Histopathological, immunohistochemical, and molecular studies for determination of wound age and vitality in rats

Abstract

In forensic medicine, it is vital to verify with the best attainable accuracy once injuries occurred during vital or post‐mortem conditions. An immunohistochemical study was carried out to examine the time‐dependent expression of macrophage‐specific gene CD68 (cluster of differentiation 68), alpha‐smooth muscle actin (α‐SMA), and vascular endothelial growth factor (VEGF) in different skin wound timings (0, 1, 3, 5, 7, and 14 days) in rats. Histopathological studies were performed to assess the wound age and vitality. Eighteen male albino Wister rats (weighing 170‐200 g) were used for wound induction. Rats (n = 3) were euthanised at 0, 1, 3, 5, 7, and 14 days from the starting point of wound induction. Histopathological examination showed that the epidermal re‐epithelialisation was completed 14 days after skin incision. The inflammatory phase was recorded during the first 3 days of healing and reached the maximum levels at 5 days, then declined after 7 days, and completely removed at 14 days. The beginning of the proliferative phase was dated to day 3 and the peak at days 5 and 7. The initiation of the granulation tissue formation and remodelling phase of the healing process was observed 5 days after wounding. By immunohistochemical staining, negative VEGF gene expressions at early stages (0‐3 days) were observed, as well as neither CD68+ macrophages nor α‐SMA+ myofibroblast cells were detected. By increasing the wound ages (5‐7 days), granulation tissue and angiogenesis were observed, with the migration of macrophages and fibroblast, which expressed VEGF, CD68, and α‐SMA positive reaction. Time‐dependent expression of the above markers suggested that they would be useful indicators for the determination of wound age. Both VEGF and transforming growth factor‐beta 1 (TGFb1) mRNA levels were determined in different skin wound ages. The transcription of TGFb1 and VEGF increased shortly after wounding, until post‐wounding day 7. It then declined constantly, reaching minimal values on day 14.

1. INTRODUCTION

Until now, it has been difficult to determine wound timing in forensic medicine; however, it will contribute to the reconstruction of crime scenes and cause the arrest of a suspect.1 Forensic pathologists should establish the temporal order of injuries in cases involving multiple traumas by different offenders. In cases of killing, the major focus is on whether an injury was caused while the individual was alive or during the post‐mortem period and how long the victim survived after the wound was inflicted.2

The wound is defined as the morphologic functional disruption of the continuity of a tissue structure. Skin wound healing is considered a complicated and well‐organised biological response composed of three phases including inflammation, granulation tissue formation, and remodelling, which involve large numbers of regulatory molecules, like cytokines and growth factors.3 Dysregulation in cytokine or growth factor expression alters the normal wound healing process.4

These biological responses are collectively termed “vitality,” which is related to whether the victim was alive at the time of the trauma and how long before the death of the victim the trauma was inflicted.5 Wound vitality can be determined through morphological, cytological, and molecular biological techniques. A variety of biomarkers concerned in vital reactions reportedly increase the accuracy of wound‐age estimation.6

Currently, the wound age is a principal parameter in forensic investigations. It is essential to determine the time of wounds whether it occurred before or after death. It can be determined using immunohistochemical techniques, growth factors and cytokines.7 A variety of methods for estimation of the wound age have been established, such as routine histopathological examination, immunohistochemical staining, and reverse transcription polymerase chain reaction (RT‐PCR).6

In forensic pathology, immunohistochemistry is the method of choice because of its reliability and simple application in formalin‐fixed paraffin‐embedded tissue. Contrary to most techniques, this morphological technique permits the location of the substance of interest inside the tissue or cell substructures. Generally, throughout the first few minutes after the wound occurrence, the microscopic examinations cannot verify whether a wound was sustained before or after death. However, the mRNA levels of cytokines and enzymes typically change sooner than the protein levels and the histomorphology after wounding.8 So that, assays based on mRNA are appropriate for estimating the age of early‐stage wounds. Although RNA is less stable than protein, it has been detected in a long‐preserved sample.9 Total RNA of sufficient quality and quantity can be obtained from samples that are many months, even years, old.10 Thus, the mRNA levels of inflammatory cytokines and wound‐healing factors are measured using the real‐time PCR to determine the wound age. Because quantitative PCR (qPCR) is a highly sensitive technique to notice even slight changes in gene expression, it is important to be careful at every step including data analysis.11 Data normalisation by using reference genes may be a crucial step for accurate analysis to notice inevitable experimental variations, particularly disparities within the step of sample loading. The expression of some housekeeping genes is upregulated after an injury, and this is considered a critical problem.12 Thus, it is important to spot a stably expressed internal control for effective normalisation.

In the past, it was suggested that histological characteristics could classify a vital wound, but this method is unreliable and showed a high rate of negative cases.13 Recently, molecular pathology techniques14 and biological substances, such as vascular endothelial growth factor (VEGF) and transforming growth factor (TGF) and pro‐inflammatory cytokines such as interleukin (IL)1, IL6, and tumor necrosis factor have become useful markers for wound age determination.15

VEGF is an essential angiogenic factor in the formation of new granulation tissue in the case of wound healing, so it is used as a marker for wound age determination.16

TGFα and TGFb1 are the foremost promising markers in this cluster of molecules. Indeed, Grellner and Madea investigated their relevance for skin wound age estimation and observed upregulation of TGFb1 within several minutes after wounding, with a peak between 30 and 60 minutes.3

However, simultaneous detection of other markers, as a cluster of differentiation 68 (CD68), which is a transmembrane protein expressed on inflammatory cells, may be effective in the estimation of wound age.17 Closure of the wound is an essential process in healing of the wound. Myofibroblasts are recognised to play a central role in closing the wound tissue through alpha‐smooth muscle actin (α‐SMA). The α‐SMA plays important roles in many cellular processes, including cell division, cell motility, and the generation of contractile force.18

It is believed that there are many established parameters that yield this knowledge due to the non‐specificity, poor repeatability, and inadequate diagnostic performance of biomarkers besides the limitations of the techniques used. Therefore, systematic and specific criteria for distinguishing useful markers are required, and many advanced techniques ought to be applied to generate data with more accuracy and objectivity. Because the wound‐age estimation is intricate and elaborate downside, the use of a combination of several parameters could minimise the faults in the wound‐age estimation.

In the current study, histopathological as well as histomorphometric studies were performed to determine the wound age at different times as well as to differentiate between vital and non‐vital wound. Immunohistochemical examinations were used to evaluate CD68, α‐SMA, and VEGF gene expressions in rat skin wounds at different ages, and discuss the practical availability of the above genes as markers for wound age determination. Also, the m‐RNA levels of VEGF and TGFb1 genes were performed for identification of such markers used for estimating wound age. From our point of view, this is the first study focused on the determination of wound vitality in addition to the timing of both vital and non‐vital wound at a long period of time using histopathological and immunohistochemical studies as well as mRNA gene analysis.

2. MATERIALS AND METHODS

2.1. Ethical considerations

All procedures were conducted according to the protocol approved by the Institutional Animal Care and Use Committee at Cairo University (IACUC, CU‐II‐F‐18‐19), Cairo, Egypt.

2.2. Animals

Eighteen male Wister rats (weighing 170‐200 g) were obtained from Holding Company for Biological Products and Vaccines (VACSERA), Helwan, Egypt. All animals were housed in plastic cages (three rats per cage) in a well‐ventilated environment and received a daily illumination of 16 hours of light. They were fed on dry commercial standard pellets and gained access to tap water ad libitum throughout the experimental period. They were acclimatised to the environment for 2 weeks prior to the onset of the experiment use to ensure their healthy state.

2.3. Induction of wound

Prior to wound induction, rats were anaesthetised with intramuscular injections of xylazine 10 mg/kg and ketamine 90 mg/kg. The area was marked with a pencil to determine wound margins and then shaved with an electric clipper at the dorsal back of the animal.19 Full‐thickness (extending up to adipose tissue) circular wounds (2 cm² × 2 cm²) was created using a sterile biopsy punch. Wounds were left open without treatment for 14 days. Rats (n = 3) were euthanised at 0, 1, 3, 5, 7, and 14 days from the starting point of wound induction. To evaluate the impact of post‐mortem degeneration, skin wound excision was performed at 1, 3, 5, and 7 days after the rats were euthanised to compare between vital and post‐mortem wound.

2.4. Sampling

At the euthanisation time, skin wound specimen was collected and preserved in 10% neutral buffer formalin (pH 7.0) for further histopathological and immunohistochemical studies, while others were preserved in liquid nitrogen for RNA extraction and RT‐PCR gene expression.

2.5. RNA isolation and qRT‐PCR

Each sample was homogenised using liquid nitrogen, and the total RNA was extracted using the Qiagen RNeasy Mini Kit according to the manufacturer's instructions. Both the concentration and purity of the isolated RNA were tested by NanoDrop.20 The RT‐PCR was performed using the RevertAid First Strand cDNA Synthesis Kit according to the guidelines. Quantitative real‐time PCR (qRT‐PCR) was performed using the Luminaries Color HiGreen Low ROX qPCR Master kit (Thermo Scientific, K0371) 21 according to the manufacturer's protocol. All values were normalised to the level of GAPDH22 mRNA. The primers for VEGF1 were designed using the Primer3 software; sense primer 5′‐GCAATGATGAAGCCCTGGAG‐3′ and antisense 5′‐GCTTGTCACATACGCTCCAG‐3′ and the transforming growth factor‐beta 1 (TGF‐β1) primer sequences were as follows: 5′‐CACTCCCGTGGCTTCTAGTG‐3′ and 5′‐GGACTGGCGAGCCTTAGTTT‐3′. The cDNA was amplified by 40 cycles of denaturation at 95°C for 45 seconds, annealing at 57°C for 45 seconds and extending at 72°C for 45 seconds. Duplicate plates were tested, and the cycle threshold (Ct) values were used to calculate the gene/GAPDH ratio, with a value of 1.0 used as the calibrator. The normalised expression ratio was calculated using ΔΔCt.23

2.6. Histopathological studies

Formalin‐fixed paraffin‐embedded wound tissue samples were cut into 4‐μm tissue sections. The sections were stained with haematoxylin and eosin (H&E) and Masson's trichrome for histopathological examination.24

The four‐point scoring system was used to evaluate the different stages of wound healing at a different time related to the wound age. Wound tissue sections were graded according to the following parameters: congestion, oedema, haemorrhage, inflammatory cell infiltration, fibroblast proliferation, re‐epithelialisation, angiogenesis, and collagen deposition.25 The above parameters were categorised as follows: (−) = normal histology (no alterations), (+) = <25% (mild alterations), (++) = 25%:50% (moderate), and (+++) >50% (severe).

2.7. Immunohistochemical studies

Formalin‐fixed paraffin‐embedded tissues were cut into 4‐μm tissue sections. The deparaffinised and dehydrated slides were quenched in 3% hydrogen peroxide to neutralise endogenous peroxidase activity, then washed in PBS‐T, and blocked in 1% bovine serum albumin. Slides were incubated with primary antibody against vascular endothelial growth factor VEGF or CD68 or α‐SMA (Abcam) at 1:400 dilutions overnight at 4°C. The slides were washed and incubated with biotinylated‐conjugated goat antimouse IgG antibody (Abcam) at 1:400 dilutions for 1 hour at room temperature. Slides were washed and immediately treated with diamino benzidine (DAB) chromogenic substrate for 5 minutes, then counterstained in haematoxylin, and rinsed in deionised water. Slides were then rehydrated in alcohol and xylene, dried, and mounted on a distyrene plasticizer xylene (DPX) mounting medium and then examined under a light microscope to evaluate the severity of gene expressions.

2.8. Statistical analysis

The results are expressed as the mean ± SD. Continuous variables were analysed with one‐way analysis of variance (ANOVA), followed by the Bonferroni post hoc test. A P‐value of <.05 was considered statistically significant. Data were analysed in SPSS 22.0.

3. RESULTS

3.1. Histopathological examination for the vital wound

The histopathological examination of skin tissue sections at day 0 did not exhibit any inflammatory reaction (Figure 1A), only there was ulceration of the epidermis associated with mild dermal oedema in the wound margins (Figure 1B). Masson trichrome stain contains normal dense thick collagen irregularly arranged at different directions (Figure 1C).

Figure 1.

Histopathological examinations of early skin wound in rats. A‐C, Rat skin wound at 0 day: A, complete epidermal ulceration (arrow) associated with necrosis of the full thickness of the dermal layer (star); B, mild dermal congestion (arrow); C, normal collagen fibre arrangement at the wound margin. D‐F, Rat skin wound at 1 day: D, epidermal ulceration (arrow) associated with hyalinosis of the dermal fibrous tissue (star); E, moderate dermal congestion (arrow), oedema, inflammatory cells' infiltrations (star); F, slightly stained collagen in a meshwork arrangement. G‐I, Rat skin wound at 3 day: G, severe necrotic dermatitis covered by crust (arrow) with complete epidermal loss as well as superficial dermal haemorrhage (star); H, severe dermal necrosis, congestion (arrow), haemorrhage, and inflammatory cells' infiltrations; I, slightly stained collagen in a network arrangement associated with severe dermal haemorrhage

Skin tissue sections at day 1 showed ulceration of the epidermis with coagulated necrosis to the full thickness of the dermis (Figure 1D) and the subcutaneous fat. Congestion, oedema, mild haemorrhage, and minimal inflammatory cells' infiltrations were noticed in the dermal layer (Figure 1E). Subcutaneous fat showed mild haemorrhage in addition to polymorph nuclear inflammatory cell infiltration. Masson's trichrome stain contains thin slightly stained collagen irregularly arranged at different directions (Figure 1F).

Skin tissue sections at day 3 showed severe necrotic dermatitis associated with loss of hair follicles, sweat, and sebaceous gland (Figure 1G). There were severe congestion, oedema, haemorrhage, inflammatory cells' infiltration mainly neutrophils, eosinophils, and macrophages (Figure 1H). Masson trichrome staining noticed the wound bed filled with prominent deposition of very thin collagen bundles arranged in a different direction in a meshwork pattern (Figure 1I). Subcutaneous fat showed severe congestion, haemorrhage, and inflammatory cells' infiltration.

Histopathological examinations of wound tissue sections at days 5 to 7 were similar and noticed evident inflammatory reactions including macrophages and lymphocytes associated with fibroblast proliferation and neovascularisation. Moderate to complete epidermal regeneration (re‐epithelialisation) was observed at the wound tips and margin (Figure 2A,D). Wound area was filled with granulation tissue ormed from macrophages, fibroblast, and new blood capillaries (Figure 2B,E). Immature collagen fibre detected by Masson trichrome stain exhibits a meshwork pattern at day 5 (Figure 2C). While prominent thin collagen fibres arranged in one direction parallel to the regenerated epidermis were detected at 7 days and both associated with the severe inflammatory reaction as well as haemorrhage (Figure 2F).

Figure 2.

Histopathological examinations of skin wound in rats at the late phase of healing (proliferation and remodelling). A‐C, Rat skin wound at 5 day: A, moderate epidermal regeneration (arrow) associated with fibroblast proliferation and neovascularisation filling the wounded area (star); B, dermal fibrogenesis (arrow) and neovascularisation (arrowhead) irregularly arranged to form granulation tissue associated with severe inflammation and haemorrhage (star); C, slightly stained thin immature collagen arranged irregularly. D‐F, Rat skin wound at 7 day: D, complete epidermal re‐epithelialisation (arrow) associated with dermal granulation tissue formation (star); E, dermal fibroblast proliferation regularly arranged parallel to the regenerated epidermis and perpendicular to the angioblast (arrow head) forming organised tissue, noticed haemorrhage (star); F, mature collagen fibre (star) arranged parallel to the regenerated epidermis. G‐I, Rat skin wound at 14 day: G, full epidermal re‐epithelialisation (arrow) in addition to organised tissue formation in the underline dermis; H, mature organised tissue formation (arrow) and neither inflammation nor neovascularisation was observed; I, dense thick mature collagen regularly arranged parallel to the regenerated epidermis (star)

At 14 days, skin wound sections showing full re‐epithelialisation and some of the mature collagen fibres still remained at the centre without inflammatory reactions (Figure 2G,H). Mature collagen fibres at the wound bed stained blue by Masson's trichrome without any inflammatory reactions (Figure 2I).

3.2. Histopathological examinations for the non‐vital wound

Microscopic picture of non‐vital skin wound tissue sections at day 0 showed autolysis, oedema, and congestion (Figure 3A). At 1 and 3 days old, non‐vital wound tissue sections showed moderate to severe autolysis, oedema, bleeding, and fibrin deposition in the dermal layer (Figure 3C,D). Blood vessels were filled with haemolysis blood (Figure 3B) without any inflammatory cells' infiltration. At 5 and 7 days old, non‐vital wound tissue sections showed extensive autolysis (Figure 3E) with mild‐to‐moderate loss (Figure 3F) of the tissue in the wound areas. The data are summarised in Table 1.

Figure 3.

Microscopic examination of the non‐vital wound in rats. A, At 0 day showing complete epidermal loss associated with post‐mortem autolysis, congestion (arrows) of the dermal layer (star). B,C, At 1 day old showing B, dermal congestion (arrows) and C, post‐mortem bleeding (arrows). D, At 3 days old showing moderate dermal autolysis and oedema (star). E, At 5 days old showing severe dermal autolysis. F, At 7 days old showing severe dermal autolysis with loss of some parts without healing (star)

Table 1.

Semiquantitative analysis of microscopic picture of wound tissue sections of different ages for assessment of wound aging

	0	1	3	5	7	14
Congestion	−	++	+++	+++	++	−
Oedema	+	++	+++	+	+	−
Haemorrhage	−	+	+++	+++	++	−
Inflammatory cells' infiltration	−	+	+++	+++	++	−
Fibroblast proliferations (fibrogenesis)	−	−	−	+++	+++	++
Angiogenesis	−	−	−	+++	+++	+
Epithelialisation	−	−	−	++	+++	+++
Mature collagen fibres (fibrosis)	−	−	−	_	++	+++

Note: −, none; +, mild; ++, moderate; +++, severe.

3.3. Immunohistochemical studies

Immunohistochemical examination of the vital wound summarised in Table 2 showed that there were negative to mild expression of α‐SMA and VEGF at 0, 1, and 3 days in skin tissue sections. Infiltration of a high number of CD68+ macrophages was observed from day 3 at the wound surface and extended to the superficial dermal layers, but negatively expressed at days 0 and 1. All of the abovementioned immunohistochemical markers positively expressed from day 5 and reach to the peak at day 7 and then declined and not expressed at day 14 except for α‐SMA still strongly expressed at day 14 in some sections (Figure 4).

Table 2.

Semiquantitative analysis of immunohistochemical examinations of wound tissue sections of different ages

	0	1	3	5	7	14
CD68	−	−	++	+++	++	−
α‐SMA	−	−	−	+++	+++	+++
VEGF	−	−	−	+++	++	+

Note: −, none; +, mild; ++, moderate; +++, severe.

Figure 4.

Immunohistochemical examination of the wound tissue sections at 3, 7, and 14 days. A, Immunostaining of CD68 positively expressed in the phagocytic macrophage in the superficial dermal layers. B, C, Negative alpha‐smooth muscle actin (α‐SMA) and VEGF gene expression in the dermal layer. D, Severe CD68+ macrophages' infiltration throughout the granulation tissue in the underline dermis. E, Severe α‐SMA+ spindle‐shaped fibroblast cells' proliferation in the wound area. F, Strong VEGF expression among the phagocytic macrophages and around the neovessels. G, Mild CD68+ macrophages' infiltration. H, Spindle‐shaped fibroblast cells positively immunostained by α‐SMA. I, Negative VEGF gene expression among the dermis

3.4. Relative mRNA expression of VEGF and TGFb2 genes

A significant upregulation in both VEGF and TGFb1 mRNA levels was observed in all of the vital skin wounds at the early stages (0, 1, 3, and 5 days) and reached to the peak at day 7. However, a sharp downregulation was detected in the mRNA level of both the VEGF and TGFb1 at day 14 (Figure 5).

Figure 5.

The mRNA expression rate of the studied genes in different experimental groups. A, VEGF1; B, TGFb1; C, gel photograph showing PCR products of the studied genes. Groups 1, control; 2, 3 d; 3, 5 d; 4, 7 d; 5, 14 d. *Significant difference at P ≤ .05. The values are represented as mean ± SD

4. DISCUSSION

The competence to resolve whether the skin wound occurred during life or after death is considered a crucial issue in forensic medicine. The determination of wound age and vitality is always required to elucidate the relationship between wounds and the cause of death. Skin‐wound healing starts immediately after wounding and consists of three phases: inflammation, proliferation, and maturation.6

In our study, histopathological examination of skin wound tissue section showed mild oedema and/or congestion of vessels at 1 day old. Margination of polymorphs was observed at 1 and 3 days after wounding. Our finding is in agreement with the previous study where it was noticed that early polymorph infiltration was found at 4 to 7 hours and reach the maximum levels after 24 hours.26

Mononuclear cell infiltration was observed at 1, 3, and 7 days, as well as the earliest re‐epithelialisation and fibroplasia were observed at 5 days. Similar observations reported that the earliest mononuclear infiltration was noticed at 24 hours.27 Another study reported that the epithelial regeneration starts as early as 30 hours and is clearly visible by 72 hours in most cases. The granulation tissue deposition was noticed in our study at 5 and 7 days. This observation in accordance with a previous study confirmed that the granulation tissue formation is seen by 5 to 8 days.28

The collagen tissue was noticed at 7 and 14 days old. The previous study confirmed that collagen formation begins at 3 to 6 days and later increases in density until 14 days.26

Our histopathological results of the non‐vital skin wound tissue sections at 0, 1, 3, 5, or 7 days old showed neither inflammatory reactions nor healing process (re‐epithelialisation, angiogenesis and fibrogenesis). Our findings were in agreement with other several studies which prove that certain changes cannot be inflicted in the post‐mortem, such as inflammation, resorption, and wound repair processes that were considered as active responses of the body.16 Our results confirmed the pivotal role of histopathological examinations in deciding both the vitality and age of the skin wound.

With advances in the biochemical and immunohistochemical techniques, several markers have been applied to the wound age determination. The immunohistochemical analysis is now exclusively utilised for wound age determination.29

In the current study, immunohistochemical staining together with the mRNA level showed that the VEGF was overexpressed at the late stages of healing (5 and 7 days) and not expressed at the early stages (0, 1, and 3 days). VEGF is a signal protein produced by cells that stimulate the formation of blood vessels and have an important role during angiogenesis.30 VEGF expression in normal skin is absent. However, cutaneous damage prompted a sharp upregulation of VEGF expression. Excessive transcription of VEGF is associated with the proliferation of new blood vessels at the site of injury.31 Expression of VEGF is upregulated by several proinflammatory cytokines such as IL1 and IL6, which are enhanced during the early stage of wound healing.32 The role of VEGF in wound healing includes synchronisation of vascular permeability, the proliferation of endothelial cells, and the influx of inflammatory cells into the site of injury.33 During the skin repair, upregulation of VEGF in dermal capillaries was reported.34

In our study, CD68+ macrophages expressed at 3, 5, and 7 days after wounding while α‐SMA + myofibroblasts appeared at 5 and 7 days. This finding is in agreement with the previous study, thus demonstrating that macrophages were observed at day 3 or later after wounding in human skin wounds.35 During the process of skin wound healing, myofibroblasts and macrophages are presumed to play an important role in angiogenesis due to the secretion of VEGF in skin wound healing.

The transcription of TGFb1 and VEGF increased shortly after wounding, until post‐wounding day 7. It then declined constantly, reaching minimal values on day 14. Among the wound repair factors, TGFb1 has the widest range of actions, influencing various cell types involved in all stages of wound repair.36 It is a potent cytokine that has a role in wound healing. Following cutaneous injury, TGFb1 is promptly secreted by macrophages, platelets, and keratinocytes.37 Upregulation in the gene expression was recorded straight away after skin damage.38 TGF‐b1 is critical for inflammation initiating and granulation tissue formation. It is essential to facilitate cell migration and promote wound healing.39 The inhibitory effect of TGFb1 on wound healing might be attributed to the increased inflammatory cytokines, which directly suppress the expression of genes that regulate keratinocyte migration.36 The overexpression of this cytokine was suggested to be associated with protraction of the wound healing process.38

5. CONCLUSION

The determinations of wound vitality apart from the timing of both vital and non‐vital wound at a long time period are very crucial subjects for the field of forensic medicine. The current study evaluated the potential capacity of CD68, α‐SMA, VEGF, and TGFb1 to be used as biomarkers for wound age determination.

CONFLICT OF INTEREST

The authors declare no potential conflict of interest.

Khalaf AA, Hassanen EI, Zaki AR, Tohamy AF, Ibrahim MA. Histopathological, immunohistochemical, and molecular studies for determination of wound age and vitality in rats. Int Wound J. 2019;16:1416–1425. 10.1111/iwj.13206