Skip to main content
NCBI home page
Saudi Journal of Biological Sciences logoLink to Saudi Journal of Biological Sciences
. 2020 Dec 17;28(3):1779–1786. doi: 10.1016/j.sjbs.2020.12.020

Assessment of genetic diversity and phylogenetic relationship among grouper species Epinephelus spp. from the Saudi waters of the Arabian Gulf

Hesham Abdallah Hassanien a,b,⁎, Yousof Al-Rashada a
PMCID: PMC7938112  PMID: 33732062

Abstract

Understanding of fish genetic characterization plays a vital role in the conservation and utilization of fish genetic resources of grouper species. The present study was carried out to assess the genetic diversity and phylogenetic relationships in five grouper species, Epinephelus spp. from eastern Saudi Arabian coast using two molecular marker systems, inter simple sequence repeat (ISSR) and microsatellite (SSR) markers. In total, 219 individuals grouper specimens (Epinephelus tauvina, E. coioides, E. bleekeri, E. malabaricus, and E. areolatus) were genotyped with 10 ISSR and 11 SSR selected primers. The ISSR produced 94 DNA fragments, of which 44 were polymorphic with an average of 2.13 fragment per primer. While SSR primers generated 107 alleles, all of them were polymorphic with an average 9.72 per primer. ISSR and SSR techniques demonstrated a high level of gene diversity and genetic distances illustrated by UPGMA dendrograms among the grouper species. The results proved that the SSR markers were highly informative and efficient in detecting genetic variability and relationships of the Epinephelus spp.

Keywords: Epinephelus spp., Genetic diversity, ISSR, SSR

1. Introduction

Grouper is a member of the sub-family Epinephelinae (family, Serranidae). There are about 159 species of groupers in 15 genera (Koedprang, et al., 2007). They are found in the tropical and subtropical waters of all oceans (Tupper and Sheriff, 2008). Grouper is a commercially important marine fish species due to its desirable taste and high market demand in many parts of the world as well as in Saudi Arabia. Groupers are the best fish species for intensive aquaculture because of its fast growth; undertake environmental stress and efficient feed conversion (Craig and Hastings, 2007). Many grouper species Epinephelus spp. distributed in the Red Sea and Arabian Gulf (Priest, et al., 2016). The most important grouper species for both capture and aquaculture are orange-spotted grouper Epinephelus coioides, greasy grouper E. tauvina, king grouper or Malabar grouper E. malabaricus, giant grouper E. lanceolatus, potato grouper E. tukula and longfin grouper E. quoyanus (Wang, et al., 2011). The E. tauvina known in the Eastern Saudi Arabia as Arabian grouper. The lack of genetic diversity information about grouper species in the Arab Gulf especially, on the eastern Saudi coast magnifies the difficulty of selecting elite species in grouper breeding programs.

The grouper has problems such as determining the exact classification of the species of grouper where the morphological traits of the species overlap, so it is difficult to classify the species. For example, E. coioides is often confused with E. tauvina, and often mistaken with E. malabaricus (Rimmer and Glamuzina, 2019). In addition, the grouper is a protogynous hermaphrodite, which begins its sex life as a female and then change sex into male. Due to grouper sex traits in nature, catch of mature male is difficult and it is the most significant limitation to artificial larvae production of grouper (Oh et al., 2013, An et al., 2014). Furthermore, genetic diversity decreased among the solitary and non-social fish species, especially grouper, because of overfishing, marine pollution, and habitat destruction (Martinez, et al., 2018).

Knowledge of the population and subpopulation (stock) structure is important for conservation, fishery management, and fish breeding programs development (Grandcourt, et al., 2005). Molecular marker techniques are commonly used for fish stock characterization (Cuéllar-Pinzón, et al., 2016). The identification, genetic diversity and estimate of genetic variation among grouper species have been reported by many scientists who used PCR based methods, including microsatellite (Antoro et al., 2006, Koedprang et al., 2007, Wang et al., 2011, Yang et al., 2011, An et al., 2014, Vaini et al., 2019), mitochondrial DNA (Maggio et al., 2005, Jackson et al., 2014, Jefri et al., 2015, Ketchum et al., 2016, Galal-Khallaf et al., 2019), random amplified polymorphic DNA (RAPD) (Govindaraju and Jayasankar, 2004, Noikotr et al., 2013, Roy et al., 2014) and inter simple sequence repeat (ISSR) (Chiu, et al., 2012). Therefore, the current investigation aimed to determine genetic relationship and diversity among five Epinephelus spp. in the eastern Saudi Arabian coast using ISSR and SSR markers and to construct a molecular fingerprint database.

2. Materials and methods

2.1. Sampling

All investigations in this study were approved by the Institutional Animal Care and Use Committee of King Faisal University (KSA). All specimens were purchased from local fishermen, hence no specific licenses were required for the described field sampling as the fishermen were required to react with local laws regarding fishing. The species sampled are not protected or endangered. Two hundred and nineteen samples of multiple species of grouper Epinephelus spp. were collected from commercial landings in four locations along the eastern Saudi Arabia coast: Khafji (28.4257°N, 48.4887°E), Al-Jubail (26.9598°N, 49.5687°E), Al-Qatif (26.5765°N, 49.9982°E), and Salwa (24.76 10°N 50.7452°E) (Fig. 1). All the specimens were collected within three months to avoid errors due to seasonal variation. The samples were identified based on morphological characters following (Heemstra and Randall, 1993, Craig et al., 2011, Allen and Erdmann, 2012) and were photographed (Fig. 2). Grouper species examined were Epinephelus tauvina (number = 46, and standard length = 276–334 mm), E. coioides (n = 67, and SL = 281–369 mm), E. bleekeri (n = 35, and SL = 355–371 mm), E. malabaricus (n = 38, and SL = 390–422 mm), and E. areolatus (n = 33, and SL = 263–349 mm).

Fig. 1.

Fig. 1

Open in a new tab

Map of the eastern of Saudi Arabia coast showing the sample sites.

Fig. 2.

Fig. 2

Open in a new tab

The five grouper species collected from eastern of Saudi Arabia coast: (A) E. tauvina, (B) E. coioides, (C) E. malabaricus, (D) E. bleekeri, and (E) E. areolatus.

2.2. DNA extraction and quantification

Fins were used for DNA extraction. A small piece of caudal fin samples was clipped (approximately 500–1000 mg), and preserved in 100% ethanol which was then stored at −20 °C. Genomic DNA was obtained through the DNeasy Tissue Kit (Qiagen, Hilden, Germany) using the manufactureŕs protocols. The DNA samples were checked for quantity and quality by spectrophotometer and 1% agarose gel electrophoresis, respectively. The DNA samples were diluted to 20 ng/μL then suspended in TE buffer (50 mM Tris-HCL; 10 mM EDTA) and then stored at 4 °C until used for PCR amplification.

2.3. ISSR electrophoresis and profile analysis

Out of the 30 ISSR primers (the University of British Columbia -UBC) screened, only ten primers giving most polymorphic, reproducible and clear fingerprints were selected for Epinephelus species analyses (Table 1). ISSR-PCR reactions were carried out in thermocycler GeneAmp® PCR System 9700. The amplification was performed in 25 µl, containing 2.5 µl template DNA (50 ng); 1X PCR buffer with Mgcl2; 0.5 µl (200 mM each) dNTP mix; 0.5 µl (5unit/ µl) Taq polymerase (Promega); 1 µl (20 pM) primer; and Millipore water to volume. ISSR-PCR was carried out in an initial denaturation for 3 min at 94° C, then 35 cycles: 45 s at 94 °C, 45 s at 50–56 °C depended on the primers base composition, 45 s at 72 °C followed by final extension at 72 °C for 7 min. PCR products were electrophoresed by running on 1.5% agarose gel stained with ethidium bromide (0.5-μg mL−1). PCR band size was estimated by 100 base pairs (bp) molecular size ladder (Promega, USA). Then gels were photographed by the Gel Doc (TM) XY System (Bio-Rad, Hercules, USA).

Table 1.

List of ISSR primers and number of polymorphic/number of bands generated per primer within five Epinephelus species.

Primer Nucleotide sequence AT E. tauvina E. coioides E. bleekeri E. Malabaricus E. areolatus Overall species
Number of polymorphic/number of bands
UBC807 AGAGAGAGAGAGAGAGT 48 °C 2/9 2/8 2/9 4/10 0/9 4/11
UBC812 GAGAGAGAGAGAGAGAA 51 °C 2/8 2/8 2/8 3/8 2/8 4/9
UBC815 CTCTCTCTCTCTCTCTG 53 °C 4/10 3/11 3/9 3/8 3/9 5/10
UBC816 CACACACACACACACAT 48 °C 0/8 2/9 2/8 2/8 2/8 3/8
UBC822 TCTCTCTCTCTCTCTCA 48 °C 3/9 3/10 3/9 3/9 3/9 4/10
UBC826 ACACACACACACACACC 53 °C 3/7 2/7 2/7 2/8 2/7 4/8
UBC828 TGTGTGTGTGTGTGTGA 50 °C 5/11 4/10 2/9 4/9 2/9 6/12
UBC835 AGAGAGAGAGAGAGAGYC 51 °C 3/7 3/7 3/7 3/7 2/7 5/8
UBC874 CCCTCC CTCCCTCCCT 50 °C 2/5 1/4 2/7 3/5 3/7 4/8
UBC880 GGAGAGGAGAGGAGA 55 °C 4/8 4/9 3/9 3/8 3/9 5/10
Total 28/82 26/83 24/82 30/80 22/82 44/94
% of polymorphism 34.15 31.32 29.26 37.50 26.82 46.8
Average number of polymorphic bands per primer 2.92 3.19 3.41 2.66 3.72 2.13
Open in a new tab

AT, Annealing temperature.

2.4. Microsatellite amplification and genotyping

Out of the fifteen microsatellite markers tested, only eleven primers gave good PCR results. Microsatellite markers were selected from the GenBank database (http//:www.ncbi.nlm.nih.gov/) for genetic analyses. The sequence of eleven pairs of microsatellite primers listed in Table 3. PCR reactions were carried out in thermocycler GeneAmp® PCR System 9700. The amplification was carried out in 25 µl volume with 1 × PCR buffer (Promega, Madison, WI, USA), 250 mM dNTPs, 250 nM each primer, 2.25mMMgcl2, 50 ng DNA and 0.25U Taq polymerase (Promega, USA). The following PCR conditions were used pre-denaturation for 3 min at 95 °C, followed by 35 cycles of 45 s at 94 °C, 45 s at 55–56 °C, 60 s at 72 °C, and final extension step at 72 °C for 7 min. The PCR product (3 µl) was loaded onto a 7% polyacrylamide gel electrophoresis (PAGE). The gels were visualized using silver nitrate staining (Promega Kit) of the polyacrylamide gel.

Table 3.

Sequence of eleven pairs of microsatellite primers, number of alleles and fixation indices (FST, FIS, and FIT) at each locus over five grouper species.

Primers GenBank no. Primer sequence (5′-3′) Tann (◦C) Size range (bp) Alleles Number FST FIS FIT
Ec_3 GQ267993 F: GTTTCAGGGTCTCTTCAGCC
R: CCCACAGTGAGGGATTAGAT		 56 164–188 8 0.252 0.072 0.021
Ec_121 GQ267996 F: GACTGAATTTGCAACTACTG
R: CATCTCTTGCCTTCAACACAC		 56 136–196 10 0.211 0.081 0.030
Ec_122 GQ267997 F: CATTCCTTAAAGTATTCTGTG
R: CCACAGCCAGTCTAGGTATTC		 55 158–210 10 0.343 0.168 0.040
Ec_124 GQ267999 F: GCTCTGACTAAGTCAGGTGAG
R: GTTTAATTTGATTTGAGTAGAGC		 56 122–148 12 0.189 0.152 0.100
Ec_125 GQ268000 F: CTGCTATATAAATAAAAACAATGC
R: CAGTGATCTGAGCTGAGTTAG		 56 174–240 9 0.201 0.059 0.090
Ec_131 GQ268001 F: CACTTGCGATCGTCATTACAG
R: CCCGTCCCACACACACAC		 56 122–186 7 0.221 0.138 0.110
Ec_154 GQ429007 F: AGCTGCTCAACAGGTTGTGTT
R: CAAGTTCCATATGTGCTCTGACA		 56 189–235 11 0.301 0.024 0.032
Ec_157 GQ429008 F: TGGAACAAGTTGGCATGGTA
R: CAAATACAACACCCTAGATTTT		 56 242–270 13 0.428 0.192 −0.002
Ec_158 GQ429009 F: TGAGAGACAGTGGAGCACAAA
R: CGTGGTTACATTCTACCCCCTA		 56 148–170 10 0.352 0.142 0.119
An-06 JN185627 F: GCTCGAAGATGAGCTGGAAG
R: AAGGTGCTGCTCCTGCTTT		 60 192–210 9 0.209 0.182 0.020
An-15 JN185636 F: CCTGTGTGTGAGCTGGAGAA
R: GGTGGAGGAGTACGAAACCA		 58 186–242 8 0.196 0.191 0.140
Mean – – – – 9.72 0.263 0.127 0.063
Open in a new tab

2.5. Statistical analyses for ISSR/SSR markers

From gel photographs, DNA bands produced by ISSR profile was scored for presence (1) or absence (0) of a band (binary data). Each primer of the ISSR marker was referred to as an allele and ISSR matrix used for analysis. For the SSR data, The size of each allele per locus was estimated by the program Quantity with the standard DNA ladder marker pBR322 DNA/MspI (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China) was loaded. The measurement of genetic diversity parameters (percentage of polymorphism (%P), observed number of alleles (Na), effective number of alleles (Ne), Shannon's Index (I), and heterozygosity (He)) in the five grouper species were estimated employing the software POPGENE version 1.31 (Yeh, et al., 1999). The degree of genetic differentiation for ISSR data was figured by a coefficient of genetic differentiation (GST). POPGENE version 1.31 (Yeh, et al., 1999), was employed for analysis of microsatellites data: allele frequencies of all loci, number of alleles, observed and expected heterozygosity, and the Hardy–Weinberg equilibrium. Also, F-Statistics, the genetic differentiation index between grouper species (genetic distance, FST), inbreeding coefficient of an individual relative to the grouper species (within inbreeding, FIS), and inbreeding coefficient of an individual relative to the total species (total inbreeding, FIT) were estimated using GenAlEx Version 6.5 (Peakall and Smouse, 2012). Two genetic distance matrices for ISSR and SSR markers were established between grouper species based on Nei’s coefficients (Nei, 1978), in GenAlEx 6.4 (Peakall and Smouse, 2012) and thereafter used to create dendrograms based on UPGMA clustering algorithm implemented in NTSYSpc 2.2 (Rohlf, 2000). The cophenetic correlation test was carried out for calculating the correlation between each of the distance matrices and its corresponding dendrogram by Mantel’s test (Mantel, 1967) with 1000 replications using NTSYSpc 2.2 (Rohlf, 2000). Correlation coefficients between ISSR and SSR systems were also calculated using Mantel's test with the same software.

3. Results

3.1. ISSR analysis

The total number of fragments that were detected consistently for the overall five Epinephelus species based on ten decamer primers were 94, out of which 44 fragments were found to be polymorphic (46.8%). The product size ranged from 500 to 3000 bp. (Table 1). The number of bands generated per primer varied from 8 to 11. With these ten primers, each primer in Epinephelus areolatus, E. bleekeri, E. coioides, E. tauvina, and E. malabaricus, generated on average 3.72, 3.41, 3.19, 2.92 and 3.66 polymorphic bands respectively. For overall species, the average number of polymorphic band per

primer was 2.13. The proportion of polymorphism detected was lower for E. areolatus (26.82%) compared with that of E. malabaricus (37.50%). A total of 82, 83, and 82 amplified bands were produced from E. tauvina, E. coioides and E. bleekeri species of which 28, 26, and 24 bands were polymorphic (34.15%, 31.32%, and 29.26% respectively) (Table 1). The heterozygosity (He) ranged between 0.111 ± 0.213 (E. areolatus) to 0.148 ± 0.119 (E. tauvina). The E. coioides, E. bleekeri and E. malabaricus showed a heterozygosity of 0.133, 0.123 and 0.161 respectively. For overall species, effective number of alleles (Ne), Shannon index (I) and the heterozygosity (He) were 1.239 ± 0.289, 0.216 ± 0.190 and 0.143 ± 0.171 respectively (Table 2). Co-efficient of genetic differentiation (GST) estimated based on the ISSR data was 0.407. The gene flow (Nm) value among grouper species Epinephelus spp. was 0.911. ISSR analysis revealed that the mean genetic distance (D) for the five species ranged from 0.101 between E. bleekeri and E. areolatus populations to 0.240 between E. tauvina and E. areolatus populations (Table 5). The cluster analysis of the ISSR data (Fig. 3) categorized the five Epinephelus spp. into three groups: Group one included the E. tauvina and E. coioides; the second was E. bleekeri and E. areolatus and the third was the E. malabaricus.

Table 2.

Estimates of ISSR variation in Epinephelus species.

E. tauvina E. coioides E. bleekeri E. malabaricus E. areolatus Across species P-values
Na ± SD 1.341 ± 0.053 1.317 ± 0.059 1.293 ± 0.047 1.378 ± 0.051 1.268 ± 0.041 1.420 ± 0.038 *
Ne ± SD 1.267 ± 0.042 1.234 ± 0.039 1.215 ± 0.028 1.285 ± 0.036 1.193 ± 0.042 1.239 ± 0.018 *
I ± SD 0.213 ± 0.033 0.194 ± 0.034 0.178 ± 0.037 0.233 ± 0.049 0.162 ± 0.035 0.216 ± 0.017 **
He ± SD 0.148 ± 0.023 0.133 ± 0.018 0.123 ± 0.026 0.161 ± 0.023 0.111 ± 0.027 0.143 ± 0.010 **
Co-efficient of genetic differentiation (GST) 0.407 ***
Gene flow (Nm) 0.911
Open in a new tab

Observed number of alleles (Na), effective number of alleles (Ne), Shannon's Index (I), heterozygosity (He) and standard deviation.

*

P < 0.05.

**

P < 0.001.

***

P < 0.0001.

Table 5.

Nei’s (1978) genetic distance between five Epinephelus species revealed by ten ISSR (above diagonal) and eleven microsatellite loci (below diagonal).

Tauvina coioides Bleekeri Malabaricus Areolatus
Tauvina 0.00 0.117 0.226 0.119 0.240
Coioides 0.126 0.00 0.184 0.134 0.196
Bleekeri 0.156 0.128 0.00 0.209 0.101
Malabaricus 0.184 0.136 0.125 0.00 0.225
Areolatus 0.220 0.175 0.142 0.153 0.00
Open in a new tab

Fig. 3.

Fig. 3

Open in a new tab

UPGMA dendrogram of the five Epinephelus species based on genetic distances derived from ISSR data.

3.2. SSR analysis

Microsatellites diversity indices among and within grouper species studied are summarized in Table 3. and Table 4. A total number of 107 alleles were obtained using eleven microsatellites in two hundred and nineteen individuals, with all of them being polymorphic. Ec_157 was the most variable locus with 13 alleles, and Ec_131 (7 alleles) was the lowest variable locus (Table 3). The number of alleles ranged from 5 to 13 (average 8.09), 6 to 13 (average 8.36), 4 to 11 (average 7.36), 5 to 12 (average 8.00) and 6 to 10 (average 7.90) for E. tauvina, E. coioides, E. bleekeri, E. malabaricus, and E. areolatus, respectively (Table 4). The mean effective number of alleles per locus varied from 4.73 for Ec_3 to10.06 for Ec_157. The average observed and expected heterozygosity had values of 0.635 to 0.782 and 0.755 to 0.860, respectively. All grouper populations showed high expected heterozygosity within population with overall mean 0.819 (±0.032) which showed high levels of genetic diversity in grouper populations studied. No private alleles were detected for any grouper species studied using eleven SSR markers.

Table 4.

Microsatellites diversity indices for grouper species.

Locus E. tauvina E. coioides E. bleekeri E. malabaricus E. areolatus Mean
Ec_3 A 5 6 4 5 6 5.20
Ae 4.96 5.00 4.00 4.40 5.30 4.73
Ho 0.700 0.680 0.619 0.654 0.541 0.638
He 0.863 0.845 0.659 0.777 0.634 0.755
Fis 0.169 0.189 −0.131 0.126 −0.033 –
P 0.001 0.000 0.314 0.005 0.002 –
Ec_121 A 8 7 9 8 8 8.00
Ae 7.33 6.21 8.00 7.56 7.11 7.242
Ho 0.706 0.780 0.763 0.717 0.690 0.731
He 0.850 0.901 0.843 0.858 0.767 0.843
Fis 0.121 0.010 0.132 0.049 −0.027 –
P 0.021 0.053 0.006 0.010 0.035 –
Ec_122 A 8 9 7 9 10 8.6
Ae 7.80 8.10 6.40 8.22 9.22 7.94
Ho 0.789 0.813 0.743 0.711 0.811 0.773
He 0.811 0.900 0.859 0.659 0.800 0.805
Fis 0.129 0.118 0.212 0.184 0.234 –
P 0.000 0.231 0.318 0.008 0.183 –
Ec_124 A 8 10 9 9 8 8.80
Ae 7.67 9.34 8.24 8.56 7.00 8.16
Ho 0.690 0.743 0.690 0.709 0.648 0.696
He 0.759 0.871 0.801 0.810 0.790 0.806
Fis −0.030 −0.061 0.070 0.110 0.018 –
P 0.020 0.013 0.018 0.009 0.043 –
Ec_125 A 9 9 7 9 8 8.40
Ae 8.33 8.25 6.66 8.30 7.63 7.83
Ho 0.732 0.771 0.720 0.751 0.729 0.740
He 0.839 0.835 0.828 0.849 0.856 0.841
Fis 0.232 0.178 0.290 0.229 0.210 –
P 0.041 0.006 0.120 0.027 0.005 –
Ec_131 A 5 7 4 5 6 5.40
Ae 4.28 6.47 3.21 4.50 5.34 4.76
Ho 0.734 0.783 0.682 0.711 0.737 0.729
He 0.863 0.885 0.739 0.833 0.848 0.833
Fis 0.211 0.193 0.242 0.230 0.227 –
P 0.038 0.145 0.091 0.004 0.087 –
Ec_154 A 9 8 11 11 10 9.8
Ae 7.67 6.30 8.96 9.30 9.33 8.31
Ho 0.750 0.831 0.795 0.694 0.841 0.782
He 0.803 0.904 0.807 0.718 0.900 0.826
Fis 0.149 0.134 0.174 0.160 0.195 –
P 0.019 0.094 0.000 0.008 0.010 –
Ec_157 A 13 13 10 12 9 11.4
Ae 11.22 11.67 8.33 10.44 8.67 10.06
Ho 0.700 0.741 0.684 0.781 0.688 0.718
He 0.893 0.844 0.823 0.910 0.757 0.845
Fis 0.186 0.177 0.227 0.167 0.291 –
P 0.211 0.164 0.000 0.000 0.110 –
Ec_158 A 7 8 6 8 8 7.4
Ae 6.22 6.47 5.55 7.67 6.69 6.52
Ho 0.750 0.642 0.769 0.714 0.680 0.711
He 0.889 0.798 0.801 0.849 0.756 0.818
Fis 0.144 0.161 0.221 0.176 0.210 –
P 0.171 0.000 0.514 0.088 0.000 –
An-06 A 9 7 9 6 7 7.60
Ae 8.00 6.39 8.22 5.37 6.14 6.82
Ho 0.731 0.799 0.737 0.783 0.765 0.763
He 0.856 0.874 0.890 0.809 0.874 0.860
Fis −0.023 0.069 0.170 0.125 −0.061 –
P 0.004 0.086 0.156 0.128 0.067 –
An-15 A 8 8 5 6 7 6.80
Ae 7.26 7.50 5.00 5.29 6.53 6.31
Ho 0.683 0.629 0.597 0.603 0.667 0.635
He 0.798 0.758 0.719 0.817 0.794 0.777
Fis 0.211 0.291 0.077 0.191 0.068 –
P 0.003 0.105 0.000 0.089 0.045 –
Mean
A 8.09 8.36 7.36 8.00 7.90 7.94
Ae 7.34 7.42 6.59 7.23 7.17 7.15
Ho 0.724 0.746 0.709 0.711 0.708 0.719
±SE ±0.024 ±0.019 ±0.031 ±0.017 ±0.021 ±0.022
He 0.838 0.855 0.797 0.808 0.797 0.819
±SE ±0.031 ±0.011 ±0.054 ±0.037 ±0.031 ±0.032
Open in a new tab

All populations deviated significantly from HWE at most of the microsatellite loci. F-statistics were determined in a fixation index as genetic differentiation (FST) per locus varied from 0.189 (Ec_124) to 0.428 (Ec_157), and the mean FST of 11 loci was 0.263, the global heterozygote deficit among five Epinephelus spp. (FIT) value ranging from −0.002 to 0.140 with average 0.063 and the heterozygote deficit within the species/among species (FIS) among the 11 SSR markers value ranged between 0.024 and 0.192 with average 0.127 (Table 3). Average FST value indicated that about 26.3% of total genetic variation corresponded to differences between populations, while the remaining 73.7% corresponded to differences among individuals within populations. The mean genetic distance based on SSR analysis, ranged from 0.125 between E. bleekeri and E. malabaricus populations to 0.220 between E. areolatus and E. tauvina populations (Table 5). Using the genetic distance parameter, the UPGMA dendrogram indicated that grouper species under study could be classified into three clearly distinct groups (Fig. 4). The first category included E. tauvina and E. coioides; the other two categories included bleekeri and the E. malabaricus, with E. areolatus being the third population.

Fig. 4.

Fig. 4

Open in a new tab

UPGMA dendrogram of the five Epinephelus species based on genetic distances derived from SSR data.

The cophenetic correlation of ISSR and SSR were r = 0.842 and 0.815, respectively. There was no significant correlation between the distance and cophenetic matrices of the two marker systems, while the highly significant correlation coefficient of the two genetic matrices from the two marker systems was 0.869 (p < 0. 01).

4. Discussion

Understanding of genetic diversity for grouper species is highly important, for fisheries and aquaculture improvement. Morphological traits are a simple method to study biodiversity. The various genera and species cataloging rely on morphological traits. However, the strategy of conservation and management of genetic resources of grouper species based on morphological traits alone is extremely limited because these traits are influenced by age and various environmental factors (Becker et al., 2015, Hulley et al., 2018). Thus, it is essential to estimate the genetic diversity of such grouper species by molecular marker techniques so that it can be improved and preserved (Cuéllar-Pinzón, et al., 2016). Molecular markers are modern genetic tools, giving polymorphism at the DNA level, which are used to improve knowledge on the population structure of fish resources (Vignal et al., 2002, Liu and Cordes, 2004).

Number of alleles per population (A), effective number of alleles (Ae), observed heterozygosity (Ho), expected heterozygosity (He), inbreeding coefficient (Fis), and probability estimates regarding deviation from Hardy-Weinberg equilibrium (p).

This study gave the first detailed analysis of the level of genetic variation and genetic relationship among the genotypes of grouper species Epinephelus spp. on the Arabian Gulf coast of Saudi Arabia revealed by ISSR (dominant) and SSR (co-dominant) molecular markers that have been proven to be valuable for the determination of genetic diversity and taxonomic discrimination of the species (Kubota et al., 2014, Bernard et al., 2016, Hassanien and Al-Rashada, 2019, Oliveira et al., 2019).

The ISSR-PCR technique was applied to identify genetic similarity and diversity in grouper species Epinephelus spp. using ten polymorphic primers. The percentage of polymorphism at intra-population in grouper species was relatively low (ranged between 26.82% and 37.50%), but was high (46.8%) in the overall population, compared to giant grouper Epinephelus lanceolatus. In the same sense, a total of 166 bands produced from 17 ISSR primers included 58 were polymorphic bands (34.9%) in the giant grouper (E. lanceolatus) (Chiu, et al., 2012). E. malabaricus had the highest percentage observed in polymorphism, recommending this technique to be used in breeding programs. In the present study, a relatively high inter-population genetic diversity was observed in Epinephelus spp. (GST = 0.407), reported that 40.7% of the total genetic variation was among grouper species and 39.3% was within the populations. The Shannon information index across species was 0.216, indicating that 21.6% of effective alleles were on average identified per primer. Average gene flow (Nm) during the current investigation was determined as 0.911 showing limited gene flow across grouper species. These data could be attributed to the continual seasonal migration of grouper species influenced by thermal variation of water temperature in the Arabian Gulf during different seasons. According to Muneer, et al., (2009) the species with limited gene flow have a common trend to form well-defined population. ISSR is a dominant marker that has high reproducibility, compared with RAPD marker in the present study. The observed data showed that ISSR analyses were found more informative than RAPD technique (Chiu, et al., 2012).

Microsatellite analysis has been proofed to offer the best estimation of genetic diversity (by producing a greater amount of polymorphism) and a better understanding of intra‐ and interspecific variability among and within these Epinephelus spp. (Koedprang et al., 2007, An et al., 2014, Kubota et al., 2014). In the current investigation, the average number of alleles (A = 9.72) was lower than that found in E. coioides populations using microsatellite markers (Ec_122, Ec_154, and Ec_158) (Wang, et al., 2011). There is a high level of genetic diversity in all grouper species studied based on the average expected heterozygosity value (0.819) while the genetic variation was relatively low for E. coioides populations which collected from Thailand and Indonesia revealed by microsatellites (Antoro, et al., 2006). In addition, heterozygote deficiency was noted, as shown by the lower average value (0.719) compared to expected heterozygosity, as well as the positive value of FIS at almost all the loci (Table 4). These results were disagreeing with the estimation of genetic differentiation for eight grouper species based on microsatellites (Koedprang, et al., 2007). All microsatellite loci had significant differences (P ≤ 0.05) from Hardy–Weinberg Equilibrium (HWE). The results indicate that the microsatellite technique produced a greater average estimation of alleles per locus compared to ISSR, suggesting a greater diversity of alleles in grouper species. The obtained data confirm that microsatellite markers are co-dominant in nature and help in identification of heterozygotes in the populations. No diagnostic alleles observed with eleven loci to genetic differentiation between five grouper species. The results confirm the importance of using another microsatellite or other molecular markers more accurately such as mitochondrial/nuclear markers. The estimation of genetic diversity and taxonomic status of grouper species in the United Arab Emirates revealed by mitochondrial DNA, indicated that there were three species of grouper (Epinephelus coioides, E areolatus and E bleekeri) that were thought to be one species (Ketchum, et al., 2016). In addition, the identification of Red Sea grouper species (Serranidae) in Egypt, proved that the data for mitochondrial DNA (COI) and nuclear gene (12srRNA) were an accurate tool for Egyptian Red Sea grouper species discrimination (Galal-Khallaf, et al., 2019).

The Mantel test was conducted on two marker systems to obtain reliable assessments of genetic distance among the grouper species investigated with their cophenetic correlation values. The cophenetic correlation for ISSR and SSR were r = 0.842 and 0.815 respectively, which indicated a good fit of the data for genetic diversity analysis. No significant correlation was found between the distance and cophenetic matrices of the two markers. The highly significant correlation coefficient estimated by the Mantel test of the two genetic matrices from ISSR and SSR systems was 0.869 (p < 0.01).

5. Conclusions

The present study identified the high profile of genetic diversity and genetic relationship of grouper species Epinephelus spp. such as E. tauvina, E. coioides, E. bleekeri, E. malabaricus and E. areolatus in the eastern Saudi Arabia coast. These results can have significant implications for the grouper in terms of fisheries conservation and genetic improvement programs. ISSR and SSR markers were useful tools for investigating genetic diversity and genetic structure of grouper species. The results indicated that the SSR molecular markers were better than ISSR molecular markers for the determination of the genetic diversity and genetic relationship between grouper species. More research is recommend for identification of grouper species based on more accurate molecular techniques like COI or other mitochondrial/nuclear markers.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

The authors acknowledge Scientific Research Deanship, King Faisal University, Saudi Arabia, for funding this work by a grant project no. 160071.

Footnotes

Peer review under responsibility of King Saud University.

References

  1. Allen, G., Erdmann, M., 2012. Reef Fishes of the East Indies, III. Tropical Reef Research, Perth, Australia.
  2. An H.S., Cho J.K., Kim K.M., Son M.H., Park J.Y., Myeong J.I., An C.M. Genetic characterization of four hatchery populations of the seven-band grouper (Epinephelus septemfasciatus) using microsatellite markers. Biochem. Syst. Ecol. 2014;57:297–304. doi: 10.1016/j.bse.2014.08.018. [DOI] [Google Scholar]
  3. Antoro S., Na-Nakorn U., Koedprang W. Study of genetic diversity of orange-spotted grouper, Epinephelus coioides, from Thailand and Indonesia using microsatellite markers. Mar. Biotechnol. (NY) 2006;8:17–26. doi: 10.1007/s10126-005-5026-0. [DOI] [PubMed] [Google Scholar]
  4. Becker R., Sales N.G., Santos G., Santos G., Carvalho D. DNA barcoding and morphological identification of neotropical ichthyoplankton from the Upper Paraná and São Francisco. J. Fish Biol. 2015;87:159–168. doi: 10.1111/jfb.12707. [DOI] [PubMed] [Google Scholar]
  5. Bernard A.M., Feldheim K., Nemeth R., Kadison E., Blondeau J., Semmens B., Shivji M. The ups and downs of coral reef fishes: the genetic characteristics of a formerly severely overfished but currently recovering Nassau grouper fish spawning aggregation. Coral Reefs. 2016;35:273–284. [Google Scholar]
  6. Chiu T.-H., Su Y.-C., Pai J.-Y., Chang H.-C. Molecular markers for detection and diagnosis of the giant grouper (Epinephelus lanceolatus) Food Control. 2012;24:29–37. doi: 10.1016/j.foodcont.2011.08.033. [DOI] [Google Scholar]
  7. Craig M.T., Hastings P.A. A molecular phylogeny of the groupers of the subfamily Epinephelinae (Serranidae) with a revised classification of the Epinephelini. Ichthyol. Res. 2007;54:1–17. [Google Scholar]
  8. Craig M.T., de Mitcheson Y.S., Heemstra P.C. NISC South Africa; 2011. Groupers of the World: A Field and Market Guide. [Google Scholar]
  9. Cuéllar-Pinzón J., Presa P., Hawkins S.J., Pita A. Genetic markers in marine fisheries: types, tasks and trends. Fish. Res. 2016;173:194–205. [Google Scholar]
  10. Galal-Khallaf A., Osman A.G.M., El-Ganainy A., Farrag M.M., Mohammed-AbdAllah E., Moustafa M.A., Mohammed-Geba K. Mitochondrial genetic markers for authentication of major Red Sea grouper species (Perciformes: Serranidae) in Egypt: a tool for enhancing fisheries management and species conservation. Gene. 2019;689:235–245. doi: 10.1016/j.gene.2018.12.021. [DOI] [PubMed] [Google Scholar]
  11. Govindaraju G.S., Jayasankar P. Taxonomic relationship among seven species of groupers (genus Epinephelus; family Serranidae) as revealed by RAPD fingerprinting. Mar. Biotechnol. (NY) 2004;6:229–237. doi: 10.1007/s10126-003-0021-9. [DOI] [PubMed] [Google Scholar]
  12. Grandcourt E., Al Abdessalaam T., Francis F., Al Shamsi A. Population biology and assessment of the orange-spotted grouper, Epinephelus coioides (Hamilton, 1822), in the southern Arabian Gulf. Fish. Res. 2005;74:55–68. doi: 10.1111/j.1095-8649.2008.02163.x. [DOI] [PubMed] [Google Scholar]
  13. Hassanien H.A., Al-Rashada Y. Estimation of genetic variation in green tiger prawn, Penaeus semisulcatus by using random amplified polymorphic DNA, inter simple sequence repeat and simple sequence repeat markers. Aquac. Res. 2019;50:1626–1633. [Google Scholar]
  14. Heemstra P.C., Randall J.E. Groupers of the world. FAO Fisheries Synop. 1993;16:I. [Google Scholar]
  15. Hulley E.N., Taylor N.D., Zarnke A.M., Somers C.M., Manzon R.G., Wilson J.Y., Boreham D.R. DNA barcoding vs. morphological identification of larval fish and embryos in Lake Huron: Advantages to a molecular approach. J. Great Lakes Res. 2018;44:1110–1116. [Google Scholar]
  16. Jackson A.M., Semmens B.X., Sadovy de Mitcheson Y., Nemeth R.S., Heppell S.A., Bush P.G., Aguilar-Perera A., Claydon J.A., Calosso M.C., Sealey K.S., Scharer M.T., Bernardi G. Population structure and phylogeography in Nassau grouper (Epinephelus striatus), a mass-aggregating marine fish. PLoS ONE. 2014;9:e97508. doi: 10.1371/journal.pone.0097508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jefri E., Zamani N.P., Subhan B., Madduppa H.H. Molecular phylogeny inferred from mitochondrial DNA of the grouper Epinephelus spp. in Indonesia collected from local fish market. Biodiversitas J. Biol. Div. 2015;16:254–263. [Google Scholar]
  18. Ketchum R.N., Dieng M.M., Vaughan G.O., Burt J.A., Idaghdour Y. Levels of genetic diversity and taxonomic status of Epinephelus species in United Arab Emirates fish markets. Mar. Pollut. Bull. 2016;105:540–545. doi: 10.1016/j.marpolbul.2015.11.042. [DOI] [PubMed] [Google Scholar]
  19. Koedprang W., Na-Nakorn U., Nakajima M., Taniguchi N. Evaluation of genetic diversity of eight grouper species Epinephelus spp. based on microsatellite variations. Fish. Sci. 2007;73:227–236. [Google Scholar]
  20. Kubota S., Liu Q., Kessuwan K., Okamoto N., Sakamoto T., Nakamura Y., Shigenobu Y., Sugaya T., Sano M., Uji S., Nomura K., Ozaki A. High-throughput simple sequence repeat (SSR) markers development for the kelp grouper (Epinephelus bruneus) and cross-species amplifications for Epinephelinae species. Adv. Biosci. Biotechnol. 2014;05:117–130. doi: 10.4236/abb.2014.52016. [DOI] [Google Scholar]
  21. Liu Z.J., Cordes J. DNA marker technologies and their applications in aquaculture genetics. Aquaculture. 2004;238:1–37. [Google Scholar]
  22. Maggio T., Andaloro F., Hemida F., Arculeo M. A molecular analysis of some Eastern Atlantic grouper from the Epinephelus and Mycteroperca genus. J. Exp. Mar. Biol. Ecol. 2005;321:83–92. doi: 10.1016/j.jembe.2005.01.004. [DOI] [Google Scholar]
  23. Mantel N. The detection of disease clustering and a generalized regression approach. Cancer Res. 1967;27:209–220. [PubMed] [Google Scholar]
  24. Martinez A.S., Willoughby J.R., Christie M.R. Genetic diversity in fishes is influenced by habitat type and life-history variation. Ecol. Evol. 2018;8:12022–12031. doi: 10.1002/ece3.4661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Muneer P.A., Gopalakrishnan A., Musammilu K., Mohindra V., Lal K.K., Basheer V., Lakra W. Genetic variation and population structure of endemic yellow catfish, Horabagrusbrachysoma (Bagridae) among three populations of Western Ghat region using RAPD and microsatellite markers. Mol. Biol. Rep. 2009;36:1779–1791. doi: 10.1007/s11033-008-9381-6. [DOI] [PubMed] [Google Scholar]
  26. Nei M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genet. Sel. Evol. 1978;89:583–590. doi: 10.1093/genetics/89.3.583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Noikotr K., Chaveerach A., Pinthong K., Tanomtong A., Sudmoon R., Tanee T. RAPD and barcode analyses of groupers of the genus Epinephelus. Genet. Mol. Res. 2013;12:5721–5732. doi: 10.4238/2013.November.18.21. [DOI] [PubMed] [Google Scholar]
  28. Oh S.-R., Kang H.-C., Lee C.-H., Hur S.-W., Lee Y.-D. Sex reversal and masculinization according to growth in longtooth grouper Epinephelus bruneus. Dev. Reprod. 2013;17:79–85. doi: 10.12717/DR.2013.17.2.079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Oliveira C.d.S.T., Moreira R.F.C., Soares Filho A.A., Fonteles S.B.A., Evangelista-Barreto N.S. Genetic diversity in natural populations of Colossomamacropomum in the Brazilian Amazon region and in populations farmed in Northeast Brazil based on ISSR markers. Aquacult. Int. 2019;27:1423–1434. [Google Scholar]
  30. Peakall R., Smouse R.P.P. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics. 2012;28:2537–2539. doi: 10.1093/bioinformatics/bts460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Priest M.A., DiBattista J.D., McIlwain J.L., Taylor B.M., Hussey N.E., Berumen M.L. A bridge too far: dispersal barriers and cryptic speciation in an Arabian Peninsula grouper (Cephalopholis hemistiktos) J. Biogeogr. 2016;43:820–832. [Google Scholar]
  32. Rimmer M.A., Glamuzina B. A review of grouper (Family Serranidae: subfamily Epinephelinae) aquaculture from a sustainability science perspective. Rev. Aquac. 2019;11:58–87. [Google Scholar]
  33. Rohlf F.J. Exeter Software; New York: 2000. NTSYS-pc: Numerical Taxonomy and Multivariate Analysis System, Version 2.2. [Google Scholar]
  34. Roy T., Gopalakrishnan A., Muneer P., John L., Musammilu K., Basheer V. Resolution of taxonomic ambiguity in groupers (Pisces: Serranidae) by the random amplified polymorphic DNA (RAPD) technique. Indian J. Fish. 2014;61:28–34. [Google Scholar]
  35. Tupper M., Sheriff N. Capture-based aquaculture of groupers. Capture-based aquaculture. Glob. Over. 2008:217–253. [Google Scholar]
  36. Vaini J.O., Mota K.G., Ojeda A.P., Barreiros J.P., Moreira R.G., Hilsdorf A.W.S. Development and characterization of 20 polymorphic microsatellite markers for Epinephelus marginatus (Lowe, 1834) (Perciformes: Epinephelidae) using 454 pyrosequencing. Genet. Mol. Biol. 2019;42:74–79. doi: 10.1590/1678-4685-GMB-2018-0067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Vignal A., Milan D., SanCristobal M., Eggen A. A review on SNP and other types of molecular markers and their use in animal genetics. Genet. Sele. Evol. 2002;34:275. doi: 10.1186/1297-9686-34-3-275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wang L., Meng Z., Liu X., Zhang Y., Lin H. Genetic diversity and differentiation of the orange-spotted grouper (Epinephelus coioides) between and within cultured stocks and wild populations inferred from microsatellite DNA analysis. Int. J. Mol. Sci. 2011;12:4378–4394. doi: 10.3390/ijms12074378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Yang S., Wang L., Zhang Y., Liu X.C., Lin H.R., Meng Z.N. Development and characterization of 32 microsatellite loci in the giant grouper Epinephelus lanceolatus (Serranidae) Genet. Mol. Res. 2011;10:4006–4011. doi: 10.4238/2011.December.12.3. [DOI] [PubMed] [Google Scholar]
  40. Yeh F.C., Yang R.-C., Boyle T. University of Alberta; Edmonton, Canada: 1999. POPGENE Version 1.31. Microsoft Window-based Freeware for Population Genetic Analysis. [Google Scholar]

Articles from Saudi Journal of Biological Sciences are provided here courtesy of Elsevier

RESOURCES