Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Mar 11.
Published in final edited form as: Methods Mol Biol. 2021;2209:287–305. doi: 10.1007/978-1-0716-0935-4_18

Probing transcriptome-wide RNA structural changes dependent on the DEAD-box helicase Dbp2

Yu-Hsuan Lai 1, Elizabeth J Tran 1,2,*
PMCID: PMC7948247  NIHMSID: NIHMS1677194  PMID: 33201476

Abstract

RNA helicases function in all aspects of RNA biology mainly through remodeling structures of RNA and RNA-protein (RNP) complexes. Among them, DEAD-box proteins form the largest family in eukaryotes, and have been shown to remodel RNA/RNP structures and clamping of RNA binding proteins, both in vitro and in vivo. Nevertheless, for the majority of these enzymes, it is largely unclear what RNAs are targeted and where they modulate RNA/RNP structures to promote RNA metabolism. Several methods have been developed to probe secondary and tertiary structures of specific transcripts or whole transcriptomes in vivo. In this chapter, we describe a protocol for identification of RNA structural changes that are dependent on a Saccharomyces cerevisiae DEAD-box helicase Dbp2. Experiments detailed here can be adapted to the study of other RNA helicases and identification of putative remodeling targets in vivo.

1. Introduction

An RNA molecule can often be folded into multiple thermodynamically favored conformations. However, for an RNA to perform its function properly, formation of other non-functional, yet stable, structures have to be prevented or resolved. Potential candidates for solving this RNA folding problem in vivo are RNA chaperones, including RNA helicases, which can bind and remodel RNAs and macromolecular complexes of RNA with proteins (RNPs) [1, 2]. Consistently, one study suggested that ATP-dependent factors, such as RNA helicases, maintain the actively unfolded state of mRNAs in vivo [3]. Therefore, to better understand the biological function of RNA structures and their regulators, identification of the enzymatic targets of RNA helicases becomes the next critical step in the field.

DEAD-box proteins are a family of RNA helicases found in all kingdoms of life, with 4 members in E. coli, 26 in Saccharomyces cerevisiae, and 37 in humans [4]. They are characterized by the presence of the 12 conserved motifs in the core [5], and are named by the Asp-Glu-Ala-Asp (D-E-A-D) sequence within motif II. Some members have additional N-terminal or C-terminal domains flanking the core, which provide specificity and/or regulation of these enzymes [6]. Many DEAD-box helicases are involved in steps of gene expression, including transcription, pre-mRNA splicing, export, translation, and RNA decay [7]. Importantly, several human DEAD-box proteins have also been implicated in a variety of diseases and cancer development [8, 9].

Most DEAD-box helicases have an ATP-dependent RNA-unwinding activity in vitro [5]. Some also display ATP-independent RNA annealing [10], an activity proposed to facilitate exchange between RNA conformations [11]. Although non-processive, the duplex unwinding activity has been demonstrated to be functional in several RNA processing steps. For example, Mss116 in S. cerevisiae serves as an RNA chaperone, assisting the folding of functional group I and II introns by disrupting misfolded structures and promoting formation of alternative conformations [12–14]. DEAD-box helicases, including DDX5 and DDX17, have also been reported to unwind secondary RNA structures in pre-mRNA and thereby regulate alternative splicing and/or miRNA processing [15–17]. Several DEAD-box helicases have also been shown to resolve structures in the 5’ UTR of mRNAs to facilitate the initiation of ribosome scanning and translation [18–20]. These examples suggest that the RNA remodeling activity plays a critical role in gene expression, yet the enzymatic targets of the majority of DEAD-box family remain uncharacterized.

Not until five years ago was the first genome-wide RNA structure probing method inside cells reported [3, 21, 22]. Since then, several studies have developed methods to map secondary structures in various RNA species and regions in cells from different organisms, including yeast, plant, and humans [23–27]. Methods for mapping intracellular RNA structures can be predominantly categorized into two major groups based on the modification chemistry: chemical modification by dimethyl sulfate (DMS) and selective 2’-hydroxyl acylation analyzed by primer extension (SHAPE) [28]. DMS is a membrane-permeable chemical that methylates accessible adenines and cytosines in an RNA molecule that are not actively engaged in Watson-Crick base-paring [28]. By probing the reactivity of nucleotides to DMS in a given RNA, the level of base pairing can be inferred at single-nucleotide resolution [29, 30]. Because of its ability to rapidly penetrate into cells, DMS probing of RNA structures has been widely applied to cells from various organisms, including bacteria, yeast, plants, and humans [31]. However, DMS-based method can only provide information of As and Cs; therefore, structural mapping can be limited for regions with few or no A/C nucleotide. In SHAPE-based methods, accessible ribonucleotides are acylated by SHAPE reagents at the 2’ hydroxyl position in the ribose, which usually happens in flexible, single stranded regions of RNAs [32]. Because all four nucleotides can be modified by SHAPE reagents, SHAPE-based methods provide a comprehensive mapping of cellular RNA structures. Nevertheless, they have been applied to only a limited number of cell types, and have not been shown to be successful for RNA structural probing in yeast [27]. The modifications produced by DMS or SHPAE reagents can lead to reverse transcription stops or mutations in the cDNAs during library preparation. Consequently, sites of modification can be identified by the location of adaptor ligation or nucleotide conversion in sequences. Thus, the level of modification at each nucleotide reflects the state of RNA folding and structures.

To date, only a few genome-wide studies investigated the impact of DEAD-box helicases on cellular RNA structures. One such example is the recent study of the role of Ded1, a DEAD-box protein required for translation initiation, in RNA structure remodeling and translation efficiency in S. cerevisiae [20]. By comparing mRNA structure profiles of the wild type and ded1 mutant, it was found that loss of Ded1 helicase activity leads to a striking change in RNA accessibility in the 5’ UTR as compared to other regions, and that the regions of structural changes align with the sites of Ded1 binding [20]. These results collectively indicate that Ded1 facilitates translation initiation through unwinding of mRNA structures in 5’ UTRs. This paradigm illustrates that combination of structural probing with other genome-wide methods provides rich information on the enzymatic targets and molecular mechanisms of DEAD-box helicases inside cells. Our lab used DMS to map RNA structures in wild type and dbp2Δ to pinpoint DBP2-dependent changes [33]. The regions of DBP2-dependent structural alteration were also well correlated with Dbp2-binding sites identified and aligned well just upstream of annotated polyadenylation sites. This provided a putative model for how a DEAD-box protein may remodel RNA/RNP structures transcriptome wide in vivo. Here, we describe the method for probing Dbp2-dependent RNA structural changes using DMS-seq in S. cerevisiae. This protocol is largely based on the development of this technique, [34] with additional optimizations to decrease undesired, self-ligated primers. This method can be further extended to studies of other RNA helicase targets in intact cells.

2. Materials

2.1. DMS treatment of yeast cells

  1. YP liquid medium: dissolve 10 g of yeast extract and 20 g of peptone in 900 mL of nuclease-free water and autoclave.

  2. 20% Glucose solution: dissolve glucose powders in nuclease free-water, and autoclave the solution.

  3. Wild type (BY4741) strain: MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 (Open Biosystems).

  4. dbp2Δ strain: MATa dbp2::KanMx6 his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 [35].

  5. UV-VIS spectrometer.

  6. Dimethyl sulfate (DMS).

  7. 2-Mercaptoethonal (BME).

  8. Isoamyl alcohol.

  9. Centrifuge.

  10. AE buffer: 50 mM sodium acetate (NaOAc, pH 5.2), 10 mM ETDA.

2.2.1. Purification and DNase treatment of total RNAs

  1. Acid phenol/chloroform (5:1, pH 4.5).

  2. Chloroform/isoamyl alcohol (24:1) solution.

  3. Ethanol.

  4. 0.3 M NaOAc in nuclease-free water, pH 5.2.

  5. Refrigerated microcentrifuge.

  6. Nanodrop.

  7. TURBO DNase, 2 U/μL (Thermo Fisher Scientific.)

  8. Glycogen (20 mg/mL), RNA grade (Thermo Fisher Scientific).

  9. 70% ethanol: mix 7 mL of ethanol with 3 mL of nuclease-free water.

2.2.2. Primer extension and denaturing polyacrylamide gel electrophoresis (PAGE)

  1. Fluorescent 5.8S rRNA primer: 5’- /56FAM/AAATGACGCTCAAACAGGCATG -3’

  2. Deoxynucleotide (dNTP) solution mix, 10 mM.

  3. Dideoxynucleotide, a set of ddATP, ddTTP, ddCTP, and ddGTP at 5 mM each (Amersham)

  4. SuperScript III Reverse Transcriptase, 200 U/μL (Thermo Fisher Scientific).

  5. Digital dry bath or water bath.

  6. 2N NaOH.

  7. 2N HCl.

  8. Formamide (> 99.5%).

  9. Urea (powder).

  10. 12.5X TTE buffer: dissolve 108 g of Tris base, 36 g of taurine, and 2 g of EDTA in 1 L of nuclease-free water.

  11. 40% acrylamide (19:1).

  12. 10% ammonium persulfate: dissolve 100 mg of ammonium persulfate in 1 mL of nuclease-free water.

  13. Tetramethylethylenediamine (TEMED).

  14. Polyacrylamide gel electrophoresis (PAGE) apparatus.

  15. Fluorescence gel imager.

2.3. Purification of polyadenylated RNAs and generation of cDNAs

  1. Poly(A)Purist MAG Kit (Thermo Fisher Scientific).

  2. RNase H (2 U/μL).

  3. Phenol (pH 8.0).

  4. Random hexamer fused with Illumina TruSeq adapter: 5’- CAGACGTGTGCTCTTCCGATCTNNNNNN-3’.

  5. TEN buffer (pH 7.5): 10 mM Tris base, 1 mM EDTA, 250 mM NaCl.

  6. ssDNA linker: 5’-/5Phos/NNNAGATCGGAAGAGCGTCGTGTAG/3SpC3/-3’ (Integrated DNA Technology).

  7. CircLigase ssDNA ligase reaction kit (Epicentre).

2.4. PCR amplification and validation of cDNA libraries

  1. PCR thermal cycler.

  2. TaKaRa Ex Taq DNA Polymerase (Clonetech).

  3. Illumina TruSeq primers (bolded letters are barcodes for multiplexed libraries):
    Illumina TruSeq forward primer 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’
    Illumina TruSeq reverse primer_index 1 5’-CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’
    Illumina TruSeq reverse primer_index 2 5’-CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’
    Illumina TruSeq reverse primer_index 3 5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’
    Open in a new tab

  4. TOPO TA cloning kit for sequencing (Thermo Fisher Scientific).

  5. Wizard Plus Minipreps DNA Purification System (Promega).

3. Methods

3.1. Optimization of DMS modification in yeast cells

3.1.1. DMS treatment

  1. For each condition being tested, grow 50 mL of wild-type and dbp2Δ yeast cells in YP with 2% glucose at 30 °C to an OD 600 nm of 0.5~0.7. Prepare one additional culture for the negative (no DMS) and sequencing controls.

  2. Add DMS to the liquid culture to a final concentration of 10 mM (Note 1). Do not add DMS in the control culture.

  3. Incubate cells for 5, 10, or 15 min at 30 °C with vigorous shaking (Note 2).

  4. Quench the reaction with 75 mL of 4.8 M BME and 25 mL of isoamyl alcohol (Note 3).

  5. Harvest the cells by centrifugation at 3500 rpm for 5 min and remove the supernatant.

  6. Wash cell pellets with 10 mL of 4.8 M BME, harvest the cells by centrifugation at 3500 rpm for 5 min, and remove the supernatant.

  7. Wash cell pellets again with 20 mL of AE buffer, harvest the cells by centrifugation at 3500 rpm for 5 min, and remove the supernatant.

3.1.2. Purification and DNase treatment of total RNAs

  1. Resuspend cells in 400 μL of AE buffer and add 40 μL of 10% SDS and 400 μL of acid phenol/chloroform (5:1).

  2. Vortex the mixture and place at 65 °C. Vortex samples once a minute.

  3. Incubate samples on ice for 5 min.

  4. Centrifuge samples at 13,000 rpm for 5 min and move the aqueous (top) layer to new tubes.

  5. Add 300 μL of chloroform/isoamyl alcohol (24:1) and mix thoroughly. Repeat step 4.

  6. Precipitate the RNAs by adding approximately 1 mL ethanol and 50 μL of 3 M sodium acetate and incubate at −80 °C for at least 30 min.

  7. Centrifuge at 13,000 rpm for 15 min at 4 °C and discard the supernatant.

  8. Wash the RNA pallet with 500 μL of 70% ethanol. Make sure the pellet is fully suspended to remove excess salt (Note 4). After suspension, add 1 μL of glycogen (20 mg/mL) and place samples in −80 °C for at least 15 min to precipitate.

  9. Centrifuge samples at 13,000 rpm for 15 min at 4 °C, and discard the supernatant. Dry samples at room temperature.

  10. Re-suspend the purified RNAs in nuclease-free water and measure the RNA concentration using a Nanodrop or other UV-VIS spectrometer at 260 nm. At least 30 μg of RNA will be needed for the following step.

  11. Set up a 150 μL DNase reaction as follows:
    Component Volume (μL) Final quantity
    Purified total RNAs ? 30 μg
    10X reaction buffer 15 1X
    TURBO DNase 3 6 U
    Nuclease-free water ? Up to 150 μL
    Open in a new tab

  12. Incubate the samples at 37 °C for 30 min.

  13. Purify the DNase-treated RNAs by adding 150 μL acid phenol/chloroform (5:1) and repeat step 4 – 9 in this section, with addition of 1 μL glycogen (20 mg/mL) during precipitation.

  14. Re-suspend RNAs in nuclease-free water and measure the RNA concentration after DNase digestion with a Nanodrop or other UV-VIS spectrometer at 260 nm. At least 20 μg of RNA will be needed for the following steps.

3.1.3. Primer extension

  1. Set up reverse transcription reactions on ice as follows:
    Component Volume (μL) Final quantity
    DNase treated RNAs ? 20 μg
    2 μM fluorescent 5.8S rRNA primer 1 2 pmol
    dNTP mix, 10 mM 1 1 mM
    Nuclease-free water ? Up to 12 μL
    Open in a new tab

  2. Incubate the reaction mixture at 65 °C for 5 min and then place the tube on ice for at least 1 min.

  3. Add the following materials to the reaction mix for sequencing controls (Note 5):
    Component Volume (μL) Final concentration
    5X First Strand buffer 4 1X
    DTT (0.1 M) 1 5 mM
    ddT or ddG (5 mM) 1 0.25 mM
    SUPERase-In (20 U/μL) 1 1 U/μL
    SuperScript III Reverse Transcriptase (200 U/μL) 1 10 U/μL
    Open in a new tab
  4. Add the following materials to other samples (Note 6):
    Component Volume (μL) Final concentration
    5X First Strand buffer 4 1X
    DTT (0.1 M) 1 5 mM
    Nuclease-free water 1 N/A
    SUPERase-In (20 U/μL) 1 1 U/μL
    SuperScript III Reverse Transcriptase (200 U/μL) 1 10 U/μL
    Open in a new tab

  5. Incubate the samples at 25 °C for 10 min, and then 50 °C for 50 min.

  6. Stop the reaction and degrade RNAs by adding 4 μL of 2N NaOH and then incubate samples at 95 °C for 3 min.

  7. Neutralize the solutions by adding 4 μL of 2N HCl.

  8. Precipitate, wash, and dry the cDNAs as described in step 6 – 9 in section 3.1.2, ensuring inclusion of 1 μL of glycogen (20 mg/mL) during precipitation.

3.1.4. Visualization of primer extension products

  1. Re-suspend cDNAs in 12 μL of denaturing gel loading buffer (90% formamide in 0.5X TTE) (Note 7).

  2. Resolve primer extension products using denaturing polyacrylamide gel electrophoresis (PAGE). To prepare 50 mL of 8% gel solution, mix the following materials (Note 8).
    Component Quantity
    Urea 21 g
    40% acrylamide (19:1) 10 mL
    12.5X TTE buffer 4 mL
    Nuclease-free water Up to 50 mL
    10% ammonium persulfate 500 μL
    TEMED 50 μL
    Open in a new tab

  3. Visualize cDNAs in the gel using gel imaging system to detect the fluorescence signal (Figure 1).

  4. For each lane, quantify the fully extended product at the top of the gel image, and compare the signal to the signal of the whole lane (including DMS modification bands and the fully extended product). If the DMS treatment is optimized for single-hit kinetics, the quantity of the full-length product should be ~75% of all the cDNAs generated [34]. Single-hit kinetics are optimal to minimize chance that a structural change induced by a modification elsewhere in the RNA.

Figure 1.

Figure 1.

Open in a new tab

Primer extension products of DMS modified RNAs. The first lane contains only the fluorescent primer, indicating the start point of primer extension. The intense signal at the top in the rest of the image represents the fully extended product. The “A” and “C” lanes are sequencing controls with ddTTP or ddGTP in the primer extension reaction (lane 2 – 3). The positions of bands in these two lanes correspond to the adenine and cytosine in the probed sequence. In the no-DMS control (lane 4), some weak bands are detected in addition to the full-length product are likely generated due to random fall-off of the reverse transcriptase or stops dues structural regions. Unlabeled arrows on the right side indicate positions of DMS-induced stops.

3.2. Purification of polyadenylated RNAs

  1. Use total RNAs purified from the optimal DMS treatment condition to prepare RNA solutions with a final concentration of 600 μg/mL in nuclease-free water. The total amount of RNA used for the following step should be at least 300 μg.

  2. Perform poly(A) selection using the Poly(A)Purist MAG Kit according to the manufacturer’s manual. The amount of recovered RNAs is expected to be 1~2% of the input total RNAs from exponentially growing S. cerevisiae.

  3. After poly(A) selection, measure the RNA concentration using Nanodrop to ensure appropriate recovery.

3.3. DNase Treatment

  1. Treat 3 μg of poly(A) RNAs with Turbo DNase. Each reaction includes 1 μL (2 Unites) of Turbo DNase, 3 μL of 10X Reaction buffer, 3 μg of poly(A) RNAs, and nuclease-free water up to 30 μL.

  2. Incubate the samples at 37 °C for 30 min.

  3. Purify the DNase-treated RNAs by adding 100 μL acid phenol/chloroform (5:1) and repeat step 4 – 7 in section 3.1.2, with addition of 1 μL glycogen (20 mg/mL) during precipitation.

  4. Wash the RNA pallet with 70% Ethanol. Centrifuge samples at 13,000 rpm for 15 min at 4 °C, and discard the supernatant. Dry samples at room temperature.

  5. Re-suspend RNAs in nuclease-free water. Measure the RNA concentration using Nanodrop.

3.4. Generation of cDNA

  1. Set up a 12-μL reverse transcription mix with the following materials:
    Component Volume (μL) Final quantity
    DNase-treated poly(A) RNAs ? 2 μg
    Random hexamer fused with Illumina TruSeq adapter, 100 μM 1 10 μM
    dNTP mix, 10 mM 1 1 mM
    Nuclease-free water ? Up to 12 μL
    Open in a new tab

  2. Incubate the reaction mixture at 65 °C for 5 min and place the tube on ice afterwards for at least 1 min.

  3. Add the following materials to the reaction mix:
    Component Volume (μL) Final concentration
    5X First Strand buffer 4 1X
    DTT, 0.1 M 2 0.01 M
    SUPERase-In (20 U/μL) 1 1 U/μL
    SuperScript III Reverse Transcriptase (200 U/μL) 1 10/μL
    Open in a new tab

  4. Incubate the samples at 25 °C for 10 min and then 50 °C for 50 min.

  5. Stop the reaction by heating the samples at 85 °C for 5 min. Chill the tubes on ice.

  6. Add 1 μL of RNase H (2 U/μL) to each sample to degrade RNAs, and incubate the reactions at 37 °C for 20 min.

  7. Purify cDNAs by adding 100 μL of phenol (pH 8.0) and repeat step 4 – 9 in section 3.1.2, with addition of 1 μL glycogen (20 mg/mL) during precipitation.

  8. Re-suspend cDNAs in 10 μL of denaturing gel loading buffer, and resolve by running electrophoresis of 8% denaturing polyacrylamide gel as described in section 3.1.4, step 2.

  9. Visualize cDNAs by staining with SYBR Gold for 20 min at room temperature. Excise bands with a razor blade and collect gel pieces containing cDNA fragments larger than 40 nt (Figure 2A).

  10. Crush the gel pieces by ejecting through a syringe and soak the gel pieces in TEN buffer at 4 °C overnight to elute cDNAs. Collect the elution solution and purify cDNAs by ethanol precipitation as described in section 3.3, step 3 – 4.

Figure 2.

Figure 2.

Open in a new tab

PAGE image of DNA fragments after reverse transcription (A) and ssDNA linker ligation (B). The two samples (lane 2 – 3) shown are from two biological replicates of wild type after DMS treatment. Bands pointed by arrows indicate positions of undesired, excess primers (A) or the ligation product of RT primer and ssDNA linker (B).

3.5. ssDNA linker ligation

  1. Re-suspend the gel-purified cDNA in 14 μL of nuclease-free water.

  2. Prepare the ligation reaction as the following:
    Component Volume (μL) Final quantity
    cDNA 14 μL ?
    ssDNA linker, 100 μM 1 5 μM
    CircLigase reaction buffer, 10X 2 1X
    ATP, 1 mM 1 0.05 mM
    MnCl2, 50 mM 1 2.5 mM
    CircLigase ssDNA ligase (100 U/μL) 1 5 U/μL
    Open in a new tab

  3. Incubate samples at 65 °C overnight (for at least 12 hr), and then deactivate CircLigase by heating samples at 85 °C for 15 min.

  4. Purify ligated cDNAs by phenol (pH 8.0) and chloroform/isoamyl alcohol (24:1), followed by ethanol precipitation as described in section 3.3, step 4 – 5.

  5. Re-suspend cDNAs in 10 μL of denaturing gel loading buffer, and resolve by running electrophoresis of 8% denaturing polyacrylamide gel as described in section 3.1.4, step 2.

  6. Visualize cDNAs by staining with SYBR Gold for 20 min at room temperature. Excise bands with a razor blade and collect gel pieces containing cDNA fragments larger than 60 nt (Figure 2B).

  7. Recover ligated cDNAs as described in step 10 of section 3.4.

3.6. PCR amplification of cDNA libraries

  1. Re-suspend the ligated, size-selected cDNA in 10 μL of nuclease-free water.

  2. Set up a PCR reaction as below:
    Component Volume (μL) Final quantity
    Ligated cDNA (or water for primer-dimer control) 5 μL ?
    dNTP mixture, 2.5 mM (provided with Takara Ex Taq) 2 0.2 mM
    Ex Taq buffer, 10X 2.5 1X
    Illumina TruSeq forward primer (5 μM) 1 0.2 μM
    Illumina TruSeq reverse primer (5 μM) 1 0.2 μM
    TaKaRa Ex Taq (50 U/μL) 0.5 0.1 U/μL
    Nuclease-free water 13 13 μL
    Open in a new tab
  3. Amplify the cDNAs by PCR using the following conditions (Note 9).
    Step Temperature Time Number of cycles
    Initial denaturation 98 °C 1 min 1
    Denaturation 98 °C 10 sec 10 – 35
    Annealing 55 °C 30 sec
    Extension 72 °C 1 min
    Final extension 72 °C 10 min 1
    Incubation 4 °C 2 min 1
    Open in a new tab

  4. Resolve PCR products by PAGE (Note 10), and collect fragments larger than 150 bp as described in section 3.4, step 8 – 10. Re-suspend purified libraries in 20 μL of nuclease-free water.

3.7. Validation of libraries

  1. Perform cloning of size-selected PCR products using TOPO TA cloning kit for sequencing according to the manufacture’s instruction.

  2. Extract plasmid DNA from at least 5 colonies for each library using Wizard Plus Miniprep DNA Purification System, and sequence the inserted fragments. The inserted sequence should contain the sequence corresponding to the transcriptome of interest (excluding ribosomal DNA).

  3. Examine the library size distribution using an Agilent Bioanalyzer. The library should not contain products below 150 bp, which represent undesired primer-dimers.

  4. Quantify libraries by qPCR to determine the appropriate amount for pooling libraries in the following sequencing runs.

  5. Perform sequencing on an Illumina Hiseq 2500 platform for 2 × 100 bp paired-end cycle run (Note 11). In our experiment, we pooled three barcoded libraries to run in a single lane of a Hiseq flow cell.

3.8. Bioinformatics analysis of the sequencing data

The bioinformatics processing steps and calculations are detailed elsewhere [36]. Examples of the normalized DMS reactivity and the difference in wild type and dbp2Δ are shown in Figure 3.

Figure 3.

Figure 3.

Open in a new tab

Normalized DMS reactivity in wild type and dbp2Δ at 3’ ends of selected transcripts (A – C). Decreased reactivity indicates that the nucleotides are less protected by RNA/PNP structures and vice versa. The change dependent on DBP2 is further visualized by subtracting the reactivity value in wild type from the value in dbp2Δ (bottom panel). This is reproduced from [33], with permission from Genetics.

4. Notes

  1. DMS is highly toxic. You must wear gloves and use a fume hood for all steps involving DMS.

  2. In addition to the length of treatment time, DMS concentration can also be varied and tested to the obtain optimal reactivity conditions.

  3. Both BME and isoamyl alcohol have strong smells and the mixed solution can leak from tube caps during centrifugation. Perform these steps in fume hoods and seal the lid of centrifuge tubes carefully with parafilm.

  4. If the DNA pellet is not fully washed, retained salt can lead to poor resolution and distorted gel images. In addition, excess salt will also reduce the efficiency of poly(A) selection in section 3.2.

  5. The ratio between dNTP and ddTTP (or ddGTP) may need to be optimized to detect and clearly visualize most of the adenines (or cytosines) in the sequence [37].

  6. If multiple reactions are performed, a master mix can be made and aliquoted to sample tubes from the last step. This will reduce the handling time and chance of RNase contamination in the reagents and samples.

  7. Do not add dye in the loading buffer, as it will impact the fluorescence signal for gel imaging. To track the positions of DNA fragments during electrophoresis, load 10-bp DNA ladders mixed with gel loading dye (0.25% bromophenol blue, 0.25 % xylene cyanol FF in 90% formamide) in an empty well. Loading of un-extended fluorescent primer in an empty lane also helps to identify the start of the sequence.

  8. For gel running, TTE is used instead of the typical Tris-borate EDTA (TBE) buffer to increase resolution. TTE gives sharper bands than TBE [38].

  9. The number of amplification cycles may need to be optimized and products may need to be visualized on a gel. The final concentration of libraries may be insufficient for downstream analysis and sequencing with too few cycles of amplification, whereas excess amplification can lead to production of undesired, non-specific bands.

  10. In addition to amplified libraries, load the non-templated primer-dimer control for PAGE analysis to pinpoint the sizes of potential non-specific products.

  11. Paired-end sequencing is recommended, as it will provide comprehensive coverage information for each nucleotide in the downstream bioinformatics analysis.

Acknowledgements

We thank Dr. Yiliang Ding (John Innes Centre) for help in protocol optimization and construction of sequencing libraries. We also thank Dr. Sharon Aviran (UC Davis) for discussion on experimental design that was critical for downstream bioinformatic analysis and for conducting bioinformatics necessary to visualize significant reactivity change genome wide. This work was supported by NIH R01GM097332 to E.J.T., P30CA023168 for core facilities at the Purdue University Center for Cancer Research.

5 References

  • 1.Schroeder R, Barta A, Semrad K (2004) Strategies for RNA folding and assembly. Nat Rev Mol Cell Biol 5:908–919. 10.1038/nrm1497 [DOI] [PubMed] [Google Scholar]
  • 2.Doetsch M, Schroeder R, Fürtig B (2011) Transient RNA-protein interactions in RNA folding. FEBS J. 278:1634–1642 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Rouskin S, Zubradt M, Washietl S, et al. (2014) Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo. Nature 505:701–5. 10.1038/nature12894 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Fairman-Williams ME, Guenther UP, Jankowsky E (2010) SF1 and SF2 helicases: Family matters. Curr. Opin. Struct. Biol 20:313–324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Russell R, Jarmoskaite I, Lambowitz AM (2013) Toward a molecular understanding of RNA remodeling by DEAD-box proteins. RNA Biol 10:44–55. 10.4161/rna.22210 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Rudolph MG, Klostermeier D (2015) When core competence is not enough: Functional interplay of the DEAD-box helicase core with ancillary domains and auxiliary factors in RNA binding and unwinding. Biol. Chem 396:849–865 [DOI] [PubMed] [Google Scholar]
  • 7.Jarmoskaite I, Russell R (2014) RNA Helicase Proteins as Chaperones and Remodelers. Annu Rev Biochem 83:697–725. 10.1146/annurev-biochem-060713-035546 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Fuller-Pace FV (2013) DEAD box RNA helicase functions in cancer. RNA Biol 10:121–132. 10.4161/rna.23312 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Steimer L, Klostermeier D (2012) RNA helicases in infection and disease. RNA Biol. 9:751–771 [DOI] [PubMed] [Google Scholar]
  • 10.Putnam AA, Jankowsky E (2013) DEAD-box helicases as integrators of RNA, nucleotide and protein binding. Biochim. Biophys. Acta - Gene Regul. Mech 1829:884–893 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Halls C, Mohr S, Del Campo M, et al. (2007) Involvement of DEAD-box Proteins in Group I and Group II Intron Splicing. Biochemical Characterization of Mss116p, ATP Hydrolysis-dependent and -independent Mechanisms, and General RNA Chaperone Activity. J Mol Biol 365:835–855. 10.1016/j.jmb.2006.09.083 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Liebeg A, Mayer O, Waldsich C (2010) DEAD-box protein facilitated RNA folding in vivo. Rna Biol 7:803–811. 10.4161/rna.7.6.13484 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ruminski DJ, Watson PY, Mahen EM, Fedor MJ (2016) A DEAD-box RNA helicase promotes thermodynamic equilibration of kinetically trapped RNA structures in vivo. RNA 22:416–427. 10.1261/rna.055178.115 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Potratz JP, Del Campo M, Wolf RZ, et al. (2011) ATP-dependent roles of the DEAD-box protein Mss116p in group II intron splicing in vitro and in vivo. J Mol Biol 411:661–679. 10.1016/j.jmb.2011.05.047 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dardenne E, PolayEspinoza M, Fattet L, et al. (2014) RNA Helicases DDX5 and DDX17 Dynamically Orchestrate Transcription, miRNA, and Splicing Programs in Cell Differentiation. Cell Rep 7:1900–1913. 10.1016/j.celrep.2014.05.010 [DOI] [PubMed] [Google Scholar]
  • 16.Kar A, Fushimi K, Zhou X, et al. (2011) RNA helicase p68 (DDX5) regulates tau exon 10 splicing by modulating a stem-loop structure at the 5’ splice site. Mol Cell Biol 31:1812–1821. 10.1128/MCB.01149-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Moy RH, Cole BS, Yasunaga A, et al. (2014) Stem-loop recognition by DDX17 facilitates miRNA processing and antiviral defense. Cell 158:764–777. 10.1016/j.cell.2014.06.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Svitkin YV, Pause A, Haghighat A, et al. (2001) The requirement for eukaryotic initiation factor 4A (elF4A) in translation is in direct proportion to the degree of mRNA 5′ secondary structure. RNA 7:382–394. 10.1017/S135583820100108X [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Soto-Rifo R, Rubilar PS, Limousin T, et al. (2012) DEAD-box protein DDX3 associates with eIF4F to promote translation of selected mRNAs. EMBO J 31:3745–3756. 10.1038/emboj.2012.220 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Guenther UP, Weinberg DE, Zubradt MM, et al. (2018) The helicase Ded1p controls use of near-cognate translation initiation codons in 5′ UTRs. Nature 559:130–134. 10.1038/s41586-018-0258-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ding Y, Tang Y, Kwok CK, et al. (2014) In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features. Nature 505:696–700. 10.1038/nature12756 [DOI] [PubMed] [Google Scholar]
  • 22.Wan Y, Qu K, Zhang QC, et al. (2014) Landscape and variation of RNA secondary structure across the human transcriptome. Nature 505:706–709. 10.1038/nature12946 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Talkish J, May G, Lin Y, et al. (2014) Mod-seq: High-throughput sequencing for chemical probing of RNA structure. RNA 20:713–720. 10.1261/rna.042218.113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ding Y, Kwok CK, Tang Y, et al. (2015) Genome-wide profiling of in vivo RNA structure at single-nucleotide resolution using structure-seq. Nat Protoc 10:1050–1066. 10.1038/nprot.2015.064 [DOI] [PubMed] [Google Scholar]
  • 25.Zubradt M, Gupta P, Persad S, et al. (2016) DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo. Nat Methods 14:75–82. 10.1038/nmeth.4057 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ritchey LE, Su Z, Tang Y, et al. (2017) Structure-seq2: sensitive and accurate genome-wide profiling of RNA structure in vivo. Nucleic Acids Res 45:e135. 10.1093/nar/gkx533 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Smola MJ, Weeks KM (2018) In-cell RNA structure probing with SHAPE-MaP. Nat Protoc 13:1181–1195. 10.1038/nprot.2018.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Bevilacqua PC, Ritchey LE, Su Z, Assmann SM (2016) Genome-Wide Analysis of RNA Secondary Structure. Annu Rev Genet 50:235–266. 10.1146/annurev-genet-120215-035034 [DOI] [PubMed] [Google Scholar]
  • 29.Inoue T, Cech TR (1985) Secondary structure of the circular form of the Tetrahymena rRNA intervening sequence: a technique for RNA structure analysis using chemical probes and reverse transcriptase. Proc Natl Acad Sci 82:648–652. 10.1073/pnas.82.3.648 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Klinz FJ, Gallwitz D (1985) Size and position of intervening sequences are critical for the splicing efficiency of pre-mRNA in the yeast Saccharomyces cerevisiae. Nucleic Acids Res 13:3791–3804. 10.1093/nar/13.11.3791 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wells SE, Hughes JMX, Haller Igel A, Ares MBT-M in E (2000) Use of dimethyl sulfate to probe RNA structure in vivo. In: RNA-Ligand Interactions Part B. Academic Press, pp 479–493 [DOI] [PubMed] [Google Scholar]
  • 32.Wilkinson KA, Merino EJ, Weeks KM (2006) Quantitative RNA structure analysis at single nucleotide resolution. Nat Protoc 1:1610–1616 [DOI] [PubMed] [Google Scholar]
  • 33.Lai Y-H, Choudhary K, Cloutier SC, et al. (2019) Genome-Wide Discovery of DEAD-Box RNA Helicase Targets Reveals RNA Structural Remodeling in Transcription Termination. Genetics genetics.302058.2019. 10.1534/genetics.119.302058 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ding Y, Kwok CK, Tang Y, et al. (2015) Genome-wide profiling of in vivo RNA structure at single-nucleotide resolution using structure-seq. Nat Protoc 10:1050–1066. 10.1038/nprot.2015.064 [DOI] [PubMed] [Google Scholar]
  • 35.Cloutier SC, Ma WK, Nguyen LT, Tran EJ (2012) The DEAD-box RNA helicase Dbp2 connects RNA quality control with repression of aberrant transcription. J Biol Chem 287:26155–26166. 10.1074/jbc.M112.383075 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Choudhary K, Lai Y-H, Tran EJ, Aviran S (2019) dStruct: identifying differentially reactive regions from RNA structurome profiling data. Genome Biol 20:. 10.1186/s13059-019-1641-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ruano G, Kidd KK (2006) Coupled amplification and sequencing of genomic DNA. Proc Natl Acad Sci 88:2815–2819. 10.1073/pnas.88.7.2815 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Tijerina P, Mohr S, Russell R (2007) DMS footprinting of structured RNAs and RNA-protein complexes. Nat Protoc 2:2608–2623. 10.1038/nprot.2007.380 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES