb2‐C‐AP‐R TGGTTCTCAGTGGTGTCA
msb2‐C‐BP‐F GTCGCCGCATACACTATT
msb2‐C‐BP‐R TCGTCACATCAGCAGAGA
Open in a new tab

Mycelial growth, conidiation and sclerotia analysis

The phenotypes of the WT, Δmsb2 and Δmsb2C strains were observed using different medium. Assays for mycelial growth, fungal conidia and sclerotia formation were carried out according to our previously described methods (Yuan et al., 2018). Each experiment was repeated at least 3 times.

Stress assay

For the stress assays, 1 μl of conidial suspension (107 conidial ml−1) were inoculated at the centre of the YES and PDA medium plates supplemented with the following agents: 1.2 M l−1 NaCl, 0.95% water activity (95Aw: glycerol was used as an osmostressor to adjust the water availability), 300 μg ml−1 CR, 10 μg ml−1 caspofungin and 100 μg ml−1 SDS, respectively. All the plates were incubated at 37°C for 4 days under dark condition, and the relative inhibition rates were calculated as thus: [(diameter of control colony – diameter of treatment colony)/diameter of control colony] × 100%. Each experiment was repeated at least 3 times. For detecting the inhibition of cell growth upon high osmotic stress, liquid YES medium and liquid YES medium supplement with 1.2 M l−1 NaCl were used to inoculate the same aliquots of conidial suspension. After 1–24 h inoculation at 37°C on shaker, Leica confocal SP8 microscope (Leica, Heidelberg, Germany) with a 20× objective was used to record the hyphae growth, and Laetophcnol cotton blue was used to make the hyphae morphology more clear. The experiments were repeated 3 times, using 3 independent batches of conidia.

Aflatoxins analysis

For aflatoxins (AFs) production, 10 μl conidial suspension (107 conidial ml−1) of WT, Δmsb2 and Δmsb2C strains were inoculated into 7.5 ml YES liquid medium respectively and incubated in 29°C under dark condition for 7 days. AFs production was detected by thin‐layer chromatography (TLC) (Haiyang Chemical, Qingdao, China). For quantitative analysis of aflatoxins production, methanol was used to resuspend the aflatoxin extracts. After filtration (0.22 µm), the samples were analysed by high‐performance liquid chromatography (HPLC) (Waters, Milford, MA, U.S.A.) on a Mycotox™ column (Water, Milford, USA) at 42°C. After the column was equilibrated in running solvent (water:methanol:acetonitrile, 56:22:22), 10 µl samples were injected, and isocratic runs were conducted for 15 min in 100% running solvent at a flow rate of 1.0 ml min−1. Aflatoxins were checked using a fluorescent detector (Water, Milford, USA) with excitation and emission wave lengths of 365 and 455 nm, respectively. Each experiment was repeated 3 times.

Seeds infections

The ability of WT, Δmsb2 and Δmsb2C strains to infect plant seeds was assayed as described previously (Yang et al., 2019). Seeds were inoculated with conidial suspension and cultured at 29°C, then 700 μl sterile water was added to keep the filter paper almost moist. After 6 days, seeds were harvested in 50 ml centrifuge tubes (one plate corresponds to one centrifuge tube) which contained 15 ml sterile water and 7.5 μl Tween 20. In order to release conidia on seeds surface, tubes were vigorously mixed for 5 min. The number of conidia was counted and AF was extracted according to the method described above. Each experiment was repeated at least 3 times.

Western blot analysis

The conidia (6 × 105) of WT, Δmsb2 and Δmsb2C strains were inoculated in YES liquid medium respectively and cultivated for 48 h. Whole‐cell extraction and Western blot were performed as described previously (Lan et al., 2019). Phospho‐p38 MAPK antibody (Cell Signaling Technology, Boston, MA, USA) and Anti‐phospho‐p44/42 MAPK (Erk 1/2) antibody (Cell signaling Technology, MA, USA) against target proteins were used to detect the specific phosphorylated proteins. Monoclonal antibody Hog1 (Santa Cruz Biotechnology, Dallas, Texas, USA) and anti‐AflSlt2 antibody (prepared by our laboratory) were used as loading controls respectively. Enhanced chemiluminescence (ECL) substrate was used for immunoblot analysis and chemiluminescence was measured by G‐BOX Chemi XT4 (Syngene, HK, China).

Chitinase activity assay

The conidia (6 × 105) of WT, Δmsb2 and Δmsb2C strains were grown in YES liquid medium in a rotary shaker (180 r min−1) for 72 h. The mycelia were removed with glass filter, and ultrasonic crusher (Scientz, Zhejiang, China) was used for protein extraction. Chitinase activity was measured using a chitinase activity detection reagent (Solarbio Science, Beijing, China) as described by Yanai et al. (1992). Chitinase hydrolyses chitin to produce n‐acetylglucosamine, which is further combined with 3, 5‐dinitrosalicylic acid to produce brownish red compounds. There is a characteristic absorption peak at 540 nm detected by enzyme‐labelled instrument (Molecular Devices, San Jose, CA, USA), and the increase of absorption reflects the activity of chitinase. The experiment was repeated 3 times.

Quantitative RT‐PCR analysis

For qRT‐PCR, the mycelia of WT, Δmsb2 and Δmsb2C strains were harvested at WKM, PDA and YES medium at 37°C. The total RNA was got from 100 mg ground mycelium through the TRIzol reagent (Biomarker Technologies, Beijing, China), and the First‐strand cDNA was obtained by the cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). qRT‐PCR was performed on the Thermo Fisher Scientific Real‐time PCR System (Finland) using SYBR Green qPCR Mix (DongSheng Biotech, Guangzhou, China). The actin gene of A. flavus was utilized as the reference gene, and the relative expression of the target gene was calculated using the 2−ΔΔ Ct method (Livak and Schmittgen, 2001). The qRT‐PCR primers were listed in Table 2. All assays of qRT‐PCR were conducted with technical triplicates for each sample, and each experiment was repeated at least 3 times.

Table 2.

qRT‐PCR primer sets used in this study.

Primer Sequence (5′–3′) Characteristics
abaA‐ qRT‐F TCTTCGGTTGATGGATGATTTC For abaA qRT‐PCR
abaA‐ qRT‐R CCGTTGGGAGGCTGGGT
brlA‐ qRT‐F GCCTCCAGCGTCAACCTTC For brlA qRT‐PCR
brlA‐ qRT‐R TCTCTTCAAATGCTCTTGCCTC
nsdC‐ qRT‐F GCCAGACTTGCCAATCAC For nsdC qRT‐PCR
nsdC‐ qRT‐R CATCCACCTTGCCCTTTA
sclR‐ qRT‐F CAATGAGCCTATGGGAGTGG For sclR qRT‐PCR
sclR‐ qRT‐R ATCTTCGCCCGAGTGGTT
aflC‐ qRT‐F GTGGTGGTTGCCAATGCG For aflC qRT‐PCR
aflC‐ qRT‐R CTGAAACAGTAGGACGGGAGC
aflR‐ qRT‐F AAAGCACCCTGTCTTCCCTAAC For aflR qRT‐PCR
aflR‐ qRT‐R GAAGAGGTGGGTCAGTGTTTGTAG
aflQ‐ qRT‐F GTCGCATATGCCCCGGTCGG For aflQ qRT‐PCR
aflQ‐ qRT‐R GGCAACCAGTCGGGTTCCGG
Ags1‐ qRT‐F CTACGCCCGTTATCCCATCT For Ags1 qRT‐PCR
Ags1‐ qRT‐R TGACATCAAGACCAGCCCAT
ChsB‐ qRT‐F CGCTAACTATCCGCAGAG For ChsB qRT‐PCR
ChsB‐ qRT‐R CACCACGATGTTGATGAAG
ChsG‐ qRT‐F AGGAGTTTACCCACATGCGA For ChsG qRT‐PCR
ChsG‐ qRT‐R TTGAGGTTCACAATGTCGCG
actin‐F ACGGTGTCGTCACAAACTGG For actin qRT‐PCR

actin‐R

veA‐qPCR‐F

veA‐qPCR‐R

laeA‐qPCR‐F

laeA‐qPCR‐R

GCGTATCGTCGTTACCTCATC

TATCATTCCGTGGCTCAAT

GAGAGGTACTGCTGGATG

TTGTTGGGGTTGACCTTGCT

GCCATCCCATCACACTTCCA

For veA qRT‐PCR

For laeA‐qRT‐PCR
Open in a new tab

Statistical analysis

graphpad prism 7 (https://www.graphpad.com) was used to analyse the statistics and significance. Student’s t test was performed for comparison of two different groups, while multiple groups comparisons were through One‐way analysis of variance (ANOVA) test.

Conflict of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

This work was funded by the National Natural Science Foundation of China (No. 31600118, 31772105).

Microbial Biotechnology (2021) 14(2), 628–642

Funding informationThis work was funded by the National Natural Science Foundation of China (No. 31600118, 31772105).

Contributor Information

Shihua Wang, Email: wshyyl@sina.com.

Jun Yuan, Email: yjmail2008@fafu.edu.cn.

References

  1. Aguilera, A. (2002) The connection between transcription and genomic instability. EMBO J 21: 195–201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amaike, S. , and Keller, N.P. (2011) Aspergillus flavus . Annu Rev Phytopathol 49: 107–133. [DOI] [PubMed] [Google Scholar]
  3. Amare, M.G. , and Keller, N.P. (2014) Molecular mechanisms of Aspergillus flavus secondary metabolism and development. Fungal Genet Biol 66: 11–18. [DOI] [PubMed] [Google Scholar]
  4. Bhatnagar, D. , Ehrlich, K.C. , and Cleveland, T.E. (2003) Molecular genetic analysis and regulation of aflatoxin biosynthesis. Appl Microbiol Biotechnol 61: 83–93. [DOI] [PubMed] [Google Scholar]
  5. Brow, N.A. , Dos Reis, T.F. , Goinski, A.B. , Savoldi, M. , Menino, J. , Almeida, M.T. , et al. (2014) The Aspergillus nidulans signalling mucin MsbA regulates starvation responses, adhesion and affects cellulase secretion in response to environmental cues. Mol Microbiol, 94), 1103–1120. https://doi.org/10:1111/mmi.12820 [DOI] [PubMed] [Google Scholar]
  6. Cary, J.W. , Han, Z. , Yin, Y. , Lohmar, J.M. , Shantappa, S. , Harris‐Coward, P.Y. , et al. (2015) Transcriptome analysis of Aspergillus flavus Reveals veA‐dependent regulation of secondary metabolite gene clusters, including the Novel Aflavarin Cluster. Eukaryot Cell 14: 983–997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cary, J.W. , Harris‐Coward, P.Y. , Ehrlich, K.C. , Mack, B.M. , Kale, S.P. , Larey, C. , et al. (2012) NsdC and NsdD affect Aspergillus flavus morphogenesis and aflatoxin production. Eukaryot Cell 11: 1104–1111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cary, J.W. , O'Brian, G.R. , Nielsen, D.M. , Nierman, W. , Harris‐Coward, P. , Yu, J. , et al. (2007) Elucidation of veA‐dependent genes associated with aflatoxin and sclerotial production in Aspergillus flavus by functional genomics. Appl Microbiol Biotechnol 76: 1107–1118. [DOI] [PubMed] [Google Scholar]
  9. Chang, P.K. , Scharfenstein, L.L. , Wei, Q. , and Bhatnagar, D. (2010) Development and refinement of a high‐efficiency gene‐targeting system for Aspergillus flavus . J Microbiol Methods 81: 240–246. [DOI] [PubMed] [Google Scholar]
  10. Chen, Z. , Gibson, T.B. , Robinson, F. , Silvestro, L. , Pearson, G. , Xu, B. , et al. (2001) MAP. kinases. Chem Rev 101: 2449–2476. [DOI] [PubMed] [Google Scholar]
  11. Chow, J. , Dionne, H.M. , Prabhakar, A. , Mehrotra, A. , Somboonthum, J. , Gonzalez, B. , et al. (2019) Aggregate filamentous growth responses in yeast. mSphere 4:e00702‐18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Duran, R.M. , Cary, J.W. , and Calvo, A.M. (2007) Production of cyclopiazonic acid, aflatrem, and aflatoxin by Aspergillus flavus is regulated by veA, a gene necessary for sclerotial formation. Appl Microbiol Biotechnol 73: 1158–1168. [DOI] [PubMed] [Google Scholar]
  13. Dyer, P.S. , and O'Gorman, C.M. (2012) Sexual development and cryptic sexuality in fungi: insights from Aspergillus species. FEMS Microbiol Rev 36:165–192. [DOI] [PubMed] [Google Scholar]
  14. Frawley, D. , Greco, C. , Oakley, B. , Alhussain, M.M. , Fleming, A.B. , Keller, N.P. , et al. (2020) The tetrameric. pheromone module SteC‐MkkB‐MpkB‐SteD regulates asexual sporulation, sclerotia formation and aflatoxin production in Aspergillus flavus . Cell Microbiol 22: e13192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Free, S.J. (2013) Fungal cell wall organization and biosynthesis. Adv Genet 81: 33–82. [DOI] [PubMed] [Google Scholar]
  16. Geoghegan, I. , Steinberg, G. , and Gurr, S. (2017) The role of the fungal cell wall in the infection of plants. Trends Microbiol 25: 957–967. [DOI] [PubMed] [Google Scholar]
  17. Gow, N.A.R. , Latge, J.P. , and Munro, C.A. (2017) The fungal cell wall: structure, biosynthesis, and function. Microbiol Spectr 5, 267–292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gurgel, I. , Jorge, K. , Malacco, N. , Souza, J. , Rocha, M.C. , Fernandes, M.F. , et al. (2019) The Aspergillus fumigatus Mucin MsbA regulates the cell wall integrity pathway and controls recognition of the fungus by the immune system. mSphere 4:e00350‐19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kale, S.P. , Milde, L. , Trapp, M.K. , Frisvad, J.C. , Keller, N.P. , and Bok, J.W. (2008) Requirement of LaeA for secondary metabolism and sclerotial production in Aspergillus flavus . Fungal Genet Biol 45: 1422–1429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Karpinets, T.V. , and Foy, B.D. (2005) Tumorigenesis: the adaptation of mammalian cells to sustained stress environment by epigenetic alterations and succeeding matched mutations. Carcinogenesis 26: 1323–1334. [DOI] [PubMed] [Google Scholar]
  21. Lan, H. , Wu, L. , Fan, K. , Sun, R. , Yang, G. , Zhang, F. , et al. (2019) Set3 is required for asexual development, Aflatoxin biosynthesis, and fungal virulence in Aspergillus flavus . Front Microbiol 10: 530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lanver, D. , Mendoza‐Mendoza, A. , Brachmann, A. , and Kahmann, R. (2010) Sho1 and Msb2‐related proteins regulate appressorium development in the smut fungus Ustilago maydis . Plant Cell 22: 2085–2101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lee, Y. , Kim, Y.J. , Kim, M.H. , and Kwak, J.M. (2016) MAPK cascades in guard cell signal transduction. Front Plant Sci 7: 80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Li, D. , Qin, L. , Wang, Y. , Xie, Q. , Li, N. , Wang, S. , et al. (2019) AflSte20 regulates morphogenesis, stress response, and Aflatoxin biosynthesis of Aspergillus flavus . Toxins (Basel) 11: 730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Livak, K.J. , and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real‐time quantitative PCR and the 2(‐Delta Delta C(T)) Method. Methods 5: 402–408. [DOI] [PubMed] [Google Scholar]
  26. Martínez‐Soto, D. , and Ruiz‐Herrera, J. (2017) Functional analysis of the MAPK pathways in fungi. Rev Iberoam Micol 34: 192–202. [DOI] [PubMed] [Google Scholar]
  27. Pérez‐Nadales, E. , and Di Pietro, A. (2011) The membrane mucin Msb2 regulates invasive growth and plant infection in Fusarium oxysporum . Plant Cell 23: 1171–1185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Perez‐Nadales, E. , and Di Pietro, A. (2015) The transmembrane protein Sho1 cooperates with the mucin Msb2 to regulate invasive growth and plant infection in Fusarium oxysporum . Mol Plant Pathol 16:593–603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Puri, S. , Kumar, R. , Chadha, S. , Tati, S. , Conti, H.R. , Hube, B. , et al. (2012) Secreted aspartic. protease cleavage of Candida albicans Msb2 activates Cek1 MAPK signaling affecting biofilm formation and oropharyngeal candidiasis. PLoS One 7, e46020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ren, W. , Liu, N. , Yang, Y. , Yang, Q. , Chen, C. , and Gao, Q. (2019) The sensor proteins BcSho1 and BcSln1 are involved in, though not essential to, vegetative differentiation, pathogenicity and osmotic stress tolerance in Botrytis cinerea . Front Microbiol 10: 328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Rodriguez, L. , Voorhies, M. , Gilmore, S. , Beyhan, S. , Myint, A. , and Sil, A. (2019) Opposing signaling pathways regulate morphology in response to temperature in the fungal pathogen Histoplasma capsulatum . PLoS Biol 17: e3000168. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  32. Román, E. , Cottier, F. , Ernst, J.F. , and Pla, J. (2009) Msb2 signaling mucin controls activation of Cek1 mitogen‐activated protein kinase in Candida albicans . Eukaryot Cell 8:1235–1249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Saito, H. , and Posas, F. (2012) Response to hyperosmotic stress. Genetics 192: 289–318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sanz, A.B. , García, R. , Rodríguez‐Peña, J.M. , and Arroyo, J. (2017) The CWI pathway: regulation of the transcriptional adaptive response to cell wall stress in yeast. J Fungi (Basel) 4:1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sanz, A.B. , García, R. , Rodríguez‐Peña, J.M. , Nombela, C. , and Arroyo, J. (2018) Slt2 MAPK association with chromatin is required for transcriptional activation of Rlm1 dependent genes upon cell wall stress. Biochim Biophys Acta Gene Regul Mech 1861: 1029–1039. [DOI] [PubMed] [Google Scholar]
  36. So, Y.S. , Jang, J. , Park, G. , Xu, J. , Olszewski, M.A. , and Bahn, Y.S. (2018) Sho1 and Msb2 play complementary but distinct roles in stress responses, sexual differentiation, and pathogenicity of Cryptococcus neoformans . Front Microbiol 9:2958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Swidergall, M. , Ernst, A.M. , and Ernst, J.F. (2013) Candida albicans mucin Msb2 is a broad‐range protectant against antimicrobial peptides. Antimicrob Agents Chemother 57: 3917–3922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Tanaka, K. , Tatebayashi, K. , Nishimura, A. , Yamamoto, K. , Yang, H.Y. , and Saito, H. (2014) Yeast osmosensors Hkr1 and. Msb2 activate the Hog1 MAPK cascade by different mechanisms. Sci Signal 7:ra21. [DOI] [PubMed] [Google Scholar]
  39. Tatebayashi, K. , Tanaka, K. , Yang, H.Y. , Yamamoto, K. , Matsushita, Y. , Tomida, T. , et al. (2007) Transmembrane mucins Hkr1 and Msb2 are putative osmosensors in the SHO1 branch of yeast HOG pathway. EMBO J 26: 3521–3533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tsitsigiannis, D.I. , and Keller, N.P. (2006) Oxylipins act as determinants of natural product biosynthesis and seed colonization, Aspergillus nidulans . Mol Microbiol 59: 882–892. [DOI] [PubMed] [Google Scholar]
  41. Tumukunde, E. , Li, D. , Qin, L. , Li, Y. , Shen, J. , Wang, S. , and Yuan, J. (2019) Osmotic‐adaptation response of sakA/hogA gene to Aflatoxin biosynthesis, morphology development and pathogenicity in Aspergillus flavus . Toxins (Basel) 11:41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Wang, G. , Li, G. , Zhang, S. , Jiang, C. , Qin, J. , and Xu, J.R. (2015) Activation of the signaling mucin MoMsb2 and its. functional relationship with Cbp1 in Magnaporthe oryzae . Environ Microbiol 17:2969–2981. [DOI] [PubMed] [Google Scholar]
  43. Wu, F. , Groopman, J.D. , and Pestka, J.J. (2014) Public health impacts of foodborne mycotoxins. Annu Rev Food Sci Technol 5: 351–372. [DOI] [PubMed] [Google Scholar]
  44. Yanai, K. , Takaya, N. , Kojima, N. , Horiuchi, H. , Ohta, A. , and Takagi, M. (1992) Purification of two chitinases from Rhizopus. oligosporus and isolation and sequencing of the encoding genes. J Bacteriol 174:7398–7406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Yang, K. , Liu, Y. , Wang, S. , Wu, L. , Xie, R. , Lan, H. , et al. (2019) Cyclase‐associated protein cap with multiple domains contributes to mycotoxin biosynthesis and fungal virulence in Aspergillus flavus . J Agric Food Chem 67:4200–4213. [DOI] [PubMed] [Google Scholar]
  46. Yu, J. , Chang, P.K. , Ehrlich, K.C. , Cary, J.W. , Bhatnagar, D. , Cleveland, T.E. , et al. (2004a) Clustered pathway genes in aflatoxin biosynthesis. Appl Environ Microbiol 70: 1253–1262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Yu, J.H. , Hamari, Z. , Han, K.H. , Seo, J.A. , Reyes‐Domínguez, Y. , and Scazzocchio, C. (2004b) Double‐joint PCR: a PCR‐based molecular tool for gene manipulations in filamentous fungi. Fungal Genet Biol 41: 973–981. [DOI] [PubMed] [Google Scholar]
  48. Yuan, J. , Chen, Z. , Guo, Z. , Li, D. , Zhang, F. , Shen, J. , et al. (2018) PbsB regulates morphogenesis, Aflatoxin B1 biosynthesis, and pathogenicity of Aspergillus flavus . Front Cell Infect Microbiol 8:162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zhang, J. , Chen, H. , Sumarah, M.W. , Gao, Q. , Wang, D. , and Zhang, Y. (2018a) veA gene acts as a positive regulator of Conidia production, Ochratoxin A biosynthesis, and oxidative stress tolerance in Aspergillus niger . J Agric Food Chem 66: 13199–13208. [DOI] [PubMed] [Google Scholar]
  50. Zhang, F. , Geng, L. , Deng, J. , Huang, L. , Zhong, H. , Xin, S. , et al. (2020) The MAP kinase AflSlt2. modulates aflatoxin biosynthesis and peanut infection in the fungus Aspergillus flavus . Int J Food Microbiol 322:108576. [DOI] [PubMed] [Google Scholar]
  51. Zhang, F. , Geng, L. , Huang, L. , Deng, J. , Fasoyin, O.E. , Yao, G. , and Wang, S. (2018b) Contribution of peroxisomal protein importer AflPex5 to development and pathogenesis in the fungus Aspergillus flavus . Curr Genet 64: 1335–1348. [DOI] [PubMed] [Google Scholar]

Articles from Microbial Biotechnology are provided here courtesy of Wiley

RESOURCES