Oncogenic miR-27a delivered by exosomes binds to SFRP1 and promotes angiogenesis in renal clear cell carcinoma

Yi Hou; Li Fan; Hai Li

doi:10.1016/j.omtn.2020.11.019

This article has been retracted.

Retraction in: Mol Ther Nucleic Acids. 2022 Nov 4;30:346 See also: PMC Retraction Policy

. 2020 Nov 26;24:92–103. doi: 10.1016/j.omtn.2020.11.019

Oncogenic miR-27a delivered by exosomes binds to SFRP1 and promotes angiogenesis in renal clear cell carcinoma

Yi Hou ¹, Li Fan ¹, Hai Li ^1,^∗

PMCID: PMC7941030 PMID: 33738141

Abstract

Exosomes derived from cancer cells have emerged as important mediators of malignant phenotypes of tumors, being involved in the transmission of biological signals between cells. Herein, we intended to clarify the role of exosome-mediated transfer of oncogenic microRNA-27a (miR-27a) in angiogenesis of renal clear cell carcinoma (RCCC). Through bioinformatics analysis, we identified the differentially expressed genes of RCCC and predicted miRNAs targeting SFRP1. We manipulated the expression of miR-27a and/or SFRP1 in RCCC cells to explore their roles in angiogenesis through Cell Counting Kit-8 (CCK-8), Transwell, and Matrigel tubule formation assays. miR-27a loaded in exosomes was overexpressed and downregulated in vitro and in vivo to verify its effect on angiogenesis. SFRP1 was poorly expressed and miR-27a was highly expressed in RCCC tissues, showing a negative correlation. Dual-luciferase assay verified that miR-27a targeted and downregulated SFRP1 expression. Notably, miR-27a enhanced angiogenesis by downregulating SFRP1 expression. miR-27a-loaded exosomes can be delivered from RCCC cells to human umbilical vein endothelial cells (HUVECs). In vitro and in vivo experiments substantiated that miR-27a-loaded exosomes from RCCC cells repressed SFRP1, augmenting the viability, migration, and angiogenesis of RCCC cells. Together, RCCC-derived miR-27a-loaded exosomes inhibit SFRP1 expression and accelerate tumor angiogenesis in RCCC.

Keywords: renal clear cell carcinoma, exosome, microRNA-27a, SFRP1, cell viability, transfer

Graphical Abstract

Renal clear cell carcinoma cell-derived exosomal miR-27a shuttled into human umbilical vein endothelial cells binds to and suppresses SFRP1 expression, thereby inhibiting angiogenesis and ultimately tumor growth.

Introduction

Renal cell carcinomas (RCCs) consist of a diverse array of tumors originating from nephrons and represent nearly 2% of all adult malignancies.¹ Notably, renal clear cell carcinoma (RCCC) represents the most frequently occurring subtype of RCC and one of the most fatal urological tumors across the globe,² accompanied by alarmingly high aggressiveness, unfavorable prognosis, and therapy resistance.³ Evidence exists demonstrating that RCCC leads to metabolic disorders and boosted angiogenesis, and therefore characterization of potential tumorigenesis-related molecules may contribute to innovated treatment options.⁴ It is interesting that therapeutic strategies to combat angiogenesis have been widely proposed in variable malignancies, especially in the context of RCC.⁵ However, the understanding of mechanisms behind signaling pathways orchestrating tumor angiogenesis in RCCC should be thoroughly probed.⁶

Cancer cells have been recognized to secret exosomes, which are pivotal modulators of intercellular delivery of proteins, messenger RNAs (mRNAs), and microRNAs (miRNAs) in the microenvironment.⁷^,⁸ miRNAs are small non-coding RNA molecules that serve as regulators of protein expression via degradation of targeted mRNA or blockade of protein translation.⁹ Through bioinformatics analysis, we identified the differentially expressed gene secreted frizzled-related protein 1 (SFRP1) in RCCC and predicted the regulatory miRNA microRNA-27a (miR-27a) in the present study. Evidence exists indicating that the methylation of the SFRP1 promoter in RCCC repressed its expression,¹⁰ but the specific molecular mechanism of the effect of differential expression of SFRP1 on RCCC is still unclear. Therefore, we took SFRP1 as the key target of this study. Moreover, evidence exists highlighting that miR-27a is expressed in endothelial cells and enhances endothelial cell sprouting,¹¹ while SFRP1, as an inhibitor of the Wnt pathway, has the potential to restrict tumor angiogenesis, since disruption of the Wnt pathway halts angiogenesis of tumors.¹²^,¹³ Therefore, the current study focused on the role and mechanism of miR-27a and SFRP1 in angiogenesis of RCCC. Furthermore, miR-27a was observed to express at high levels in the serum exosomes of patents who are affected by osteosarcoma.¹⁴ Thus, we are very interested in whether miR-27a mediated SFRP1 during tumor angiogenesis and the involvement of tumor cell-derived exosome delivery. This study sought to explain the regulatory mechanistic actions of exosomal miR-27a from RCCC cells in tumor angiogenesis, which may implicate SFRP1.

Results

SFRP1 was poorly expressed and miR-27a was highly expressed in RCCC, showing a negative correlation

We first used R language to select 98, 131, and 164 differentially expressed genes from GSE14762, GSE71963, and GSE6344 microarray profiles, respectively. Next, the first 20 differentially expressed genes were selected for comparison, and a Venn diagram (Figure 1A) was drawn. It was found that there was only one SFRP1 intersection gene. Then, the top 20 differentially expressed genes in GSE14762, GSE71963, and GSE6344 were used to draw the expression heatmap (Figure S1). The expression of SFRP1 in the RCCC samples of the three profiles was significantly lower than that of the normal control samples. In order to confirm the expression of SFRP1 in RCCC, we collected clinical cancer tissues and adjacent tissues of patients with RCCC, in which western blot assay and qRT-PCR found that SFRP1 was poorly expressed in RCCC (Figure 1B). The above results indicate that SFRP1 was lowly expressed in RCCC, which may be a tumor suppressor gene of RCCC.

Next, we predicted the miRNAs that may target SFRP1 in miRDB, mirDIP, TargetScan, miRTarBase, and miRSearch databases. There were 21 miRNAs with a target score >90 in the miRDB prediction results. In addition, 23 miRNAs were retrieved in the mirDIP database by setting score class to “very high,” and 17 miRNAs were predicted in the TargetScan database based on context ++ score <−0.4. In miRTarBase and miRSearch databases, 28 and 39 miRNAs, respectively, may target and regulate SFRP1. Comparing the above five prediction results, we found that the only intersection of miRNA was hsa-miR-27a (Figure 1C), suggesting that miR-27a may target and regulate SFRP1. So, we further examined the expression of miR-27a in RCCC. qRT-PCR experiments confirmed that the expression of miR-27a in RCCC tissues was higher than that in adjacent tissues (Figure 1D). Correlation analysis showed that the expression of miR-27a and SFRP1 mRNA was negatively correlated in RCCC tissues (Figure 1E) (p < 0.05). This result indicates that our speculation may be feasible.

miR-27a targets and downregulates SFRP1 expression

We predicted the miR-27a binding site of 3′UTR for SFRP1 in miRDB and TargetScan databases (Figure 2A). Thereafter, a dual-luciferase assay further validated that co-transfection of the SFRP1-3′UTR-wild-type (WT) plasmid with miR-27a mimic resulted in lower luciferase activity than that with mimic negative control (NC). For SFRP1-3′UTR-mutant (MUT) plasmid co-transfection, the luciferase activity of each group did not change significantly (Figure 2B). This result indicates that miR-27a can specifically bind SFRP1. We next explored the role and mechanism of miR-27a and SFRP1 in angiogenesis. Thus, we transfected miR-27a mimics and inhibitors as well as their controls in human umbilical vein endothelial cells (HUVECs); the transfection efficiency was shown in Figure 2C. The following qRT-PCR and western blot assays displayed that miR-27a mimic in HUVECs downregulated SFRP1, while miR-27a inhibitor elevated SFRP1 expression (Figures 2D and 2E). Together, miR-27a can target and downregulate the expression of SFRP1 in HUVECs.

miR-27a accelerates angiogenesis of HUVECs by downregulating SFRP1 expression

In an attempt to clarify the function of miR-27a and SFRP1 in angiogenesis, we first constructed SFRP1-silenced or overexpressed HUVECs using small interfering RNA (siRNA) and overexpressed plasmids. The efficiency is shown in Figures S2A and S2B. Since the silencing efficiency of siSFRP1-3 was the best among the three siRNAs, we used siSFRP1-3 for subsequent experiments. Cell Counting Kit-8 (CCK-8) assay illustrated that overexpressing miR-27a or silencing SFRP1 accelerated cell viability, while silencing miR-27a or upregulating SFRP1 restricted cell viability (Figure 3A). Transwell assay illustrated that upregulating miR-27a or silencing SFRP1 in HUVECs augmented cell migration, while cell migration was restricted by silenced miR-27a or overexpressed SFRP1 (Figure 3B; Figure S2C). The Matrigel tubule formation assay of HUVECs indicated that high expression of miR-27a or low expression of SFRP1 promoted angiogenesis, yet silenced miR-27a or overexpressed SFRP1 suppressed angiogenesis (Figure 3C; Figure S2D). In addition, western blot assays for the expression of angiogenesis-related factors (vascular endothelial growth factor [VEGF] and tumor necrosis factor alpha [TNF-α]) illustrated that miR-27a overexpression or SFRP1 knockdown augmented levels of these factors, whereas the expression of angiogenesis-related factors would be restricted by silenced miR-27a or overexpressed SFRP1 (Figure 3D).

To further confirm that miR-27a exerted effects by targeting the expression of SFRP1 during angiogenesis, we conducted rescue experiments. We first transfected miR-27a mimic in HUVECs and then transfected SFRP1 overexpression plasmid into them. CCK-8, Transwell, and Matrigel tubule formation assays all showed that the reintroduction of SFRP1 into the cells partially rescued the miR-27a promotion on viability, migration, and angiogenesis in HUVECs (Figures 3E–3G; Figures S2E and S2F). At the same time, the expression of related angiogenesis-related factors in the cells also produced consistent changes (Figure 3H). The above results indicate that miR-27a enhanced angiogenesis in HUVECs by targeting the expression of SFRP1.

RCCC cell-derived exosomes deliver miR-27a to HUVECs to directly target SFRP1

Next, we explored whether miR-27a targeted SFRP1 through tumor exosomes during tumor angiogenesis. We extracted the secreted exosomes from the conditioned medium of RCCC cell line 786-O and renal normal epithelial cell line RPTEC and identified the morphology and particle size of the extracted exosomes by electron microscope and nanoparticle tracking analysis (NTA) particle size analysis. The results revealed that the exosomes presented saucer-like three-dimensional structures with clear membranes in the electron microscopic field of view. The average particle size was between 50 nm and 200 nm, and the exosome concentration of RCCC cell line 786-O was higher (Figures 4A and 4B). Western blot assay showed that the expression of CD63 and TSG101 in exosomes was higher than that in cells, while the expression of GM130 in exosomes was significantly lower (Figure 4C). These experiments implied that we successfully extracted exosomes from cells. In addition, the expression of miR-27a in RCCC cells and the RCCC cell-derived exosomes was higher than that of renal normal epithelial cells (Figure 4D). Meanwhile, we detected the expression of SFRP1 in RPTEC and 786-O cells and their secreted exosomes by qRT-PCR and western blot. As compared with RPTEC cells, the expression of SFRP1 in 786-O cells was significantly decreased, which was extremely low and almost undetectable in exosomes (Figure S3A and S3B). To investigate whether RCCC cell-derived exosomes can transfer miR-27a to HUVECs and affect the expression of SFRP1, we first labeled the exosomes secreted by 786-O cells with PKH67 and then co-cultured with HUVECs. Through observing the fluorescence in HUVECs under a laser confocal microscope (Figure 4E), we found that PKH67-labeled exosomes that were endocytosed into HUVECs were increasing with culture time prolonging. Next, we transfected the donor cell (786-O) with miR-27a inhibitor and inhibitor NC and obtained miR-27a-inhibited exosomes (transfected miR-27a inhibitor) and I.NC exosomes (transfected inhibitor NC). The inhibition of miR-27a in exosomes was verified by qRT-PCR (Figure 4F). Following co-culture of HUVECs and exosomes for 24 h, the levels of miR-27a were quantified in the HUVECs harvested (Figure 4G). After co-culture of HUVECs with 786-O cell-derived exosomes, miR-27a was upregulated in HUVECs; however, miR-27a was downregulated in HUVECs co-cultured with miR-27a inhibitor-loaded exosomes. Moreover, expression of SFRP1 mRNA and protein in 786-O cell-derived exosomes was diminished. After co-culture with miR-27a inhibitor-loaded exosomes, the mRNA and protein of SFRP1 in HUVECs increased (Figures 4H and 4I). The above experiments suggest that exosomal miR-27a derived from RCCC cells can be delivered to HUVECs and directly downregulate the expression of SFRP1.

RCCC cell-derived exosomal miR-27a accelerates angiogenesis of HUVECs by downregulating SFRP1 in vitro

We simulated the process during which RCCC cell-derived exosomal miR-27a enhanced angiogenesis by directly downregulating the expression of SFRP1. In this part of the experiment, we demonstrated that compared with the NC exosome, overexpression or inhibition of miR-27a loaded in exosomes in vitro affected the biological function of HUVEC angiogenesis. After co-culture of HUVECs with 786-O cell-derived exosomes, we evaluated angiogenesis by observing the behaviors of HUVECs. As expected, HUVECs co-cultured with 786-O-exo showed enhanced cell viability (Figure 5A), cell migration (Figures 5B and 5C), and angiogenesis (Figures 5D and 5E). In contrast, cells co-cultured with miR-27a inhibitor-loaded exosomes showed significant inhibition of the biological function of angiogenesis. Similarly, through the detection of the expression of VEGF and TNF-α, it could be seen that the expression of angiogenesis-related factors in the 786-O-exo culture group was higher than that in the PBS group. When HUVECs were co-cultured with exosomes derived from 786-O cells with low expression of miR-27a, the expression of these angiogenesis-related factors in HUVECs was reduced (Figure 5F).

RCCC cell-derived exosomal miR-27a accelerates angiogenesis of HUVECs by downregulating SFRP1 in vivo

Finally, we used a mouse xenograft model to verify the effect of miR-27a on tumor growth. We used lentiviral vectors to transfect 786-O cells to construct cell lines with stable miR-27a knockdown (miR-27a-KD) or miR-27a overexpression (oe-miR-27a). The 786-O cells transfected with lentivirus empty were used as controls, and we also prepared untreated 786-O cells. The transfection efficiency of each transfection group is shown in Figure S4. Then, we injected the treated RCCC cells subcutaneously into the mice, regularly measured the size of subcutaneous tumors, and sacrificed the mice at 30 days. We removed the tumor tissue and measured the diameter and weight (Figure 6A). The tumor diameter and weight in the presence of miR-27a-KD was decreased, while the tumor diameter and weight in the presence of oe-miR-27a was increased (Figures 6B and 6C). We collected their plasma when the mice were sacrificed and separated the plasma exosomes. qRT-PCR analysis found that miR-27a levels in tumor tissues and plasma exosomes decreased in response to miR-27a-KD, while miR-27a levels increased in response to oe-miR-27a (Figures 6D and 6E).

We then measured the protein level of SFRP1 by western blot assay. The miR-27a-KD treatment resulted in a higher SFRP1 level, while oe-miR-27a had the opposite effect on SFRP1 level (Figure 6F). Finally, we used immunohistochemistry to evaluate the role of miR-27a in tumor angiogenesis. Overexpression of miR-27a resulted in an increase in blood vessel density, while downregulation of miR-27a expression restricted angiogenesis (Figure 6G). At the same time, ELISA identified that overexpression of miR-27a increased the content of VEGF in the blood of mice, while the downregulation of miR-27a reduced the content of VEGF in the blood (Figure 6H). Next, we tested the expression of angiogenesis-related factors VEGF and TNF-α in the tumor tissue of each group of mice. The results showed that high expression of miR-27a promoted the expression of these factors, and low expression of miR-27a repressed the expression of these factors (Figure 6I). From these results, we conclude that miR-27a delivered by exosomes acted as oncomiR by downregulating the expression of SFRP1, thereby accelerating tumor growth and angiogenesis in vivo.

Discussion

Exosomes secreted by cancer cells have been proposed as a novel target for a less-invasive detection of malignancies due to its enrichment of multiple tumor antigens.¹⁵ The aberrant regulatory interaction of miRNA-mRNA that mediates the malignant phenotypes of cancer cells may provide novel targets and therapies to limit angiogenesis of malignancies, including RCCC.¹⁶ Tumor angiogenesis refers to the sprouting of new blood vessels from the vascular network formed by tumors, which is responsible for the growth, proliferation, progression, and metastasis of tumors. Angiogenesis is closely related to the prognosis of tumors. At present, it is believed that angiogenesis is not only a prognostic indicator of tumors but also a target of tumor treatment. Tumors directly secrete angiogenic factors or activate and release pro-angiogenic complexes in the extracellular matrix. Meanwhile, angiogenic substances produced by tumor-infiltrating lymphocytes, macrophages, or mast cells play a role in strengthening the vascular connection between tumors.¹⁷^,¹⁸ In this study, we screened out the differentially expressed SFRP1 gene in RCCC by Gene Expression Omnibus (GEO) data analysis and predicted that miR-27a targeted SFRP1 by bioinformatics methods. Evidence exists showing that miR-27a is expressed in endothelial cells and promotes angiogenesis,¹¹ and SFRP1 has the potential to inhibit tumor angiogenesis.¹² Therefore, we explored their roles and mechanisms underlying angiogenesis in this study in an attempt to elucidate the role of exosomal miR-27a in tumor angiogenesis in RCCC and to provide new ideas for diagnosis and treatment of RCCC.

The experimental observations uncovered that SFRP1 was poorly expressed and miR-27a was highly expressed in RCCC, showing a negative correlation. The study of Dahl et al.¹⁹ has identified the SFRP1 loss and SFRP1 promoter methylation in RCC, which was hypothesized to result in occurrence and progression of RCC. It is interesting to note that SFRP1 is a promising tumor-suppressive gene located at 8p11.2 and antagonizes the Wnt pathway, and knockdown of SFRP1 induced by methylation was widely identified in RCC tumorigenesis.¹⁰ Activation of SFRP1 expression has been often linked with promoter methylation in colon, bladder, and breast cancers, which is always linked with unfavorable overall survival.²⁰ At the same time, overexpression of miR-27a frequently occurs in human cancers and has been proposed to serve as an anti-tumor therapeutic strategy.²¹ For example, abnormally high expression of miR-27a in gastric cancer has been implicated in tumor cell proliferative potential and therapy resistance.²²

We proceeded to probe the specific relationship between miR-27a and SFRP1 and predicted the putative binding affinity through in silico analyses. The dual-luciferase reporter gene assay further validated that miR-27a targeted and downregulated SFRP1 expression. A previous study by Guo et al.²³ has also suggested the putative binding of miR-27a to SFRP1 during osteoblast differentiation, and they revealed that exogenous miR-27a has the ability to appreciably knock SFRP1 down. Moreover, in the context of glioma, SFRP1 was indicated to be a direct target of miR-27a, which may be a mechanism underlying the tumor-supporting activities of miR-27a in glioma.²⁴ Thus, we also speculated that the binding affinity between miR-27a and SFRP1 may be an explanation for their roles in RCCC.

Interestingly, therapies for RCC are revolutionized by introducing inhibitors of VEGF receptor.²⁵^,²⁶ Cancers of the kidney are accompanied by a high and rising morbidity across the globe, and there is an urgent sense that improvements must now come from fresh approaches.²⁷ The current study has provided evidence reporting that miR-27a accelerated angiogenesis of HUVECs by downregulating SFRP1 expression. The high expression of miR-27a has been found to augment sprout formation in endothelial cells and then angiogenesis through stimulating the repulsion of neighboring endothelial cells.¹¹ In the context of tumors, such as breast cancer, miR-27a augmented angiogenesis via modulating endothelial differentiation in stem-like cells of breast cancer.²⁸ Moreover, another study by Wang et al.²⁹ for thyroid cancer has illuminated that inhibition of miR-27a was observed to cause significant decline in tumor angiogenesis and metastasis. Meanwhile, SFRP1 has been recognized as a significant inhibitor of the Wnt pathway, and it is an extensively studied tumor-inhibiting gene in a diverse array of tumors.¹² Based on a previous study of Pate et al.,³⁰ Wnt signaling has a potent ability to stimulate the angiogenesis of the tumor microenvironment in colon cancer. It is noted that SFRP1 curtailed tube formation and vascular endothelial cell migration, thus exercising significant antineoplastic properties in hepatocellular carcinoma.¹³ Agents that disrupt pathways orchestrating tumor angiogenesis have provided promising innovation for anti-cancer methods.⁵ Furthermore, our findings delineated that RCCC cell-derived exosomal miR-27a accelerated angiogenesis of HUVECs by downregulating SFRP1 in vitro and in vivo. Exosomes, as special endogenous carriers of proteins and nucleic acids, can protect the proteins and nucleic acids loaded from degradation in the cellular microenvironment.³¹ When exosomes are internalized by other cells, the membrane of the exosomes is ruptured and the contents are released due to the presence of various enzymes in the recipient cells, thereby affecting the function of the recipient cells.³² miR-27a expression has been identified in exosomes of serum from osteosarcoma samples, which shows an ability to influence the chemotherapeutic response.¹⁴ Other miRNAs, such as miR-451a, carried by exosomes have aroused great interest as less-invasive targets for preventing recurrence and poor prognosis in human cancers.³³ It is reasonable to state that miR-27a may be a physiologically validated approach for the treatment of RCCC.

To generalize our findings, we recapitulated that RCCC cell-derived exosomal miR-27a shuttled into HUVECs bound to and suppressed SFRP1, thereby inhibiting angiogenesis and ultimately tumor growth (Figure 7). Nonetheless, explorations on the mechanistic basis are not yet fully illustrated. Thus, future studies are still required to extend the regulatory network into other targets. Moreover, it takes a lot of time and money to extract exosomes, especially the number of exosomes required for in vivo experiments. This study utilized qRT-PCR to determine the expression level of miR-27a in the plasma exosomes of mice, which explained the participation of exosomal miR-27a. However, due to limited conditions, this study did not illustrate the effects of injection of exosomes loaded with different levels of miR-27a in nude mice on angiogenesis and tumor growth, which should be further clarified in future studies.

Schematic representation of the potential molecular mechanisms of exosomal miR-27a involved in RCCC

RCCC-derived miR-27a-loaded exosomes inhibit the expression of SFRP1 and promote the increase of VEGF, thereby promoting tumor angiogenesis.

Materials and methods

Ethics statement

This study was approved by the ethics committee of China-Japan Union Hospital of Jilin University, and all patients provided written informed consent. All procedures were performed in accordance with the Helsinki Declaration. Animal experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health and approved by the Animal Ethics Committee of China-Japan Union Hospital of Jilin University.

Patients

RCCC cancer tissues (n = 38) and paracancerous tissues (n = 38) were obtained from RCCC patients (aged 24–80 years, with a mean age of 56 ± 14 years; 23 males; 15 females) undergoing surgical treatment in China-Japan Union Hospital of Jilin University. The cancerous tissues and adjacent tissues were fresh and intact, which had been confirmed by histopathological examination. The tissue fragments were separated during operation, immediately frozen in liquid nitrogen, and then stored at −80°C. According to the 2002 edition of the American Joint Committee on Cancer Staging Criteria for RCCC, there were 15 cases at stage I, 20 cases at stage II, 2 cases at stage III, and 1 case at stage IV. Based on the Fuhrman pathological grading criteria, there were 13 cases at grade I, 23 cases at grade II, 1 case at grade III, and 1 case at grade IV.

Animals

A total of 30 male nude mice (BALB/c-nu, 3–5 weeks old, 17–22 g) were purchased from Vital River Lab Animal Technology (Beijing, P.R. China) and raised in specific pathogen-free (SPF) animal facilities.

Cell lines

The cell lines RCCC cell line 786-O, renal normal epithelial cell line RPTEC, HEK293T, and HUVECs used in this study were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). The 786-O cells were cultured in RPMI-1640 (HyClone, USA), RPTEC cells in F12 medium (HyClone, USA), and HEK293T and HUVEC cells in DMEM (HyClone, USA). 1% antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin) and 10% fetal bovine serum (FBS) were added to RPMI-1640, DMEM, and F12 medium. The culture plates were then cultured in a humidified incubator in 5% CO₂ at 37°C.

Bioinformatics analysis

To screen out differentially expressed genes in RCCC, the RCCC gene expression microarray was downloaded in the GEO database (https://www.ncbi.nlm.nih.gov/geo/), of which GSE14762, GSE71963, and GSE6344 were applied for differential analysis. See Table 1 for microarray details. The microarray data were analyzed using the R language affy package³⁴ for standardized preprocessing. The limma package³⁵ was applied to screen for differentially expressed genes. The corrected p value was expressed by adjusted p value (adj.p.val,) where genes with |log2FC| >3.0 and adj.p.val <0.05 were considered to be differentially expressed, followed by plotting differential gene expression heatmap. The jvenn (http://jvenn.toulouse.inra.fr/app/example.html) was adopted to compare the differentially expressed genes of the three gene expression profiles and further screen the differentially expressed genes in RCCC. To predict miRNAs that bind to the 3′UTR of the target gene mRNA, five miRNA-mRNA relationship prediction tools: miRDB (http://www.mirdb.org/), mirDIP (http://ophid.utoronto.ca/mirDIP/), TargetScan (http://www.targetscan.org/vert_71/), miRTarBase (http://mirtarbase.mbc.nctu.edu.tw/php/search.php), and miRSearch (http://www.exiqon.com/microrna-target-prediction) were employed to predict regulatory miRNAs of differentially expressed genes, and jvenn was adopted for comparing the prediction results.

Table 1.

Detailed information of RCCC-related gene chips

Accession	Platform	Organism	Sample
GSE14762	GPL4866	Homo sapiens	10 tumor samples and 12 normal renal tissues
GSE71963	GPL6480	Homo sapiens	16 normal renal tissues and 32 tumor tissues
GSE6344	GPL96	Homo sapiens	10 tumor samples and 10 normal renal epithelium

Open in a new tab

RNA extraction and qRT-PCR

According to the manufacturer’s instructions, total RNA was extracted from cells or tissues using TRIzol (Invitrogen, Carlsbad, CA, USA), and total exosome RNA was extracted using a total exosome RNA and protein isolation kit (Thermo Fisher Scientific, MA, USA). Reverse-transcription reaction was used to synthesize the cDNA template. qRT-PCR was performed using the ABI 7500 system (Applied Biosystems, Carlsbad, CA, USA). In cell and tissue lysates, mRNA levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and miRNA levels were normalized to U6. Moreover, the miRNA levels in culture medium and exosomes were normalized to the exogenous reference cel-miR-39. The SFRP1 primer was synthesized by Sangon Biotech (Shanghai, P.R. China), and the primer sequences are shown in Table 2. The relative quantification of the gene expression was calculated using the 2^−ΔΔCT method: ΔCt = Ct target gene − Ct internal reference gene, while ΔΔCT = ΔCt experimental group − ΔCt control group.

Table 2.

Primer sequences for qRT-PCR

Gene	Primer sequences (5′–3′)
miR-27a	Forward: TGCGGTTCACAGTGGCTAAG
miR-27a	Reverse: CTCAACTGGTGTCGTGGA
U6	Forward: CTCGCTTCGGCAGCACA
U6	Reverse: AACGCTTCACGAATTTGCGT
SFRP1	Forward: TGACTTCAGGTCAAGGGATGGT
SFRP1	Reverse: ACATCGCTTGAGGATCTGGAA
GAPDH	Forward: TGGGTGTGAACCATGAGAAGT
GAPDH	Reverse: TGAGTCCTTCCACGATACCAA

Open in a new tab

Western blots

The β-actin was adopted as an internal control in western blot assay. In addition, CD63, TSG101, and Alix were often used as exosome markers and internal controls due to their close relationship with the formation and transport of exosomes. Protein extraction of cells and exosomes was performed as described in previous studies.³⁶^,³⁷ SDS-PAGE was performed for total protein separation, and each sample was loaded with 50 μg. The protein in the gel was transferred to a nitrocellulose membrane, which was blocked with 5% skimmed milk powder. The blots were probed with specific human primary antibody: rabbit monoclonal SFRP1 (ab267466; 1:250, Abcam), rabbit monoclonal β-actin (ab8227; 1:3,000, Abcam), rabbit monoclonal CD63 (ab134045; 1:2,000, Abcam), mouse monoclonal TSG101 (sc-7964; 1:1,000, Santa Cruz Biotechnology), rabbit monoclonal GM130 (12480S; 1:1,000, Cell Signaling Technology), rabbit monoclonal VEGF (ab46154; 1:2,000, Abcam), and rabbit monoclonal TNF-α (ab183218; 1:1,000, Abcam). Thereafter, the membrane was incubated with secondary antibody: goat anti-rabbit IgG H&L (horseradish peroxidase [HRP]) (ab97051; 1:20,000, Abcam) and goat anti-mouse IgG H&L (HRP) (ab6808; 1:20,000, Abcam) for 1–2 h at room temperature. The blots were visualized using the enhanced chemiluminescence.

Immunohistochemistry

Immunohistochemistry was performed according to a previous study.³⁸ In brief, paraffin-embedded tumor tissue sections were immersed in xylene to remove paraffin and then hydrated with gradient ethanol. Endogenous peroxidase activity was blocked with 3% H₂O₂, followed by antigen retrieval using a pressure cooker. The sections were cooled at room temperature, which was blocked by 5% goat serum (Beyotime Biotechnology, Beijing, P.R. China), and incubated at 4°C with primary antibody overnight, including anti-SFRP1 (ab267466; 1:800, Abcam) and anti-CD31 (ab9498; 1:50, Abcam). The sections were incubated with HRP-conjugated secondary antibody (Abcam) for 1 h at room temperature, and the sections were developed with diaminobenzene (DAB) for color development.

Lentiviral production and transduction

The lentiviral vector containing miR-27a mimic or its NC and the plasmid carrying WT or MUT 3′UTR SFRP1 were designed and purchased from Genechem (Shanghai, P.R. China). The 786-O cells were transfected with lentivirus, and the multiplicity of infection (MOI) was 20. Cells were screened in 1 μg/mL puromycin for 3 days. The miR-27a mimic, miR-27a mimic-NC, SFRP1 siRNA, and plasmid vectors overexpressing SFRP1 were designed and purchased from GenePharma (Shanghai, P.R. China). According to the manufacturer’s instructions, Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was used for transfection of miRNA and plasmids.

Luciferase activity assay

Whether miR-27a directly targeted the 3′UTR of the SFRP1 gene was validated by a dual luciferase reporter gene assay. The luciferase reporter gene carrying SFRP1-3′UTR-WT or SFRP1-3′UTR-MUT was synthesized at Genechem (Shanghai, P.R. China). Co-transfection of 3′UTR luciferase carrier (150 ng) with miR-27a mimic/inhibitor or mimic/inhibitor NC was conducted in HEK293T cells using Lipofectamine 2000 (Invitrogen), respectively. After culturing for 24 h, the cells were collected and lysed, and the luciferase activity was detected using the dual luciferase reporter kit (Beyotime Biotechnology, Shanghai, P.R. China) according to the manufacturer’s instructions.

CCK-8 assay

The treated cells were cultured for 0–3 days, and CCK-8 (Beyotime, Shanghai, P.R. China) was employed to assess cell viability according to the manufacturer’s instructions. A microplate reader (Synergy HT, BioTek) was employed to identify absorbance at 450 nm and determine cell viability.

Transwell assay

The migration ability of HUVECs was tested in the Transwell Boyden chamber (6.5 mm, Costar) and polycarbonate membrane (8 mm aperture) at the bottom of the upper chamber. First, 1 × 10⁵ cells were suspended in serum-free DMEM. At the same time, 0.5 mL DMEM containing 10% FBS was added to the lower chamber and incubated for 6 h. After the incubation, 90% ethanol was used to fix the cells that passed through the membrane at room temperature for 15 min. The cells were stained with 0.1% crystal violet solution. Finally, images of migrating cells were obtained using a microscope, and cell migration was quantified by blind cell counting in five fields per chamber.

Matrigel-based tube formation assay

The Matrigel-based tube formation assay was performed as described above.39, 40, 41 In brief, in each well of a 24-well plate, 100 mL of Matrigel (BD Biosciences) was added and polymerized at 37°C for 30 min. Then, the treated HUVECs were resuspended in FBS-free medium and seeded at a density of 1 × 10⁵ cells/well. After 6 h, the cells were observed under an optical microscope to evaluate the formation of capillary-like structures. Branch points of the capillary-like structures formed in at least 5 different fields of view were photographed and quantified under the field of view of the low-power microscope. These branch points represented the degree of angiogenesis in vitro.

Isolation and identification of exosomes

Cells were cultured in conditioned media (CM) without FBS or penicillin-streptomycin for 48–72 h. Exosomes were collected by differential centrifugation.⁴² In short, CM was centrifuged at 300 × g for 5 min to discard dead or floating cells, and another centrifugation (3,000 × g) was carried out for 15 min to remove cell debris. Then, the supernatant harvested was filtered using a 0.22 μm polyvinylidene fluoride (PVDF) membrane, followed by centrifugation with a Beckman Coulter Type 55.2 Ti rotor at 120,000 × g for 70 min. The exosomes obtained by centrifugation were purified by ultracentrifugation with Amicon Ultra-15 Centrifugal Filter Devices (100 K; Merck Millipore, USA). Subsequently, the harvested exosomes were resuspended in PBS for further experiments. Serum exosomes were extracted using exosome isolation reagents (Thermo Fisher Scientific, MA, USA) according to the instructions. The extracted exosomes were characterized using electron microscopy under an 80 kV transmission electron microscope (FEI Tecnai G2 Spirit, Thermo Fisher Scientific), NTA by NanoSight NS300 (Malvern) for particle size, and western blot assay for markers.

PKH67 staining of exosomes

Exosomes were labeled with PKH67 Green Fluorescent Cell Linker Kits (Sigma-Aldrich, USA). First, exosomes were suspended in 100 mL of diluent C; 0.4 mL of PKH67 ethanol dye solution was added to 100 mL of diluent C to prepare a dye solution (4 × 10⁶ M). Then, 100 mL of exosome suspension was mixed with 100 mL of dye solution with a pipette. The cell and dye suspension were incubated for 1–5 min. After periodic mixing, the exosomes were added with 200 mL of serum and incubated for 1 min to stop staining. Finally, the exosomes were washed twice with 1 × PBS and resuspended in fresh sterile conical polypropylene tubes.

Xenograft tumors in nude mice

Lentiviral expression vectors that overexpressed or knocked down miR-27a, or knocked down TSG101 expression, and their control vectors were purchased from Shanghai Genechem. Lentiviral vectors were used to infect 786-O cells, and puromycin (Sigma-Aldrich, USA) was used to screen out the infected cells with stable expression. The 786-O cells infected with empty lentiviral vector served as controls. Then, these cells were injected subcutaneously into BALB/c nude mice (1 × 10⁷ cells per mouse, 0.2 mL PBS, 6 mice per group). Mice were sacrificed 30 days after injection, and mouse plasma was drawn to extract plasma exosomes. At the same time, transplanted tumors were removed, with the tumor volume and weight recorded. A part of the tumor was used to extract protein and total RNA, and the remaining tumor tissue was stained with CD31 for immunohistochemistry. Tumor tissue used for immunohistochemistry was fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned.

Exosomes were extracted from the culture supernatant of untreated 786-O cells or transfected 786-O cells (oe-miR-27a, miR-27a-KD, vector). Then, the exosomes were mixed with untreated 786-O cells and injected subcutaneously into mice (1 × 10⁷ cells and 10⁸ exosomes per mouse, 0.2 mL PBS, 6 mice per group). On the 14th day after the injection, 10⁸ exosomes per mouse were injected again at the tumor site. The mice were euthanized 30 days after the injection, and then the same assays as above were performed.⁴³^,⁴⁴

ELISA

ELISA was employed to detect the level of VEGF in mouse plasma. Venous blood of the mice was collected, and the supernatant was collected. The ELISA was performed following the steps in the kit instructions (Roche, Shanghai, P.R. China). The instruments used were CELLTRACKS Analyzer II (Natural Gene, USA) and a fully automatic microplate reader (Bio-Rad, USA).

Statistical analysis

The data were processed using SPSS 21.0 statistical software (IBM SPSS Statistics, Chicago, IL, USA). Measurement data were summarized as mean ± SD. Data between RCCC tissues and adjacent normal tissues were compared using paired t test, while data between other groups were compared using unpaired t test. Comparisons among multiple groups were conducted by one-way analysis of variance (ANOVA) with Tukey’s post hoc test. Statistical analysis in relation to time-based measurements within each group was realized using two-way ANOVA or repeated-measures ANOVA, followed by a Bonferroni’s post hoc test. Pearson’s correlation coefficient was used to analyze the relationship between miR-27a and SFRP1. A value of p <0.05 indicated significant difference.

Acknowledgments

We thank our colleagues for technical help and stimulating discussions.

Author contributions

Y.H. and H.L. designed the study. L.F. and H.L. collated the data, carried out data analyses, and produced the initial draft of the manuscript. Y.H. and L.F. contributed to drafting the manuscript. All authors have read and approved the final submitted manuscript.

Declaration of interests

The authors declare no competing interests.

Footnotes

Supplemental Information can be found online at https://doi.org/10.1016/j.omtn.2020.11.019.

Supplemental information

Document S1. Figures S1–S4

mmc1.pdf^{(493.8KB, pdf)}

Document S2. Article plus Supplemental information

mmc2.pdf^{(2.3MB, pdf)}

References

1.Fabbri L., Dufies M., Lacas-Gervais S., Gardie B., Gad-Lapiteau S., Parola J., Nottet N., Meyenberg Cunha de Padua M., Contenti J., Borchiellini D. Identification of a new aggressive axis driven by ciliogenesis and absence of VDAC1-ΔC in clear cell Renal Cell Carcinoma patients. Theranostics. 2020;10:2696–2713. doi: 10.7150/thno.41001. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Rao H., Li X., Liu M., Liu J., Li X., Xu J., Li L., Gao W.Q. Di-Ras2 promotes renal cell carcinoma formation by activating the mitogen-activated protein kinase pathway in the absence of von Hippel-Lindau protein. Oncogene. 2020;39:3853–3866. doi: 10.1038/s41388-020-1247-y. [DOI] [PubMed] [Google Scholar]
3.Wang R., Zheng B., Liu H., Wan X. Long non-coding RNA PCAT1 drives clear cell renal cell carcinoma by upregulating YAP via sponging miR-656 and miR-539. Cell Cycle. 2020;19:1122–1131. doi: 10.1080/15384101.2020.1748949. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
4.Wolf M.M., Kimryn Rathmell W., Beckermann K.E. Modeling clear cell renal cell carcinoma and therapeutic implications. Oncogene. 2020;39:3413–3426. doi: 10.1038/s41388-020-1234-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Fogli S., Porta C., Del Re M., Crucitta S., Gianfilippo G., Danesi R., Rini B.I., Schmidinger M. Optimizing treatment of renal cell carcinoma with VEGFR-TKIs: a comparison of clinical pharmacology and drug-drug interactions of anti-angiogenic drugs. Cancer Treat. Rev. 2020;84:101966. doi: 10.1016/j.ctrv.2020.101966. [DOI] [PubMed] [Google Scholar]
6.Morin E., Lindskog C., Johansson M., Egevad L., Sandström P., Harmenberg U., Claesson-Welsh L., Sjöberg E. Perivascular Neuropilin-1 expression is an independent marker of improved survival in renal cell carcinoma. J. Pathol. 2020;250:387–396. doi: 10.1002/path.5380. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Sun Z., Yang S., Zhou Q., Wang G., Song J., Li Z., Zhang Z., Xu J., Xia K., Chang Y. Emerging role of exosome-derived long non-coding RNAs in tumor microenvironment. Mol. Cancer. 2018;17:82. doi: 10.1186/s12943-018-0831-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Alvarez M.L., Khosroheidari M., Kanchi Ravi R., DiStefano J.K. Comparison of protein, microRNA, and mRNA yields using different methods of urinary exosome isolation for the discovery of kidney disease biomarkers. Kidney Int. 2012;82:1024–1032. doi: 10.1038/ki.2012.256. [DOI] [PubMed] [Google Scholar]
9.Di Gregoli K., Jenkins N., Salter R., White S., Newby A.C., Johnson J.L. MicroRNA-24 regulates macrophage behavior and retards atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2014;34:1990–2000. doi: 10.1161/ATVBAHA.114.304088. [DOI] [PubMed] [Google Scholar]
10.Awakura Y., Nakamura E., Ito N., Kamoto T., Ogawa O. Methylation-associated silencing of SFRP1 in renal cell carcinoma. Oncol. Rep. 2008;20:1257–1263. [PubMed] [Google Scholar]
11.Urbich C., Kaluza D., Frömel T., Knau A., Bennewitz K., Boon R.A., Bonauer A., Doebele C., Boeckel J.N., Hergenreider E. MicroRNA-27a/b controls endothelial cell repulsion and angiogenesis by targeting semaphorin 6A. Blood. 2012;119:1607–1616. doi: 10.1182/blood-2011-08-373886. [DOI] [PubMed] [Google Scholar]
12.Huth L., Rose M., Kloubert V., Winkens W., Schlensog M., Hartmann A., Knüchel R., Dahl E. BDNF is associated with SFRP1 expression in luminal and basal-like breast cancer cell lines and primary breast cancer tissues: a novel role in tumor suppression? PLoS ONE. 2014;9:e102558. doi: 10.1371/journal.pone.0102558. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Hu J., Dong A., Fernandez-Ruiz V., Shan J., Kawa M., Martínez-Ansó E., Prieto J., Qian C. Blockade of Wnt signaling inhibits angiogenesis and tumor growth in hepatocellular carcinoma. Cancer Res. 2009;69:6951–6959. doi: 10.1158/0008-5472.CAN-09-0541. [DOI] [PubMed] [Google Scholar]
14.Xu J.F., Wang Y.P., Zhang S.J., Chen Y., Gu H.F., Dou X.F., Xia B., Bi Q., Fan S.W. Exosomes containing differential expression of microRNA and mRNA in osteosarcoma that can predict response to chemotherapy. Oncotarget. 2017;8:75968–75978. doi: 10.18632/oncotarget.18373. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Zhao Z., Yang Y., Zeng Y., He M. A microfluidic ExoSearch chip for multiplexed exosome detection towards blood-based ovarian cancer diagnosis. Lab Chip. 2016;16:489–496. doi: 10.1039/c5lc01117e. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Li H.C., Li J.P., Wang Z.M., Fu D.L., Li Z.L., Zhang D., Gan W.M., Chong T. Identification of angiogenesis-related miRNAs in a population of patients with renal clear cell carcinoma. Oncol. Rep. 2014;32:2061–2069. doi: 10.3892/or.2014.3403. [DOI] [PubMed] [Google Scholar]
17.Viallard C., Larrivée B. Tumor angiogenesis and vascular normalization: alternative therapeutic targets. Angiogenesis. 2017;20:409–426. doi: 10.1007/s10456-017-9562-9. [DOI] [PubMed] [Google Scholar]
18.Sajib S., Zahra F.T., Lionakis M.S., German N.A., Mikelis C.M. Mechanisms of angiogenesis in microbe-regulated inflammatory and neoplastic conditions. Angiogenesis. 2018;21:1–14. doi: 10.1007/s10456-017-9583-4. [DOI] [PubMed] [Google Scholar]
19.Dahl E., Wiesmann F., Woenckhaus M., Stoehr R., Wild P.J., Veeck J., Knüchel R., Klopocki E., Sauter G., Simon R. Frequent loss of SFRP1 expression in multiple human solid tumours: association with aberrant promoter methylation in renal cell carcinoma. Oncogene. 2007;26:5680–5691. doi: 10.1038/sj.onc.1210345. [DOI] [PubMed] [Google Scholar]
20.Veeck J., Niederacher D., An H., Klopocki E., Wiesmann F., Betz B., Galm O., Camara O., Dürst M., Kristiansen G. Aberrant methylation of the Wnt antagonist SFRP1 in breast cancer is associated with unfavourable prognosis. Oncogene. 2006;25:3479–3488. doi: 10.1038/sj.onc.1209386. [DOI] [PubMed] [Google Scholar]
21.Zhu H., Wu H., Liu X., Evans B.R., Medina D.J., Liu C.G., Yang J.M. Role of MicroRNA miR-27a and miR-451 in the regulation of MDR1/P-glycoprotein expression in human cancer cells. Biochem. Pharmacol. 2008;76:582–588. doi: 10.1016/j.bcp.2008.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Zhao X., Yang L., Hu J. Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J. Exp. Clin. Cancer Res. 2011;30:55. doi: 10.1186/1756-9966-30-55. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Guo D., Li Q., Lv Q., Wei Q., Cao S., Gu J. MiR-27a targets sFRP1 in hFOB cells to regulate proliferation, apoptosis and differentiation. PLoS ONE. 2014;9:e91354. doi: 10.1371/journal.pone.0091354. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Wang K., Xie D., Xie J., Wan Y., Ma L., Qi X., Yang S. MiR-27a regulates Wnt/beta-catenin signaling through targeting SFRP1 in glioma. Neuroreport. 2015;26:695–702. doi: 10.1097/WNR.0000000000000410. [DOI] [PubMed] [Google Scholar]
25.Rini B.I., Pal S.K., Escudier B.J., Atkins M.B., Hutson T.E., Porta C., Verzoni E., Needle M.N., McDermott D.F. Tivozanib versus sorafenib in patients with advanced renal cell carcinoma (TIVO-3): a phase 3, multicentre, randomised, controlled, open-label study. Lancet Oncol. 2020;21:95–104. doi: 10.1016/S1470-2045(19)30735-1. [DOI] [PubMed] [Google Scholar]
26.Ornstein M.C., Pal S.K., Wood L.S., Tomer J.M., Hobbs B.P., Jia X.S., Allman K.D., Martin A., Olencki T., Davis N.B. Individualised axitinib regimen for patients with metastatic renal cell carcinoma after treatment with checkpoint inhibitors: a multicentre, single-arm, phase 2 study. Lancet Oncol. 2019;20:1386–1394. doi: 10.1016/S1470-2045(19)30513-3. [DOI] [PubMed] [Google Scholar]
27.Richter A.M., Woods M.L., Küster M.M., Walesch S.K., Braun T., Boettger T., Dammann R.H. RASSF10 is frequently epigenetically inactivated in kidney cancer and its knockout promotes neoplasia in cancer prone mice. Oncogene. 2020;39:3114–3127. doi: 10.1038/s41388-020-1195-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Tang W., Yu F., Yao H., Cui X., Jiao Y., Lin L., Chen J., Yin D., Song E., Liu Q. miR-27a regulates endothelial differentiation of breast cancer stem like cells. Oncogene. 2014;33:2629–2638. doi: 10.1038/onc.2013.214. [DOI] [PubMed] [Google Scholar]
29.Wang Y.L., Gong W.G., Yuan Q.L. Effects of miR-27a upregulation on thyroid cancer cells migration, invasion, and angiogenesis. Genet. Mol. Res. 2016 doi: 10.4238/gmr15049070. Published online December 19, 2016. [DOI] [PubMed] [Google Scholar]
30.Pate K.T., Stringari C., Sprowl-Tanio S., Wang K., TeSlaa T., Hoverter N.P., McQuade M.M., Garner C., Digman M.A., Teitell M.A. Wnt signaling directs a metabolic program of glycolysis and angiogenesis in colon cancer. EMBO J. 2014;33:1454–1473. doi: 10.15252/embj.201488598. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Kooijmans S.A.A., Stremersch S., Braeckmans K., de Smedt S.C., Hendrix A., Wood M.J.A., Schiffelers R.M., Raemdonck K., Vader P. Electroporation-induced siRNA precipitation obscures the efficiency of siRNA loading into extracellular vesicles. J. Control. Release. 2013;172:229–238. doi: 10.1016/j.jconrel.2013.08.014. [DOI] [PubMed] [Google Scholar]
32.Ramanathan S., Shenoda B.B., Lin Z., Alexander G.M., Huppert A., Sacan A., Ajit S.K. Inflammation potentiates miR-939 expression and packaging into small extracellular vesicles. J. Extracell. Vesicles. 2019;8:1650595. doi: 10.1080/20013078.2019.1650595. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Takahasi K., Iinuma H., Wada K., Minezaki S., Kawamura S., Kainuma M., Ikeda Y., Shibuya M., Miura F., Sano K. Usefulness of exosome-encapsulated microRNA-451a as a minimally invasive biomarker for prediction of recurrence and prognosis in pancreatic ductal adenocarcinoma. J. Hepatobiliary Pancreat. Sci. 2018;25:155–161. doi: 10.1002/jhbp.524. [DOI] [PubMed] [Google Scholar]
34.Gautier L., Cope L., Bolstad B.M., Irizarry R.A. affy--analysis of Affymetrix GeneChip data at the probe level. Bioinformatics. 2004;20:307–315. doi: 10.1093/bioinformatics/btg405. [DOI] [PubMed] [Google Scholar]
35.Smyth G.K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. 2004;3 doi: 10.2202/1544-6115.1027. Article3. [DOI] [PubMed] [Google Scholar]
36.Donnarumma E., Fiore D., Nappa M., Roscigno G., Adamo A., Iaboni M., Russo V., Affinito A., Puoti I., Quintavalle C. Cancer-associated fibroblasts release exosomal microRNAs that dictate an aggressive phenotype in breast cancer. Oncotarget. 2017;8:19592–19608. doi: 10.18632/oncotarget.14752. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Zhang Z., Li X., Sun W., Yue S., Yang J., Li J., Ma B., Wang J., Yang X., Pu M. Loss of exosomal miR-320a from cancer-associated fibroblasts contributes to HCC proliferation and metastasis. Cancer Lett. 2017;397:33–42. doi: 10.1016/j.canlet.2017.03.004. [DOI] [PubMed] [Google Scholar]
38.Wu F., Li J., Guo N., Wang X.H., Liao Y.Q. MiRNA-27a promotes the proliferation and invasion of human gastric cancer MGC803 cells by targeting SFRP1 via Wnt/β-catenin signaling pathway. Am. J. Cancer Res. 2017;7:405–416. [PMC free article] [PubMed] [Google Scholar]
39.Akhtar N., Dickerson E.B., Auerbach R. The sponge/Matrigel angiogenesis assay. Angiogenesis. 2002;5:75–80. doi: 10.1023/a:1021507031486. [DOI] [PubMed] [Google Scholar]
40.Li J., Zhang Y., Liu Y., Dai X., Li W., Cai X., Yin Y., Wang Q., Xue Y., Wang C. Microvesicle-mediated transfer of microRNA-150 from monocytes to endothelial cells promotes angiogenesis. J. Biol. Chem. 2013;288:23586–23596. doi: 10.1074/jbc.M113.489302. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Malinda K.M. In vivo matrigel migration and angiogenesis assay. Methods Mol. Biol. 2009;467:287–294. doi: 10.1007/978-1-59745-241-0_17. [DOI] [PubMed] [Google Scholar]
42.Valadi H., Ekström K., Bossios A., Sjöstrand M., Lee J.J., Lötvall J.O. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 2007;9:654–659. doi: 10.1038/ncb1596. [DOI] [PubMed] [Google Scholar]
43.Chen L., Feng Z., Yue H., Bazdar D., Mbonye U., Zender C., Harding C.V., Bruggeman L., Karn J., Sieg S.F. Exosomes derived from HIV-1-infected cells promote growth and progression of cancer via HIV TAR RNA. Nat. Commun. 2018;9:4585. doi: 10.1038/s41467-018-07006-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Kamerkar S., LeBleu V.S., Sugimoto H., Yang S., Ruivo C.F., Melo S.A., Lee J.J., Kalluri R. Exosomes facilitate therapeutic targeting of oncogenic KRAS in pancreatic cancer. Nature. 2017;546:498–503. doi: 10.1038/nature22341. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Document S1. Figures S1–S4

mmc1.pdf^{(493.8KB, pdf)}

Document S2. Article plus Supplemental information

mmc2.pdf^{(2.3MB, pdf)}

[bib1] 1.Fabbri L., Dufies M., Lacas-Gervais S., Gardie B., Gad-Lapiteau S., Parola J., Nottet N., Meyenberg Cunha de Padua M., Contenti J., Borchiellini D. Identification of a new aggressive axis driven by ciliogenesis and absence of VDAC1-ΔC in clear cell Renal Cell Carcinoma patients. Theranostics. 2020;10:2696–2713. doi: 10.7150/thno.41001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib2] 2.Rao H., Li X., Liu M., Liu J., Li X., Xu J., Li L., Gao W.Q. Di-Ras2 promotes renal cell carcinoma formation by activating the mitogen-activated protein kinase pathway in the absence of von Hippel-Lindau protein. Oncogene. 2020;39:3853–3866. doi: 10.1038/s41388-020-1247-y. [DOI] [PubMed] [Google Scholar]

[bib3] 3.Wang R., Zheng B., Liu H., Wan X. Long non-coding RNA PCAT1 drives clear cell renal cell carcinoma by upregulating YAP via sponging miR-656 and miR-539. Cell Cycle. 2020;19:1122–1131. doi: 10.1080/15384101.2020.1748949. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]

[bib4] 4.Wolf M.M., Kimryn Rathmell W., Beckermann K.E. Modeling clear cell renal cell carcinoma and therapeutic implications. Oncogene. 2020;39:3413–3426. doi: 10.1038/s41388-020-1234-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib5] 5.Fogli S., Porta C., Del Re M., Crucitta S., Gianfilippo G., Danesi R., Rini B.I., Schmidinger M. Optimizing treatment of renal cell carcinoma with VEGFR-TKIs: a comparison of clinical pharmacology and drug-drug interactions of anti-angiogenic drugs. Cancer Treat. Rev. 2020;84:101966. doi: 10.1016/j.ctrv.2020.101966. [DOI] [PubMed] [Google Scholar]

[bib6] 6.Morin E., Lindskog C., Johansson M., Egevad L., Sandström P., Harmenberg U., Claesson-Welsh L., Sjöberg E. Perivascular Neuropilin-1 expression is an independent marker of improved survival in renal cell carcinoma. J. Pathol. 2020;250:387–396. doi: 10.1002/path.5380. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib7] 7.Sun Z., Yang S., Zhou Q., Wang G., Song J., Li Z., Zhang Z., Xu J., Xia K., Chang Y. Emerging role of exosome-derived long non-coding RNAs in tumor microenvironment. Mol. Cancer. 2018;17:82. doi: 10.1186/s12943-018-0831-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib8] 8.Alvarez M.L., Khosroheidari M., Kanchi Ravi R., DiStefano J.K. Comparison of protein, microRNA, and mRNA yields using different methods of urinary exosome isolation for the discovery of kidney disease biomarkers. Kidney Int. 2012;82:1024–1032. doi: 10.1038/ki.2012.256. [DOI] [PubMed] [Google Scholar]

[bib9] 9.Di Gregoli K., Jenkins N., Salter R., White S., Newby A.C., Johnson J.L. MicroRNA-24 regulates macrophage behavior and retards atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2014;34:1990–2000. doi: 10.1161/ATVBAHA.114.304088. [DOI] [PubMed] [Google Scholar]

[bib10] 10.Awakura Y., Nakamura E., Ito N., Kamoto T., Ogawa O. Methylation-associated silencing of SFRP1 in renal cell carcinoma. Oncol. Rep. 2008;20:1257–1263. [PubMed] [Google Scholar]

[bib11] 11.Urbich C., Kaluza D., Frömel T., Knau A., Bennewitz K., Boon R.A., Bonauer A., Doebele C., Boeckel J.N., Hergenreider E. MicroRNA-27a/b controls endothelial cell repulsion and angiogenesis by targeting semaphorin 6A. Blood. 2012;119:1607–1616. doi: 10.1182/blood-2011-08-373886. [DOI] [PubMed] [Google Scholar]

[bib12] 12.Huth L., Rose M., Kloubert V., Winkens W., Schlensog M., Hartmann A., Knüchel R., Dahl E. BDNF is associated with SFRP1 expression in luminal and basal-like breast cancer cell lines and primary breast cancer tissues: a novel role in tumor suppression? PLoS ONE. 2014;9:e102558. doi: 10.1371/journal.pone.0102558. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib13] 13.Hu J., Dong A., Fernandez-Ruiz V., Shan J., Kawa M., Martínez-Ansó E., Prieto J., Qian C. Blockade of Wnt signaling inhibits angiogenesis and tumor growth in hepatocellular carcinoma. Cancer Res. 2009;69:6951–6959. doi: 10.1158/0008-5472.CAN-09-0541. [DOI] [PubMed] [Google Scholar]

[bib14] 14.Xu J.F., Wang Y.P., Zhang S.J., Chen Y., Gu H.F., Dou X.F., Xia B., Bi Q., Fan S.W. Exosomes containing differential expression of microRNA and mRNA in osteosarcoma that can predict response to chemotherapy. Oncotarget. 2017;8:75968–75978. doi: 10.18632/oncotarget.18373. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib15] 15.Zhao Z., Yang Y., Zeng Y., He M. A microfluidic ExoSearch chip for multiplexed exosome detection towards blood-based ovarian cancer diagnosis. Lab Chip. 2016;16:489–496. doi: 10.1039/c5lc01117e. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib16] 16.Li H.C., Li J.P., Wang Z.M., Fu D.L., Li Z.L., Zhang D., Gan W.M., Chong T. Identification of angiogenesis-related miRNAs in a population of patients with renal clear cell carcinoma. Oncol. Rep. 2014;32:2061–2069. doi: 10.3892/or.2014.3403. [DOI] [PubMed] [Google Scholar]

[bib17] 17.Viallard C., Larrivée B. Tumor angiogenesis and vascular normalization: alternative therapeutic targets. Angiogenesis. 2017;20:409–426. doi: 10.1007/s10456-017-9562-9. [DOI] [PubMed] [Google Scholar]

[bib18] 18.Sajib S., Zahra F.T., Lionakis M.S., German N.A., Mikelis C.M. Mechanisms of angiogenesis in microbe-regulated inflammatory and neoplastic conditions. Angiogenesis. 2018;21:1–14. doi: 10.1007/s10456-017-9583-4. [DOI] [PubMed] [Google Scholar]

[bib19] 19.Dahl E., Wiesmann F., Woenckhaus M., Stoehr R., Wild P.J., Veeck J., Knüchel R., Klopocki E., Sauter G., Simon R. Frequent loss of SFRP1 expression in multiple human solid tumours: association with aberrant promoter methylation in renal cell carcinoma. Oncogene. 2007;26:5680–5691. doi: 10.1038/sj.onc.1210345. [DOI] [PubMed] [Google Scholar]

[bib20] 20.Veeck J., Niederacher D., An H., Klopocki E., Wiesmann F., Betz B., Galm O., Camara O., Dürst M., Kristiansen G. Aberrant methylation of the Wnt antagonist SFRP1 in breast cancer is associated with unfavourable prognosis. Oncogene. 2006;25:3479–3488. doi: 10.1038/sj.onc.1209386. [DOI] [PubMed] [Google Scholar]

[bib21] 21.Zhu H., Wu H., Liu X., Evans B.R., Medina D.J., Liu C.G., Yang J.M. Role of MicroRNA miR-27a and miR-451 in the regulation of MDR1/P-glycoprotein expression in human cancer cells. Biochem. Pharmacol. 2008;76:582–588. doi: 10.1016/j.bcp.2008.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib22] 22.Zhao X., Yang L., Hu J. Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J. Exp. Clin. Cancer Res. 2011;30:55. doi: 10.1186/1756-9966-30-55. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib23] 23.Guo D., Li Q., Lv Q., Wei Q., Cao S., Gu J. MiR-27a targets sFRP1 in hFOB cells to regulate proliferation, apoptosis and differentiation. PLoS ONE. 2014;9:e91354. doi: 10.1371/journal.pone.0091354. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib24] 24.Wang K., Xie D., Xie J., Wan Y., Ma L., Qi X., Yang S. MiR-27a regulates Wnt/beta-catenin signaling through targeting SFRP1 in glioma. Neuroreport. 2015;26:695–702. doi: 10.1097/WNR.0000000000000410. [DOI] [PubMed] [Google Scholar]

[bib25] 25.Rini B.I., Pal S.K., Escudier B.J., Atkins M.B., Hutson T.E., Porta C., Verzoni E., Needle M.N., McDermott D.F. Tivozanib versus sorafenib in patients with advanced renal cell carcinoma (TIVO-3): a phase 3, multicentre, randomised, controlled, open-label study. Lancet Oncol. 2020;21:95–104. doi: 10.1016/S1470-2045(19)30735-1. [DOI] [PubMed] [Google Scholar]

[bib26] 26.Ornstein M.C., Pal S.K., Wood L.S., Tomer J.M., Hobbs B.P., Jia X.S., Allman K.D., Martin A., Olencki T., Davis N.B. Individualised axitinib regimen for patients with metastatic renal cell carcinoma after treatment with checkpoint inhibitors: a multicentre, single-arm, phase 2 study. Lancet Oncol. 2019;20:1386–1394. doi: 10.1016/S1470-2045(19)30513-3. [DOI] [PubMed] [Google Scholar]

[bib27] 27.Richter A.M., Woods M.L., Küster M.M., Walesch S.K., Braun T., Boettger T., Dammann R.H. RASSF10 is frequently epigenetically inactivated in kidney cancer and its knockout promotes neoplasia in cancer prone mice. Oncogene. 2020;39:3114–3127. doi: 10.1038/s41388-020-1195-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib28] 28.Tang W., Yu F., Yao H., Cui X., Jiao Y., Lin L., Chen J., Yin D., Song E., Liu Q. miR-27a regulates endothelial differentiation of breast cancer stem like cells. Oncogene. 2014;33:2629–2638. doi: 10.1038/onc.2013.214. [DOI] [PubMed] [Google Scholar]

[bib29] 29.Wang Y.L., Gong W.G., Yuan Q.L. Effects of miR-27a upregulation on thyroid cancer cells migration, invasion, and angiogenesis. Genet. Mol. Res. 2016 doi: 10.4238/gmr15049070. Published online December 19, 2016. [DOI] [PubMed] [Google Scholar]

[bib30] 30.Pate K.T., Stringari C., Sprowl-Tanio S., Wang K., TeSlaa T., Hoverter N.P., McQuade M.M., Garner C., Digman M.A., Teitell M.A. Wnt signaling directs a metabolic program of glycolysis and angiogenesis in colon cancer. EMBO J. 2014;33:1454–1473. doi: 10.15252/embj.201488598. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib31] 31.Kooijmans S.A.A., Stremersch S., Braeckmans K., de Smedt S.C., Hendrix A., Wood M.J.A., Schiffelers R.M., Raemdonck K., Vader P. Electroporation-induced siRNA precipitation obscures the efficiency of siRNA loading into extracellular vesicles. J. Control. Release. 2013;172:229–238. doi: 10.1016/j.jconrel.2013.08.014. [DOI] [PubMed] [Google Scholar]

[bib32] 32.Ramanathan S., Shenoda B.B., Lin Z., Alexander G.M., Huppert A., Sacan A., Ajit S.K. Inflammation potentiates miR-939 expression and packaging into small extracellular vesicles. J. Extracell. Vesicles. 2019;8:1650595. doi: 10.1080/20013078.2019.1650595. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib33] 33.Takahasi K., Iinuma H., Wada K., Minezaki S., Kawamura S., Kainuma M., Ikeda Y., Shibuya M., Miura F., Sano K. Usefulness of exosome-encapsulated microRNA-451a as a minimally invasive biomarker for prediction of recurrence and prognosis in pancreatic ductal adenocarcinoma. J. Hepatobiliary Pancreat. Sci. 2018;25:155–161. doi: 10.1002/jhbp.524. [DOI] [PubMed] [Google Scholar]

[bib34] 34.Gautier L., Cope L., Bolstad B.M., Irizarry R.A. affy--analysis of Affymetrix GeneChip data at the probe level. Bioinformatics. 2004;20:307–315. doi: 10.1093/bioinformatics/btg405. [DOI] [PubMed] [Google Scholar]

[bib35] 35.Smyth G.K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. 2004;3 doi: 10.2202/1544-6115.1027. Article3. [DOI] [PubMed] [Google Scholar]

[bib36] 36.Donnarumma E., Fiore D., Nappa M., Roscigno G., Adamo A., Iaboni M., Russo V., Affinito A., Puoti I., Quintavalle C. Cancer-associated fibroblasts release exosomal microRNAs that dictate an aggressive phenotype in breast cancer. Oncotarget. 2017;8:19592–19608. doi: 10.18632/oncotarget.14752. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib37] 37.Zhang Z., Li X., Sun W., Yue S., Yang J., Li J., Ma B., Wang J., Yang X., Pu M. Loss of exosomal miR-320a from cancer-associated fibroblasts contributes to HCC proliferation and metastasis. Cancer Lett. 2017;397:33–42. doi: 10.1016/j.canlet.2017.03.004. [DOI] [PubMed] [Google Scholar]

[bib38] 38.Wu F., Li J., Guo N., Wang X.H., Liao Y.Q. MiRNA-27a promotes the proliferation and invasion of human gastric cancer MGC803 cells by targeting SFRP1 via Wnt/β-catenin signaling pathway. Am. J. Cancer Res. 2017;7:405–416. [PMC free article] [PubMed] [Google Scholar]

[bib39] 39.Akhtar N., Dickerson E.B., Auerbach R. The sponge/Matrigel angiogenesis assay. Angiogenesis. 2002;5:75–80. doi: 10.1023/a:1021507031486. [DOI] [PubMed] [Google Scholar]

[bib40] 40.Li J., Zhang Y., Liu Y., Dai X., Li W., Cai X., Yin Y., Wang Q., Xue Y., Wang C. Microvesicle-mediated transfer of microRNA-150 from monocytes to endothelial cells promotes angiogenesis. J. Biol. Chem. 2013;288:23586–23596. doi: 10.1074/jbc.M113.489302. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib41] 41.Malinda K.M. In vivo matrigel migration and angiogenesis assay. Methods Mol. Biol. 2009;467:287–294. doi: 10.1007/978-1-59745-241-0_17. [DOI] [PubMed] [Google Scholar]

[bib42] 42.Valadi H., Ekström K., Bossios A., Sjöstrand M., Lee J.J., Lötvall J.O. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 2007;9:654–659. doi: 10.1038/ncb1596. [DOI] [PubMed] [Google Scholar]

[bib43] 43.Chen L., Feng Z., Yue H., Bazdar D., Mbonye U., Zender C., Harding C.V., Bruggeman L., Karn J., Sieg S.F. Exosomes derived from HIV-1-infected cells promote growth and progression of cancer via HIV TAR RNA. Nat. Commun. 2018;9:4585. doi: 10.1038/s41467-018-07006-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib44] 44.Kamerkar S., LeBleu V.S., Sugimoto H., Yang S., Ruivo C.F., Melo S.A., Lee J.J., Kalluri R. Exosomes facilitate therapeutic targeting of oncogenic KRAS in pancreatic cancer. Nature. 2017;546:498–503. doi: 10.1038/nature22341. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

This article has been retracted.

Oncogenic miR-27a delivered by exosomes binds to SFRP1 and promotes angiogenesis in renal clear cell carcinoma

Yi Hou

Li Fan

Hai Li

Abstract

Graphical Abstract

Introduction

Results

SFRP1 was poorly expressed and miR-27a was highly expressed in RCCC, showing a negative correlation

Figure 1.

miR-27a targets and downregulates SFRP1 expression

Figure 2.

miR-27a accelerates angiogenesis of HUVECs by downregulating SFRP1 expression

Figure 3.

RCCC cell-derived exosomes deliver miR-27a to HUVECs to directly target SFRP1

Figure 4.

RCCC cell-derived exosomal miR-27a accelerates angiogenesis of HUVECs by downregulating SFRP1 in vitro

Figure 5.

RCCC cell-derived exosomal miR-27a accelerates angiogenesis of HUVECs by downregulating SFRP1 in vivo

Figure 6.

Discussion

Figure 7.

Materials and methods

Ethics statement

Patients

Animals

Cell lines

Bioinformatics analysis

Table 1.

RNA extraction and qRT-PCR

Table 2.

Western blots

Immunohistochemistry

Lentiviral production and transduction

Luciferase activity assay

CCK-8 assay

Transwell assay

Matrigel-based tube formation assay

Isolation and identification of exosomes

PKH67 staining of exosomes

Xenograft tumors in nude mice

ELISA

Statistical analysis

Acknowledgments

Author contributions

Declaration of interests

Footnotes

Supplemental information

References

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases