Abstract
Background
Serine‐arginine protein kinase (SRPK) is a regulator of alternative splicing events via phosphorylation of splicing factor proteins. Oncogenic roles of SRPK1 and SRPK2 have been reported in various types of cancer. To date, only SRPK1/2 specific inhibitors and small interfering RNA (siRNA) have been used for halting their function momentarily; however, there is no attempt to generate SRPK1/2 stable knockout cancer cells as a tool to investigate their roles in tumorigenesis.
Aim
Our objective is therefore to establish a nasopharyngeal carcinoma (NPC) cell line with stable SRPK1 or SRPK2 knockout and SRPK1/2 double knockout as a model to investigate their potential roles in NPC.
Methods and Results
CNE1 was selected as a representative of NPC cell lines to create single and double knockout of SRPK1/2 proteins. SRPK1/2 KO plasmid with cas9, green fluorescent protein (GFP), and gRNA expression was cotransfected with SRPK1/2 homology‐directed repair (HDR) plasmid containing puromycin resistance, red fluorescent protein (RFP), and 5′ and 3′ arm sequence for homologous recombination to CNE1 cells. The transfected CNE1 cells with GFP and RFP expression were sorted through fluorescence‐activated cell sorting for further treatment with puromycin containing medium. This step generated stable single knockout of SRPK1 and SRPK2. The SRPK2 knockout NPC cells were used as a precursor for double knockout generation via transfection with Cre plasmid for excision of inserted material to generate puromycin‐sensitive SRPK2 knockout clone. The puromycin‐sensitive SRPK2 knockout cells were transfected with SRPK1 KO/HDR plasmid and treated with puromycin‐containing medium. The puromycin‐resistant cells of SRPK1/2 stable double knockout were expanded, and the corresponding protein expression was confirmed by western immunoblotting analysis.
Conclusion
Single and double knockout of SRPK1/2 were established using clustered regularly interspaced short palindromic repeats (CRISPR)/ CRISPR‐associated 9 (Cas9) system in an NPC cell line as a model for investigation of their splicing mechanism in NPC.
Keywords: alternative splicing, SRPK1, SRPK2, CRISPR/Cas9, nasopharyngeal carcinoma
1. INTRODUCTION
Nasopharyngeal carcinoma (NPC) is a malignant cancer derived from nasopharyngeal epithelium. Although NPC is a rare disease in Europe, it is commonly found in China, Taiwan, and Southeast Asia including in Thailand.1, 2 Most NPC cases appear at advanced stages; therefore, conventional treatments are not effective.3 Pathway targeted therapy is currently of interest as a potential approach to treat advanced stages of NPC.4 Alternative splicing has been reported as one mechanism to govern oncogenic isoform(s) of specific genes during tumorigenesis. Hence, proteins involved in alternative splicing could represent as novel targets for therapy in many types of cancer including NPC.5
Serine/arginine‐protein kinase (SRPK) is well‐known as a player involved in the regulation of several mRNA processing pathways including alternative splicing. It phosphorylates serine/arginine‐rich splicing factors (SRSFs). Phosphorylated SRSF enters to nucleus and splices the mRNA target.6 Two major SRPKs are SRPK1 and SRPK2, both of which have been reported to play a role in several cancer types. For example, SRPK1 is upregulated in non‐small–cell lung cancer, which promotes aggressive phenotypes of cancer cells.7 SRPK2 has been shown to be overexpressed in colon cancer tissues and inhibition of SRPK2 suppressed growth, migration, and tumorigenicity of colon cancer cells.8
To date, there are commercially available SRPK inhibitors including SRPIN340 and SRPKIN‐1 for inhibiting both SRPK1/2, whereas SPHINX31 was designed to be specific only to SRPK1.9, 10, 11 Small interfering RNA (siRNA) is another tool to suppress SRPK protein expression.12 However, both inhibitors and siRNA can reduce SRPK function transiently. Thus, the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR‐associated 9 (Cas9) system are considered as a useful tool to generate stable SRPK gene disruption in cancer cells. To generate the knockout cells, the knockout (KO) plasmid expresses Cas9 protein and guide RNA (gRNA) of the target gene, both of which then cleave the target gene. The cleaved site is then repaired by the homology‐directed repair (HDR) with a donor DNA template from the HDR plasmid containing inserted materials. Consequently, the resultant cells will contain specific gene disruption with inserted selective markers.13
Herein, we described a detailed protocol to generate a single knockout of SRPK1 or SRPK2 and a double knockout of both SRPK1/2 in an NPC cell line. Cloning dilution and routine western immunoblotting assay were performed to determine SRPK1/2 proteins.
2. AIM
This work aims to establish a stable SRPK1/2 knockout cell line as a model to investigate their roles in alternative splicing in NPC.
3. METHODS
3.1. NPC cell line and culture conditions
A nasopharyngeal carcinoma cell line, CNE1, was obtained from NPC AoE Research Tissue Bank Center for Nasopharyngeal Carcinoma Research, Hong Kong SAR China. The cell line has a complete authentication report utilizing short tandem repeat profiling. CNE‐1 cells were cultured in the Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco) supplemented with 10% heat inactivated fetal bovine serum (FBS) in cell culture flask under 5% CO2 and 37°C humidified incubator.
3.2. Off‐target analysis
For each KO plasmid, a pool of three different gRNA was included with the sequences for SRPK1—sense‐ATAATACCCCTGCTGACATT; CCGCTCACCTTTCCGCTCCA; AGATCTGAAACTCAGCACCG—and SRPK2—sense‐GGATATCATCCAGTGAAAAT; GTAGCTGTACCTTTCTGAAG; ATCTCCTCCTCTGGCTCCGG. The specificity and genome‐wide off‐target analysis of the gRNA sequences for SRPK1 and SRPK2 were performed using web‐based algorithms, Cas‐OFFinder14 to assure the high specificity to the target sites.
3.3. Single knockout generation
3.3.1. Transfection
Approximately, 20 000 cells were seeded into a 6‐well plate containing 3 mL of RPMI complete medium without penicillin/streptomycin in each well and were incubated for 24 hours. For SRPK1 knockout, 1 μg of SRPK1 CRISPR/Cas9 KO plasmid (Santa Cruz Biotechnology, cat# sc‐402855) and 1 μg of SRPK1 HDR plasmid (Santa Cruz Biotechnology, cat# sc‐402855‐HDR) were mixed into transfection medium (Santa Cruz Biotechnology, cat# sc‐108062) with a final volume of 150 μL (solution A). Then, 10 μL of transfection reagent (Santa Cruz Biotechnology, cat# sc‐395739) was added into transfection medium with a final volume of 150 μL (solution B). The solution A was added to the solution B dropwise, which was then vortexed immediately and incubated at room temperature for 30 minutes. For SRPK2 knockout, the solution A was replaced with SRPK2 KO plasmid (Santa Cruz Biotechnology, cat# sc‐403763) and HDR (Santa Cruz Biotechnology, cat# sc‐403763‐HDR). For control condition, 1 μg of control CRISPR/Cas9 plasmid (Santa Cruz Biotechnology, cat# sc‐418922) was added into transfection medium with a final volume of 150 μL for the solution A. After 30‐minute incubation period, the medium in each well was replaced with antibiotic‐free RPMI complete medium and the transfection reagent complex was added dropwise to the cells in each single condition. The plate was mixed gently and incubated for 48 hours. Following the incubation, the medium was replaced with normal RPMI complete medium, and the cells were further incubated for 1 to 2 days to make cell healthier before sorting process.
3.3.2. GFP and RFP sorting
The transfected cells were washed on plate by rinsing with ice‐cold phosphate buffer saline (PBS) and were trypsinized for 5 minutes in the incubator. Trypsinized cells were transferred into a 15‐mL tube, were centrifuged at 2000× g, and were washed with ice‐cold PBS. The cells were then resuspended in 1 mL of cell sorting buffer containing 5mM ethylenediaminetetraacetic acid (EDTA), 25mM 4‐(2‐hydroxyethyl)‐1‐piperazineethanesulfonic acid (HEPES) pH 7.0, and 1% bovine serum albumin (BSA) in PBS prior to fluorescence signal analysis. Nontransfected CNE‐1 cells were used as a background control. Green fluorescent protein (GFP) and red fluorescent protein (RFP) positive cell populations of SRPK1 and SRPK2 knockout were sorted by BD FACSAria II Cell Sorter into 2 mL of recovery medium (50% FBS in RPMI). The GFP‐positive cells were sorted for control plasmid transfection.
3.3.3. Puromycin selection
Once the cells underwent the sorting process, they were then transferred in recovery medium into T25 flask containing 5 mL of 10% RPMI complete and were further incubated for 24 hours. Following the incubation, the medium was replaced with RPMI complete medium with 2 μg/mL puromycin (HiMedia) every 2 days to eliminate wild‐type puromycin‐sensitive cells. The cells were allowed to grow for a week prior to SRPK1 and SRPK2 expression analysis.
3.3.4. Western immunoblotting
The subconfluent, healthy cells on 6‐well plate were rinsed with 37°C ice‐cold PBS. The lysis buffer 10 mL containing 50mM Tris‐HCl pH7, 150mM NaCl, 5mM EDTA, 5mM dithiothreitol (DTT), and 1%(v/v) IGEPAL CA‐630 (Sigma‐Aldrich) with one tablet protease inhibitor cocktail (Roche Diagnostics) was added directly to the cell culture plate (100 μL per well in 6‐well plate). After 5 minutes, the lysate from the plate was transferred into a microtube, which was subjected to centrifugation at 12 000× g, 4°C for 10 minutes. The supernatant was collected into a new microtube and placed on ice immediately. Protein concentration of each sample was measured using Bradford protein assay (Bio‐Rad). Protein samples were mixed with protein loading buffer (5X: 250mM Tris‐HCl, pH 6.8, 10% sodium dodecyl sulfate (SDS), 30% (v/v) glycerol, 10mM DTT, 0.05% (w/v)) and heated at 95°C for 10 minutes. The protein samples and prestained protein standards were loaded onto the 10% SDS‐PAGE at 100 V for 1 hour in running buffer (25mM Tris, 192mM glycine [pH 8.3], 0.1% SDS). Then, the proteins were transferred to nitrocellulose membrane using wet transfer (25mM Tris‐192mM glycine [pH 8.3]) at 100 V for 2 hours. The membrane was washed in Tris buffer saline supplemented with Tween‐20 (TBST; 50mM Tris (pH 7.5), 150mM NaCl with 0.01% Tween‐20) on shaker for 10 minutes, three times and was blocked by gently shaking with blocking solution (5% BSA in TBST) at room temperature for 1 hour. Finally, immunoblotting was performed with primary antibodies: mouse anti‐human SRPK1 (Santa Cruz Biotechnology, cat# sc‐100443) concentration 1:400, mouse anti‐human SRPK2 concentration (Santa Cruz Biotechnology, cat# sc‐136078) 1:400, and mouse anti‐human β‐tubulin (Merck, cat# 05‐661) 1:1000 in blocking solution at 4°C overnight. The membrane was then washed vigorously in TBST 20 minutes, three times on the shaker and was subjected to anti‐mouse horseradish peroxidase (HRP)‐conjugated secondary antibody (Cell Signaling Technology, cat#7076) 1:2000 with gently shaking for 1 hour. The membrane was then washed vigorously in TBST 20 minutes, three times on the shaker. The proteins on the blots were detected by soaking the membrane with enhanced chemiluminescence (ECL) mixture (Perkin Elmer) and incubated for 1 minute prior to visualization in the gel documentation system.
3.4. Double knockout generation
3.4.1. Cre excision
The puromycin‐resistant SRPK2 KO NPC cells was used as a precursor in Cre excision. Approximately, 1000 cells were seeded into a 6‐well plate containing 3 mL of RPMI complete medium without penicillin/streptomycin in each well and were incubated for 24 hours. The mixture was prepared by mixing 3 μg of Cre plasmid (Santa Cruz Biotechnology, cat# sc‐ 418923) into transfection medium (Santa Cruz Biotechnology, cat# sc‐108062) with a final volume of 150 μL (solution A). Then, 10 μL of transfection reagent (Santa Cruz Biotechnology, cat# sc‐395739) was added into transfection medium with a final volume of 150 μL (solution B). The solution A was added to the solution B dropwise, which was then vortexed immediately and incubated at room temperature for 30 minutes. The medium in each well was then replaced with antibiotic‐free RPMI complete medium and the transfection reagent complex was added dropwise to the cells in each single condition. The plate was mixed gently and incubated for 24 hours. Following the incubation, the medium was replaced with normal RPMI complete medium.
The transfected cells were then diluted to a concentration of 10 000 cells/mL and tenfold dilution was performed to obtain 100 cells/mL. Approximately 10 μL of 100 cells/mL was seeded into each well of a 96‐well plate with 150 μL of RPMI complete medium. The cells were then cultured for a week and were observed for colony formation in each well. Every single clone was then trypsinized and spread into two replicates of 24‐well plates. The first plate was kept as a stock of SRPK2 KO Cre‐transfected cells with RPMI complete medium. The second plate was treated with RPMI complete medium containing 2 μg/mL puromycin and 20% FBS for a week with medium replacement every 2 days. The puromycin‐sensitive clones were picked from the stock plate according to its phenotype in the second plate.
3.4.2. Double knockout transfection
The puromycin‐sensitive SRPK2 KO CNE‐1 cells were used to generate SRPK1/2 double knockout cells. The transfection protocol was followed as previously described, except for the solution A that coupling the SRPK1 KO/HDR plasmid system on SRPK2 KO cells. Following the transfection, the cells were treated with RPMI complete medium containing 2 μg/mL puromycin for a week with medium replacement every 2 days. Finally, SRPK1 and SRPK2 expressions were determined by western immunoblotting as previously described.
4. RESULTS
CNE1 cells were used to create single and double knockout of SRPK1/2 following the flow chart in Figure 1. The first round of transfection generated control and single knockout conditions for SRPK1 and SRPK2. The flanking region mediated gene disruption and puromycin resistance simultaneously. The linear plasmid representation and outline of single knockout are shown (Figures 2 and 3). Transfected CNE1 cells with GFP and RFP expression were sorted for single SRPK1 or SRPK2 knockout, but only GFP positive cells were selected for control condition (Figure 4). In the second round of transfection, SRPK2 knockout CNE1 cells were transfected with Cre plasmid and were screened for puromycin‐sensitive clones via the cloning dilution. The puromycin‐sensitive cells then underwent the transfection with SRPK1 KO/plasmid for SRPK1/2 double knockout generation (Figure 5). The expression of both SRPK1 and SRPK2 in the CNE1 control cells, SRPK1 single knockout, SRPK2 single knockout, and SRPK1/2 double knockout as well as CNE1 wildtype cells was examined by Western immunoblotting analysis (Figure 6).
Figure 1.

A schematic flowchart of the protocol. The first round of transfection consists of control plasmid, SRPK1 KO/HDR plasmid, and SRPK2 KO/HDR plasmid to establish single knockout CNE1 cells. SRPK2 knockout CNE1 cells were then used as a precursor for Cre excision. Cloning dilution was performed to generate many possible clones of puromycin‐sensitive cells, which were subsequently transfected with SRPK1 KO/HDR plasmid for SRPK1/2 knockout. The expression was evaluated by western immunoblotting. HDR, homology‐directed repair; KO, knockout; SRPK, serine‐arginine protein kinase
Figure 2.

Plasmid maps. The linear structure of KO, HDR, and Cre plasmids are represented. HDR, homology‐directed repair; KO, knockout
Figure 3.

Gene disruption pattern of CRISPR/Cas9 system. The knockout process was mediated via KO/HDR plasmid transfection. The KO plasmid contains GFP and gRNA, which bring Cas9 to cleave the SRPK1/2 gene at a specific region, thereby triggering homologous recombination repair. The HDR plasmid contains RFP and an insertion part, puromycin N‐acetyltransferase gene (PAC), LoxP region, 3′arm and 5′arm. Once DNA is cut by gRNA, HDR plasmid acts as a template for DNA repair. Thus, LoxP and PAC are inserted into the genome within the SRPK1/2 gene causing gene disruption. Moreover, the knockout cells can survive puromycin treatment due to the presence of PAC gene. CRISPR, clustered regularly interspaced short palindromic repeats; GFP, green fluorescent protein; HDR, homology‐directed repair; KO, knockout; RFP, red fluorescent protein; SRPK, serine‐arginine protein kinase
Figure 4.

Flow cytometric analysis of transfected cells. Transfected cells were analyzed for fluorescence signal and sorted via FACS. Cells in quadrant 4 with only GFP positive population were sorted as a control condition, whereas population in quadrant 1 with GFP and RFP were selected for knockout conditions (SRPK1 KO and SRPK2 KO). GFP, green fluorescent protein; KO, knockout; RFP, red fluorescent protein; SRPK, serine‐arginine protein kinase
Figure 5.

Cre excision process. The Cre plasmid was transfected into the SRPK2 knockout NPC cells to remove the flanking material containing PAC gene, leaving the short flanking region of LoxP to persist the gene disruptive mechanism. Puromycin‐sensitive SRPK2 knockout cells were established at this step, which were then used as a starter for the double knockout process. NPC, nasopharyngeal carcinoma; SRPK, serine‐arginine protein kinase
Figure 6.

Expression of SRPK1 and SRPK2 in the knockout NPC cells. Western blot analysis revealed the expression of SRPK1 and SRPK2 in knockout CNE1 cells compared with the control and wildtype CNE1 cells. NPC, nasopharyngeal carcinoma; SRPK, serine‐arginine protein kinase
5. DISCUSSION
A detailed method to create the double knockout of SRPK1/2 in an NPC cell line was described herein. First, we generated the single knockout of SRPK1 and SRPK2 NPC cells. Second, the flanking region was then excised by the Cre vector, rendering the transfected cells to become puromycin‐sensitive due to the removal of PAC gene.15, 16 However, the Cre transfection rate in CNE1 was very low; we therefore reduced the amount of cells that were typically recommended from 20 000 to 1000 cells. It was then possible to dilute all remaining cells into single cell colony and replica culturing was performed to evaluate puromycin sensitivity. The SRPK2 KO cells were then used as a starter to generate double SRPK1/2 knockout via transfection with SRPK1 KO/plasmid. From the western blotting analysis, we successfully produced stable single and double knockout of SRPK1/2 in NPC cells.
6. CONCLUSION
We created SRPK1 and SRPK2 single knockout CNE1 cells and SRPK1/2 double knockout CNE1 cell using CRISPR/Cas9 as a model for further evaluations of alternative splicing mechanism in NPC.
CONFLICT OF INTEREST
Authors declare no conflict of interest.
AUTHORS' CONTRIBUTIONS
All authors had full access to the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Conceptualization, P.P., T.J.; Methodology, P.P., C.N., S.A.; Investigation, P.P., C.N.; Formal Analysis, P.P., T.J.; Resources, T.J.; Writing‐Original Draft, P.P.; Writing‐Review and Editing, P.P., C.N., S.A., T.J.; Visualization, P.P., T.J.; Supervision, T.J.; Funding Acquisition, T.J.
ACKNOWLEDGEMENTS
This work is supported by Thailand Research Fund to T.J. (BRG5980003). P.P. is supported by the Science Achievement Scholarship of Thailand. C.N. is supported by the Development and Promotion of Science and Technology Talents Project. S.A. is supported by the Royal Golden Jubilee Ph.D. Program.
Prattapong P, Ngernsombat C, Aimjongjun S, Janvilisri T. CRISPR/Cas9‐mediated double knockout of SRPK1 and SRPK2 in a nasopharyngeal carcinoma cell line. Cancer Reports. 2020;3:e1224. 10.1002/cnr2.1224
DATA AVAILABILITY STATEMENT
The data that support the findings of this study and the cell lines generated herein are available from the corresponding author upon request.
REFERENCES
- 1. Fachiroh J, Sangrajrang S, Johansson M, et al. Tobacco consumption and genetic susceptibility to nasopharyngeal carcinoma (NPC) in Thailand. Cancer Causes Control: CCC. 2012;23(12):1995‐2002. [DOI] [PubMed] [Google Scholar]
- 2. Jeyakumar A, Brickman TM, Jeyakumar A, Doerr T. Review of nasopharyngeal carcinoma. Ear Nose Throat J. 2006;85(3):168‐184. [PubMed] [Google Scholar]
- 3. Caponigro F, Longo F, Ionna F, Perri F. Treatment approaches to nasopharyngeal carcinoma: a review. Anticancer Drugs. 2010;21(5):471‐477. [DOI] [PubMed] [Google Scholar]
- 4. Tulalamba W, Janvilisri T. Nasopharyngeal carcinoma signaling pathway: an update on molecular biomarkers. Int J Cell Biol. 2012;2012:594681. 10.1155/2012/594681 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Oltean S, Bates DO. Hallmarks of alternative splicing in cancer. Oncogene. 2014;33(46):5311‐5318. [DOI] [PubMed] [Google Scholar]
- 6. Zhou Z, Fu XD. Regulation of splicing by SR proteins and SR protein‐specific kinases. Chromosoma. 2013;122(3):191‐207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Liu H, Hu X, Zhu Y, Jiang G, Chen S. Up‐regulation of SRPK1 in non‐small cell lung cancer promotes the growth and migration of cancer cells. Tumour Biol: J Int Soc Oncodevelopmental Biol Med. 2016;37(6):7287‐7293. [DOI] [PubMed] [Google Scholar]
- 8. Wang J, Wu HF, Shen W, et al. SRPK2 promotes the growth and migration of the colon cancer cells. Gene. 2016;586(1):41‐47. [DOI] [PubMed] [Google Scholar]
- 9. Batson J, Toop HD, Redondo C, et al. Development of potent, selective SRPK1 inhibitors as potential topical therapeutics for neovascular eye disease. ACS Chem Biol. 2017;12(3):825‐832. [DOI] [PubMed] [Google Scholar]
- 10. Hatcher JM, Wu G, Zeng C, et al. SRPKIN‐1: a covalent SRPK1/2 inhibitor that potently converts VEGF from pro‐angiogenic to anti‐angiogenic isoform. Cell Chem Biol. 2018;25(4):460‐70.e6):460‐470.e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Gammons MV, Hagiwara M, Dick AD, Bates DO. SRPK1/2 inhibition, by SRPIN340, as a novel therapeutic to control VEGF mediated choroidal neovascularisation. Invest Ophthalmol Vis Sci. 2011;52(14):5928.21693610 [Google Scholar]
- 12. Yi N, Xiao MB, Jiang F, et al. SRPK1 is a poor prognostic indicator and a novel potential therapeutic target for human colorectal cancer. Oncotargets Ther. 2018;11:5359‐5370. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Liu KI, Sutrisnoh NB, Wang Y, Tan MH. Genome editing in mammalian cell lines using CRISPR‐Cas. J Vis Exp. 2019;11(146). 10.3791/59086 [DOI] [PubMed] [Google Scholar]
- 14. Zhang XH, Tee LY, Wang XG, Huang QS, Yang SH. Off‐target effects in CRISPR/Cas9‐mediated genome engineering. Mol Ther Nucleic Acids. 2015;17(4):e264. 10.1038/mtna.2015.37 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Faddaoui A, Sheta R, Bachvarova M, et al. Suppression of the grainyhead transcription factor 2 gene (GRHL2) inhibits the proliferation, migration, invasion and mediates cell cycle arrest of ovarian cancer cells. Cell Cycle. 2017;16(7):693‐706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Faddaoui A, Bachvarova M, Plante M, et al. The mannose receptor LY75 (DEC205/CD205) modulates cellular phenotype and metastatic potential of ovarian cancer cells. Oncotarget. 2016;7(12):14125‐14142. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study and the cell lines generated herein are available from the corresponding author upon request.
