Abstract
Background
Alveolar echinococcosis (AE) is caused by parasitic infection by Echinococcus multilocularis. Its diagnosis is usually based on clinical symptoms, ultrasound, and other imaging methods. MicroRNAs (miRNAs) play important roles in disease processes and can exist in a highly stable cell-free form in body fluids. It is important to identify specific, sensitive diagnostic markers for early diagnosis and evaluation of AE. In this study, we examined hsa-miR-125b-5p as a potential plasma biomarker of E. multilocularis infection.
Methods
Plasma samples from patients with AE and healthy individuals were screened for the presence of five miRNAs using miRNA chips. We used quantitative polymerase chain reaction to measure miRNA expression levels in plasma and liver tissue samples from patients with AE.
Results
hsa-miR-125b-5p was stably upregulated in the plasma and liver tissue samples from patients with AE.
Conclusions
The results suggest that hsa-miR-125b-5p may be a promising biomarker for early, non-invasive diagnosis of AE.
Keywords: Echinococcus multilocularis, Alveolar echinococcosis, Biomarker, hsa-miR-125b-5p, Plasma
Background
Echinococcus multilocularis is a small tapeworm belonging to the family Taeniidae of the class Cestoda. The parasite requires two different hosts to complete its lifecycle. Adult worms live in the intestine of carnivorous definitive hosts, such as foxes or wolves. The worms produce a large number of eggs that are released into the environment via the feces of the host. These eggs are ingested from contaminated food or drink by intermediate hosts, such as ruminants, rodents, or humans [1–3]. The eggs develop into larvae that grow into cysts called alveolar echinococcosis (AE) in the liver of the intermediate hosts, encysting and producing large numbers of protoscoleces, thus causing the zoonotic parasitic disease. When canines ingest infected rodents or viscera from intermediate hosts, the protoscoleces in the AE cysts in the canine intestine are activated and develop into adult worms in the intestine, completing the life cycle.
AE is particularly common in areas with developed animal husbandry, such as the northwest and Tibetan plateau in China, especially the Qinghai Tibetan plateau [4]. AE resembles a slow-growing liver cancer (called “worm carcinoma”), progressively infiltrating neighboring tissues and organs and even metastasizing to the brain, lungs, and other organs, thereby causing serious complications [5]. AE thus poses a significant threat to human health [6]. When left untreated, its five- and 10-year mortality rates are 52 and 96%, respectively [7]. AE poses a significant burden wherever it occurs [8]. AE is diagnosed primarily based on medical history, clinical findings, imaging techniques, and the detection of specific antibodies [9].
These diagnostic methods have drawbacks, and there is no stable and quantifiable indicator for evaluating therapeutic effects or follow-up in AE [10]. Recently, it was reported that circulating microRNAs (miRNAs) could serve as biomarkers for the detection of parasitic infections [11–13]. miRNAs are short, endogenous, non-coding RNAs that post-transcriptionally regulate gene expression by binding to the 3′-untranslated regions of target mRNAs [14]. Several studies have demonstrated the feasibility of stable detection of circulating miRNAs in the serum and plasma. miRNAs have been used as biomarkers for the early diagnosis, classification, and prognosis of various tumors, liver damages, and other diseases [15–20]. For example, sja-miR-2b-5p and sja-miR-2c-5p have been used as biomarkers with high specificity and sensitivity for the diagnosis of Schistosoma japonicum infection, while miR-277 and miR-3479-3p have been used to detect Schistosoma mansoni infection [21]. A group of miRNAs, including miR-125b, are significantly dysregulated in the plasma of patients with malaria involving multiple organ failure, indicating that miRNAs could be used as biomarkers for severe malaria infection [22]. Similarly, miR-125b-5p has been found to enhance the diagnostic potential of carcinoembryonic antigens for early-stage colon cancer [23].
miRNA assays have high sensitivity and specificity and can detect miRNAs in a small amount of blood, making sampling minimally invasive. The use of miRNAs in mouse sera as diagnostic biomarkers for AE has been studied [24], but there have been few studies on the use of miRNAs for the diagnosis of AE. The aim of this study was to validate the upregulation of miR-125b-5p in plasma after infection with E. multilocularis using quantitative polymerase chain reaction (qPCR).
Methods
MicroRNA expression profiling and detection
Twenty subjects (10 AE cases and 10 healthy cases) were randomly selected from AE inpatients and healthy outpatient individuals at the Affiliated Hospital of Qinghai University. This study was approved by the ethics review board of the Affiliated Hospital of Qinghai University (approval number: P-SL-2019054) for miRNA chip screening. An mParaflo miRNA microarray assay was performed by an external service provider (LC Sciences, Houston, TX, USA). Hybridization images were collected using a laser scanner (GenePix 4000B, Molecular Devices, San Jose, CA, USA) and digitized using Array-Pro image analysis software (Media Cybernetics Inc., Rockville, MD, USA). Data were analyzed by first subtracting the background and then normalizing the signals using a locally weighted regression filter. For two-color experiments, the ratio of the two sets of detection signals (log2 transformed, balanced) was calculated, and significant differences were determined using t-tests. Significantly different signals were defined as those with P-values less than 0.05. Multi-array normalization and clustering analysis were performed using a hierarchical method with average linkage and Euclidean distance metric. Clustering plots were generated for miRNAs with a total signal density of more than 1000 using the MultiExperiment Viewer software (v4.0, 2006) from the Institute for Genomic Research. The different miRNAs are shown in supplementary materials (Table 1).
Table 1.
The prediction of target genes of miRNAs
| miRNA name | Log2 (G2/G1) | P-value | Target Sequence (5′ to 3′) | Accession No. |
|---|---|---|---|---|
| hsa-miR-6849-3p | −7.96 | 0.015 | ACCAGCCUGUGUCCACCUCCAG | MIMAT0027599 |
| hsa-miR-3165 | −3.93 | 0.047 | AGGUGGAUGCAAUGUGACCUCA | MIMAT0015039 |
| hsa-miR-377-5p | −2.96 | 0.046 | AGAGGUUGCCCUUGGUGAAUUC | MIMAT0004689 |
| hsa-miR-4725-3p | −1.97 | 0.035 | UGGGGAAGGCGUCAGUGUCGGG | MIMAT0019844 |
| hsa-miR-937-5p | −7.42 | 0.001 | GUGAGUCAGGGUGGGGCUGG | MIMAT0022938 |
| hsa-miR-203a-3p | 6.88 | 0.003 | GUGAAAUGUUUAGGACCACUAG | MIMAT0000264 |
| hsa-miR-577 | 3.11 | 0.005 | UAGAUAAAAUAUUGGUACCUG | MIMAT0003242 |
| hsa-miR-7113-3p | 6.38 | 0.006 | CCUCCCUGCCCGCCUCUCUGCAG | MIMAT0028124 |
| hsa-miR-125b-5p | 2.42 | 0.0126 | UCCCUGAGACCCUAACUUGUGA | MIMAT0000423 |
| hsa-miR-6738-3p | 3.20 | 0.0143 | CUUCUGCCUGCAUUCUACUCCCAG | MIMAT0027378 |
| hsa-miR-32-5p | 5.09 | 0.0153 | UAUUGCACAUUACUAAGUUGCA | MIMAT0000090 |
| hsa-miR-938 | −2.01 | 0.0881 | UGCCCUUAAAGGUGAACCCAGU | MIMAT0004981 |
| hsa-let-7e-5p | −3.07 | 0.0182 | UGAGGUAGGAGGUUGUAUAGUU | MIMAT0000066 |
| hsa-miR-935 | −5.77 | 0.0251 | CCAGUUACCGCUUCCGCUACCGC | MIMAT0004978 |
| hsa-miR-382-5p | −3.91 | 0.056 | GAAGUUGUUCGUGGUGGAUUCG | MIMAT0000737 |
| hsa-miR-520e | −1.49 | 0.00623 | AAAGUGCUUCCUUUUUGAGGG | MIMAT0002825 |
Plasma from patients with AE and healthy individuals
We collected plasma from 44 inpatients with AE (22 males and 22 females) and 44 healthy outpatient individuals (22 males and 22 females) at the Affiliated Hospital of Qinghai University. This study was approved by the Ethics Review Board of the Affiliated Hospital of Qinghai University (approval number: P-SL-2019054). All patients were diagnosed based on their clinical symptoms and imaging data. Whole blood samples were collected in tubes, allowed to clot at 4 °C for 2 h, and centrifuged at 12,000×g for 10 min at 4 °C. Plasma was separated from the whole blood samples, and centrifuged at 12,000×g for 10 min at 4 °C to remove cell debris and blood platelets. Hemolyzed samples were excluded. Subsequently, the supernatant was transferred to fresh tubes and stored at − 80 °C until further analysis.
Collection of liver tissues from patients with AE and healthy individuals
AE lesions and sections distant from the lesion (3 × 3 × 3 mm3) were resected from the liver, washed three times in phosphate-buffered saline, and stored in liquid nitrogen until further analysis.
Cell culture and transfection
L-O2 hepatocytes were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and penicillin/streptomycin at 37 °C in a humidified atmosphere containing 5% CO2. Approximately 50 nM of hsa-miR-125b-5p or control inhibitor, both purchased from JIKAI (Shanghai Jikai, China), was transfected into L-O2 cells for 48 h using riboFECTCP transfection kits (Guangzhou RiboBio Co., Guangzhou, China), according to the manufacturer’s instructions. All experiments were performed using cells in the log phase.
RNA extraction
Total RNA was isolated from plasma and tissue samples using TRIzol, according to the manufacturer’s instructions. The concentration and integrity of isolated RNAs were evaluated using an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). cDNA was synthesized using PrimeScript Reverse Transcriptase (TIANGEN Biotech, Beijing, Co. Ltd., Beijing, China) according to the manufacturer’s protocol. Primers targeting hsa-miR-125b-5p (reverse transcription (RT): 5′-UCCCUGAGACCCUAACUUGUGA-3′; PCR forward primer: 5′-TCCCTGAGACCCTAACTTGTGA-3′; and PCR reverse primer: 5′-GTGCAGGGTCCGAGGT-3′) and U6 (RT primer: 5′-UGAGGUAGGAGGUUGUAUAGUU-3′; PCR forward primer: 5′-TGAGGTAGGAGGTTGTATAGTT-3′; and PCR reverse primer: 5′-GTGCAGGGTCCGAGGT − 3′) were purchased from Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).
qPCR
qPCR was performed using a LightCycler® 480II and Tiangen SYBR Green PCR Kits. U6 was used as the endogenous control for miRNA amplification. The reaction volume was 25 μL, and was set up according to the TB GreenTM Premix Ex TaqTMII protocol. All samples and blanks were analyzed in triplicate. The reaction conditions were as follows: pre-denaturation at 95 °C for 30 s, followed by 95 °C for 5 s and 60 °C for 30 s for 40 cycles. The melting curves were generated using the following temperatures: 95 °C for 5 s and 60 °C for 1 min. Relative miRNA expression level was calculated using the 2-△△Ct method and normalized to U6 levels.
Inhibition of hsa-miR-125b-5p in treated L-O2 hepatocytes
L-O2 hepatocytes were transfected with lentiviral vector (LV), LV-hsa-miR-125b-5p-inhibitor, or the negative control virus CON137 and incubated for 5 days. The transfected cells were subsequently analyzed with the Cell Counting Kit-8 (Dojindo, CK04, Japan) for 2 h according to manufacturer’s instructions to determine the absorption at 450 nm in a time-dependent manner. The resulting OD450 represents the number of viable cells.
Fluorescence-activated cell sorter analysis for apoptosis
LV-hsa-miR-125b-5p-inhibitor transfection solution and L-O2 hepatocytes were cultured in six-well culture plates in triplicate. To ensure that a detectable number of cells were present, a cell density of ≥5 × 105 cells/mL was used. Confluence was 85% on the fifth day after transfection. The cells were collected and centrifuged at 250×g for 5 min at 4 °C, washed with cold PBS, resuspended in complete medium, and centrifuged at 250×g for 3 min. Cells were resuspended in 200 μL 1× binding buffer, and 10 μL Annexin V-APC was added to stain the cells. The cells were incubated for 10–15 min at room temperature (20–25 °C) in the dark, and subsequently analyzed using BD Cytoflow.
Statistical analysis
Data are presented as the mean ± standard deviation. Independent sample t-tests were performed to identify significant differences between the groups, using GraphPad Prism 8 (https://www.graphpad.com/scientific-software/prism/#prism-8-new). P < 0.05 was considered to indicate a significant difference.
Results
microRNA expression in plasma samples
Using a cutoff of P < 0.01 and |log2foldchange| ≥ 2 [13], we chose to investigate the expression of five miRNAs (has-miR-4725-5p, has-miR-125b-5p, hsa-miR-520e, has-miR-3165, and let7e-5p) in the plasma of patients with AE. The miRNAs in black font in Table 1 are those confirmed by qRT-PCR. Only has-miR-125b-5p was stably upregulated in the plasma of AE patients. hsa-miR-520e was not detected in plasma from patients with AE. Although miR-4725-5p, has-miR-3165, and let7e-5p were also detected, their expression was unstable in plasma from AE patients.
qPCR analysis of hsa-miR-125b-5p expression
qRT-PCR showed that hsa-miR-125b-5p was stably upregulated in the plasma samples of patients with AE (P < 0.001; Fig. 1). The area under the receiver operating characteristic (ROC) curve calculated for miR-125b-5p was 0.9967 (95% confidence interval [CI]: 0.9907–1.000). q-PCR showed that the expression of hsa-miR-125b-5p in 8 liver lesions from patients with AE and healthy individuals was statistically significant (P < 0.001; Fig. 2). The area under the ROC curve was 0.9365 (95% CI: 0.8701–1.000).
Fig. 1.
Relative expression of hsa-miR-125b-5p in the plasma of patients with AE (treated) and healthy individual (control). The receiver operating characteristic curve for the relative expression of hsa-miR-125b-5p in healthy individual and patient with AE plasma
Fig. 2.
Relative expression of hsa-miR-125b-5p in AE lesions (treated) and sections distant from the lesion of liver (control). The receiver operating characteristic curve for the relative expression of hsa-miR-125b-5p in AE lesions and sections distant from the lesion of liver
Inhibition of hsa-miR-125b-5p in treated L-O2 hepatocytes
Normal L-O2 hepatocytes were transfected with LV, LV-hsa-miR-125b-5p-inhibitor, or negative control virus CON137 (Fig. 3). On the fifth day after treatment, the OD450 of the LV-hsa-miR-125b-5p-inhibitor group was 3.242 ± 0.032, whereas that of the control group was 1.738 ± 0.008 (P < 0.05; Fig. 4).
Fig. 3.
LV-hsa-miR-125b-5p inhibitor-transfected normal L-O2 hepatocytes (magnification, 100×)
Fig. 4.

t-test analysis of cell proliferation of LV-hsa-miR-125b-5p inhibitor-transfected and control cells (NC; P < 0.05)
The apoptosis rate (%) of the LV-hsa-miR-125b-5p-inhibitor group was 4.84 ± 0.09, whereas that of the control group was 1.91 ± 0.18 (P < 0.05). Apoptosis was decreased between the control and LV-hsa-miR-125b-5p inhibitor-transfected L-O2 cells after 5 days (P < 0.05) (Fig. 5).
Fig. 5.

t-test analysis of apoptosis in control and LV-hsa-miR-125b-5p inhibitor-transfected L-O2 cells (P < 0.05)
Discussion
miRNAs are small, non-coding regulatory RNAs that can play important roles in the pathogenesis of parasitic diseases [25–27]. miRNAs are stably expressed not only in tissues, but also in blood or body fluids. Recent reports have shown that these extracellular RNAs are associated with a variety of liver diseases, including viral hepatitis, steatohepatitis (both alcoholic and nonalcoholic), and drug-induced liver injury [28]. Further, miRNAs are considered biomarkers for early diagnosis of diseases, including liver injury [29]. Obtaining plasma for miRNA detection is non-invasive and less traumatic than collecting tissues for the same purpose. Moreover, plasma miRNAs can be stably detected and thus have a great research prospect. Further, serum miRNA expression has been widely studied in liver lesions. The expression of miR-222, miR-21, and miR-223 in the sera of patients with chronic hepatitis B-induced hepatocellular carcinoma was significantly different from that of the normal control [30]. Cai et al. [31] reported that miR-122, miR-21, and miR-34a can be used as biomarkers to support the early diagnosis of schistosomiasis. Jia et al. [32] found that the expression of mmu-miR-712-3p, mmu-miR-511-5p, and mmu-miR-217-5p was significantly increased species-specifically in the plasma of mice infected with Toxoplasma gondii, suggesting that miRNAs can be used as biomarkers for T. gondii infection. These evidences suggest that abnormal miRNA expression can indicate the progress of disease.
miR-125b-5p, a member of the miR-125 family, was found to regulate the proliferation of differentiated tumor cells, as first reported in 2005 by Lee et al. [33]. Studies on miRNA-125b-5p in liver tumors and liver microbial diseases showed that the expression of miRNA-125b-5p in the plasma and tissue of patients is significantly altered [34–36]. Recent studies have also explored the possibility of using plasma miRNA-125b-5p as a diagnostic biomarker for early-stage cervical cancer and rheumatoid arthritis [37, 38].
In this study, the expression level and diagnostic value of hsa-miR-125b-5p were validated by q-PCR in the plasma and liver lesions of patients with AE compared with those of healthy individuals. Transfection with LV-hsa-miR-125b-5p-inhibitor reduced apoptosis in L-O2 hepatocytes in vitro. We thus speculated that miR-125b-5p plays a role in AE and that inhibiting miR-125b-5p may protect hepatocytes and reduce AE progression. It is not clear why miRNA-125b-5p expression increases in the plasma and liver lesions of patients with AE. Therefore, further study is required to elucidate the mechanism underlying the increase in miRNA-125b-5p expression in the plasma/sera and liver lesions of patients with AE after liver injury. In this study, miR-125b-5p exhibited an increasing trend. Our results can be used as the basis for further research to determine whether miR-125b-5p is really valuable in the diagnosis and prognosis of AE.
Conclusions
The detection of plasma miRNAs is non-invasive, and can be applied for the investigation, prevention, and diagnosis of diseases. From the results of this study, miR-125b-5p might serve as a promising diagnostic marker for AE.
Acknowledgments
We would like to thank Editage (www.editage.com) for English language editing.
Abbreviations
- AE
Alveolar echinococcosis
- miRNAs
Circulating microRNAs
- qPCR
Quantitative polymerase chain reaction
- LV
Lentiviral vector
- ROC
Receiver operating characteristic
- 95% CI
95% confidence interval
Authors’ contributions
CDP conceived and designed the study and drafted the manuscript. JBF performed qRT-PCR and data analysis. ZYG and PMQ helped design the study and revised the draft manuscript. All authors read and approved the final manuscript.
Funding
This work was supported by Guangxi Zhuang Autonomous Region Science and Technology Department Project (grant 2020JJA140073) and Qinghai Science and Technology Department Project (grant 2019-SF-131).
Availability of data and materials
The datasets used in this study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
This study was approved by the ethics review board of the Affiliated Hospital of Qinghai University (approval number: P-SL-2019054). Written informed consent was obtained from all patients.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Nunnari G, Pinzone MR, Gruttadauria S, Celesia BM, Madeddu G, Malaguarnera G, et al. Hepatic echinococcosis: clinical and therapeutic aspects. World J Gastroenterol. 2012;18:1448–1458. doi: 10.3748/wjg.v18.i13.1448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Mariconti M, Bazzocchi C, Tamarozzi F, Meroni V, Genco F, Maserati R, et al. Immunoblotting with human native antigen shows stage-related sensitivity in the serodiagnosis of hepatic cystic echinococcosis. Am J Trop Med Hyg. 2014;90:75–79. doi: 10.4269/ajtmh.13-0341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Gottstein B, Wang JH, Blagosklonov O, Grenouillet F, Millon L, Vuitton DA, et al. Echinococcus metacestode: in search of viability markers. Parasite. 2014;21:63. doi: 10.1051/parasite/2014063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Wang H, Zhang JX, Schantz PM. Epidemiologic survey and analysis on echinococcosis in humans and animals from 1995 to 2005 in Qinghai province. Chin J Zoonoses. 2006;22:1129. [Google Scholar]
- 5.Brunetti E, Kern P, Vuitton DA. Expert consensus for the diagnosis and treatment of cystic and alveolar echinococcosis in humans. Acta Trop. 2010;114:1–16. doi: 10.1016/j.actatropica.2009.11.001. [DOI] [PubMed] [Google Scholar]
- 6.Eckert J, Deplazes P. Biological, epidemiological, and clinical aspects of echinococcosis, a zoonosis of increasing concern. Clin Microbiol Rev. 2004;17:107–135. doi: 10.1128/CMR.17.1.107-135.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Giraudoux P, Pleydell D, Raoul F, Quéré JP, Wang Q, Yang Y, et al. Transmission ecology of Echinococcus multilocularis: what are the ranges of parasite stability among various host communities in China. Parasitol Int. 2006;55:S237–S246. doi: 10.1016/j.parint.2005.11.036. [DOI] [PubMed] [Google Scholar]
- 8.Wang TP, Cao ZG. Progress in prevention and control of Chinese hydatid disease and its existing problems. Zhongguo Jishengchongxue yu Jishengchongbing Fangzhi Zazhi. 2018;36:291–296. [Google Scholar]
- 9.Polat KY, Balik AA, Celebi F. Hepatic alveolar echinococcosis: clinical report from an endemic region. Can J Surg. 2002;45:415–419. [PMC free article] [PubMed] [Google Scholar]
- 10.Guo X, Zheng Y. Expression profiling of circulating miRNAs in mouse serum in response to Echinococcus multilocularis infection. Parasitology. 2017;144:1079–1087. doi: 10.1017/S0031182017000300. [DOI] [PubMed] [Google Scholar]
- 11.Baraquin A, Hervouet E, Richou C, Flori P, Peixoto P, Azizi A, et al. Circulating cell-free DNA in patients with alveolar echinococcosis. Mol Biochem Parasitol. 2018;222:14–20. doi: 10.1016/j.molbiopara.2018.04.004. [DOI] [PubMed] [Google Scholar]
- 12.He X, Sai X, Chen C, Zhang Y, Xu X, Zhang D, et al. Host serum miR-223 is a potential new biomarker for Schistosoma japonicum infection and the response to chemotherapy. Parasit Vectors. 2013;6:272. doi: 10.1186/1756-3305-6-272. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Hoy AM, Lundie RJ, Ivens A, Quintana JF, Nausch N, Forster T, et al. Parasite-derived microRNAs in host serum as novel biomarkers of helminth infection. PLoS Negl Trop Dis. 2014;8:e2701. doi: 10.1371/journal.pntd.0002701. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–297. doi: 10.1016/S0092-8674(04)00045-5. [DOI] [PubMed] [Google Scholar]
- 15.Chen X, Ba Y, Ma L, Cai X, Yin Y, Wang K, et al. Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res. 2008;18:997–1006. doi: 10.1038/cr.2008.282. [DOI] [PubMed] [Google Scholar]
- 16.Watany MM, Hagag RY, Okda HI. Circulating miR-21, miR-210 and miR-146a as potential biomarkers to differentiate acute tubular necrosis from hepatorenal syndrome in patients with liver cirrhosis: a pilot study. Clin Chem Lab Med. 2018;56:739–747. doi: 10.1515/cclm-2017-0483. [DOI] [PubMed] [Google Scholar]
- 17.Schueller F, Roy S, Loosen SH, Alder J, Koppe C, Schneider AT, et al. miR-223 represents a biomarker in acute and chronic liver injury. Clin Sci (Lond) 2017;131:1971–1987. doi: 10.1042/CS20170218. [DOI] [PubMed] [Google Scholar]
- 18.Tao YC, Wang ML, Wang M, Ma YJ, Bai L, Feng P, et al. Quantification of circulating miR-125b-5p predicts survival in chronic hepatitis B patients with acute-on-chronic liver failure. Dig Liver Dis. 2019;51:412–418. doi: 10.1016/j.dld.2018.08.030. [DOI] [PubMed] [Google Scholar]
- 19.Mogahed NM, Khedr SI, Ghazala RA, Masoud IM. Can miRNA712-3p be a promising biomarker for early diagnosis of toxoplasmosis? Asian Pac J Trop Med. 2018;11:688–692. doi: 10.4103/1995-7645.248341. [DOI] [Google Scholar]
- 20.Grasedieck S, Sorrentino A, Langer C, Buske C, Döhner H, Mertens D, et al. Circulating microRNAs in hematological diseases: principles, challenges, and perspectives. Blood. 2013;121:4977–4984. doi: 10.1182/blood-2013-01-480079. [DOI] [PubMed] [Google Scholar]
- 21.Mu Y, Cai P, Olveda R, Ross A, Olveda D, McManus D. Parasite-derived circulating microRNAs as biomarkers for the detection of human Schistosoma japonicum infection. Parasitology. 2020;147:889–896. doi: 10.1017/S0031182019001690. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Chamnanchanunt S, Fucharoen S, Umemura T. Circulating microRNAs in malaria infection: bench to bedside. Malar J. 2017;16:334. doi: 10.1186/s12936-017-1990-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Wang J, Yan F, Zhao Q, Zhan F, Wang R, Wang L, et al. Circulating exosomal miR-125a-3p as a novel biomarker for early-stage colon cancer. Sci Rep. 2017;7:4150. doi: 10.1038/s41598-017-04386-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Jin X, Guo X, Zhu D, Ayaz M, Zheng Y. miRNA profiling in the mice in response to Echinococcus multilocularis infection. Acta Trop. 2017;166:39–44. doi: 10.1016/j.actatropica.2016.10.024. [DOI] [PubMed] [Google Scholar]
- 25.Kelada S, Sethupathy P, Okoye IS, Kistasis E, Czieso S, White SD, et al. miR-182 and miR-10a are key regulators of Treg specialisation and stability during Schistosome and Leishmania-associated inflammation. PLoS Pathog. 2013;9:e1003451. doi: 10.1371/journal.ppat.1003451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Bai Y, Zhang Z, Jin L, Kang H, Zhu Y, Zhang L, et al. Genome-widesequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus [J] BMC Genomics. 2014;15:736. doi: 10.1186/1471-2164-15-736. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, et al. Sex-biased expression of microRNAs in Schistosoma mansoni [J] PLoS Negl Trop Dis. 2013;7:e2402. doi: 10.1371/journal.pntd.0002402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Bala S, Petrasek J, Mundkur S, Catalano D, Levin I, Ward J, et al. Circulating microRNAs in exosomes indicate hepatocyte injury and inflammation in alcoholic, drug-induced, and inflammatory liver diseases. Hepatology. 2012;56:1946–1957. doi: 10.1002/hep.25873. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Chiu LY, Kishnani PS, Chuang TP, Tang CY, Liu CY, Bali D, et al. Identification of differentially expressed microRNAs in human hepatocellular adenoma associated with type I glycogen storage disease: a potential utility as biomarkers. J Gastroenterol. 2014;49:1274–1284. doi: 10.1007/s00535-013-0890-2. [DOI] [PubMed] [Google Scholar]
- 30.Qi P, Cheng SQ, Wang H, Li N, Chen YF, Gao CF. Serum microRNAs as biomarkers for hepatocellular carcinoma in Chinese patients with chronic hepatitis B virus infection. PLoS One. 2011;6:e28486. doi: 10.1371/journal.pone.0028486. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Cai P, Gobert GN, You H, Duke M, McManus DP. Circulating miRNAs: potential novel biomarkers for hepatopathology progression and diagnosis of schistosomiasis japonica in two murine models. PLoS Negl Trop Dis. 2015;9:e0003965. doi: 10.1371/journal.pntd.0003965. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Jia B, Chang Z, Wei X, Lu H, Yin J, Jiang N, et al. Plasma microRNAs are promising novel biomarkers for the early detection of toxoplasma gondii infection. J Parasit Vectors. 2014;7:433. doi: 10.1186/1756-3305-7-433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Lee YS, Kim HK, Chung S, Kim KS, Dutta A. Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down regulation of putative targets during differentiation. J Biol Chem. 2005;280:16635–16641. doi: 10.1074/jbc.M412247200. [DOI] [PubMed] [Google Scholar]
- 34.Li W, Xie L, He X, Li J, Tu K, Wei L, et al. Diagnostic and prognostic implications of microRNAs in human hepatocellular carcinoma [J] Int J Cancer. 2008;123:1616–1622. doi: 10.1002/ijc.23693. [DOI] [PubMed] [Google Scholar]
- 35.Li F, Zhou P, Deng W, Wang J, Mao R, Zhang Y, et al. Serum microRNA-125b correlates with hepatitis B viral replication and liver necroinflammation. Clin Microbiol Infect. 2016;22:384.e1–384e10. doi: 10.1016/j.cmi.2015.12.024. [DOI] [PubMed] [Google Scholar]
- 36.Iacob DG, Rosca A, Ruta SM. Circulating microRNAs as non-invasive biomarkers for hepatitis B virus liver fibrosis. World J Gastroenterol. 2020;26:1113–1127. doi: 10.3748/wjg.v26.i11.1113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Qiu H, Liang D, Liu L, Xiang Q, Yi Z, Ji Y. A novel circulating miRNA-based signature for the diagnosis and prognosis prediction of early-stage cervical cancer. Technol Cancer Rese Treat. 2020;19:1–7. doi: 10.1177/1533033820970667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Murata K, Furu M, Yoshitomi H, Ishikawa M, Shibuya H, Hashimoto M, et al. Comprehensive microRNA analysis identifies miR-24 and miR-125a-5p as plasma biomarkers for rheumatoid arthritis. PLoS One. 2013;8:e69118. doi: 10.1371/journal.pone.0069118. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets used in this study are available from the corresponding author on reasonable request.



