Mesenchymal stem cell‐conditioned medium accelerates wound healing with fewer scars

Abstract

Mesenchymal stem cells (MSCs) derived from umbilical cords (UC‐MSCs) have been shown to enhance cutaneous wound healing by means of the paracrine activity. Fibroblasts are the primary cells involved in wound repair. The paracrine effects of UC‐MSCs on dermal fibroblasts have not been fully explored in vitro or in vivo. Dermal fibroblasts were treated with conditioned media from UC‐MSCs (UC‐MSC‐CM). In this model, UC‐MSC‐CM increased the proliferation and migration of dermal fibroblasts. Moreover, adult dermal fibroblasts transitioned into a phenotype with a low myofibroblast formation capacity, a decreased ratio of transforming growth factor‐β1,3 (TGF‐β1/3) and an increased ratio of matrix metalloproteinase/tissue inhibitor of metalloproteinases (MMP/TIMP). Additionally, UC‐MSC‐CM‐treated wounds showed accelerated healing with fewer scars compared with control groups. These observations suggest that UC‐MSC‐CM may be a feasible strategy to promote cutaneous repair and a potential means to realise scarless healing.

Introduction

The skin tissues of foetuses and adults have different injury responses and distinctive mechanisms for wound healing 1. The healing of early‐ to mid‐gestational foetal mammalian skin is characterised by the absence of contraction and subsequent scarring 2, 3. In contrast, wound healing in adult mammalian skin involves intense inflammation and scarring 4. Foetal skin cells, especially dermal fibroblasts, are believed to be the primary cells involved in cutaneous regeneration. A large number of studies have suggested that fibroblasts from foetal skin and adult skin are different in many aspects, such as proliferation and migration rates, the ability to form myofibroblasts, extracellular matrix (ECM) synthesis 5, 6, 7 and the responses to inflammatory cues 8. Therefore, treatment methods that alter the phenotype of adult fibroblasts into foetal‐like fibroblasts may be a promising means for improving wound healing.

Mesenchymal stem cells (MSCs) are multipotent progenitor cells derived from a variety of tissues 9, 10, such as bone marrow, adipose tissue and amniotic membrane, and they have been reported to have therapeutic potential following transplantation as observed in in vivo wound‐healing models 11, 12. However, compared with other MSCs, umbilical cord (UC)‐MSCs are characterised by short amplification times, high proliferation rates, lower immunogenicity, higher safety, greater abundance and being more convenient to manipulate 13, 14. Furthermore, UC‐MSCs have been shown to promote cutaneous wounds recovery 15. In the literature, much debate remains over the mechanisms by which MSCs promote tissue wound healing. It has been suggested that the paracrine effect of secreted soluble factors may be the most effective way MSCs promote wound repair 16, 17. Several studies have shown that UC‐MSC‐CM enhances cutaneous wound healing by stimulating macrophage and endothelial migration 18, thereby promoting re‐epithelialisation and dermal fibroblasts migration 19. However, the role of UC‐MSC‐CM in the in vitro regulation of dermal fibroblasts into a more regenerative phenotype remains unknown.

In this study, we used adult dermal fibroblasts to detect whether UC‐MSC‐CM regulates wound healing in vitro and in vivo via a regenerative function. We demonstrate that UC‐MSC‐CM regulates dermal fibroblast proliferation, migration, myofibroblast differentiation and ECM‐related gene expression. More importantly, UC‐MSC‐CM is shown to promote skin wound healing with fewer scar formations. Overall, the data presented implicate UC‐MSC‐CM as a promising strategy for enhancing wound healing in a scarless way.

Materials and methods

Ethics statement

All animal and human protocols were approved by the ethics committee of PLA Hospital. All surgeries and measurements were performed with sodium pentobarbital anaesthesia, and maximum efforts were made to minimise suffering.

Foreskin samples were obtained from healthy donors undergoing routine circumcisions. Human umbilical cords (UCs) were collected at childbirth, by either vaginal delivery or caesarean section. All foreskin samples and UCs were collected from donors after obtaining signed informed consent forms in accordance with the ethics committee of PLA Hospital.

Isolation and culture of primary human skin fibroblasts

Primary human dermal fibroblasts were isolated and cultured as previously described 20. Each foreskin sample was washed three times with sterile phosphate buffer saline (PBS) (Hyclone, Thermo Scientific, Waltham, Massachusetts, USA) containing 1% antibiotic (100 U/ml penicillin/streptomycin). The underlying fat was removed, and the tissue was cut into 2–4‐mm small explants and incubated in a culture dish for 1 hour at 37°C in a 5% CO₂ incubator. Fresh medium was then added into the culture dish. When fibroblasts reached 70% confluence, they were trypsinised and subcultured to culture flasks.

Isolation and culture of primary umbilical cord mesenchymal stem cells

UC‐MSCs were isolated and cultured as previously described 21, 22. UCs were washed three times with PBS to remove residual blood. The UCs were then cut into 23 cm pieces, discarding the outer or epithelial layer, and digested with a mixture of collagenase type II (Sigma‐Aldrich, St. Louis, MO) and trypsin (Sigma‐Aldrich). Cells dissociated from the UCs were collected and centrifuged at 500g for 10 minutes. The cell pellets were suspended in a culture medium. Cells were incubated at 37°C and 5% CO₂ in a humidified incubator and fed by replacing the culture medium twice weekly until confluence was observed. UC‐MSCs before six passages were used for experiments.

UCs from the healthy caesarean deliveries were collected and washed with PBS to remove the residual blood. Both arteries and veins were removed. The cleaned umbilical cords were then cut into 1 cm pieces, homogenised to a volume of 1–2 mm³ and put into a (DMEM)‐F12 culture medium (cat. no. SH30023.01B; Hyclone, Logan, UT) with 10% foetal bovine serum (FBS; Hyclone). Cells were cultured with 5% CO₂ at 37°C. After the first subculture, cells were passaged with a 1:3 ratio every 3 days. Second passage human umbilical cord mesenchymal stem cells (HU‐MSCs) were used for experiments. Secondary passages of HU‐MSCs were trypsinised and dissociated into single cell suspensions. Monoclonal antibodies (Pharmingen, San Diego, CA) that recognize CD29, CD44, CD73, CD105, CD90, CD14, CD34, CD45, CD106, CD133, HLA‐I and HLA‐DR (at a concentration of 20 ll/106 cells) were used. Mouse Immunoglobin G was used as a negative control. Cells were incubated with antibodies (5 ll each) for 30 minutes at 4 °C. Antibody binding was detected using flow cytometry (FACS Calibur; BD Biosciences, San Jose, CA).

Preparation of conditioned medium

When human UC‐MSCs reached confluence, they were re‐fed with a serum‐free DMEM. UC‐MSC‐CM was then collected after a 48‐hour incubation. The collected UC‐MSC‐CM was centrifuged at 2000 rpm for 5 minutes to remove cell debris. For subsequent experiments, the UC‐MSC‐CM was further concentrated (10 times) by ultrafiltration using centrifugal filter units with a cut‐off value of 10 kDa (Amicon Ultra‐15; Millipore, MA), following the manufacturer's instructions, and subsequent filtration through a 0·22‐µm syringe filter. The concentrated UC‐MSC‐CM was frozen and stored at −80°C until use. In addition, the DMEM serum‐free medium was similarly processed for use as a negative control (N‐CM).

Cell viability assay

The viability of dermal fibroblasts after treatment with UC‐MSC‐CM was assessed using the Cell Counting Kit‐8 assay. Fibroblasts (1 × 10³/well) were briefly plated on 96‐well plates for 24 hours followed by treatment with UC‐MSC‐CM (at three concentrations: 5%, 10% and 20% as CM1, CM2, and CM3, respectively). After treatments for one, three and five days, the cell viabilities were measured utilising a CCK‐8 assay kit (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's instructions. All experiments were performed five times.

Scratch assay

The migration of dermal fibroblasts was measured by a monolayer wound assay in vitro. Fibroblasts were plated on 6‐well plates with DMEM containing 10% FBS until they reached 80% confluence. The plated cells were scraped across the plate with a 200‐µl pipette tip. The culture medium was then immediately changed into a serum‐free DMEM supplement with UC‐MSC‐CM (at CM1, CM2 and CM3 respectively) or N‐CM. To evaluate the cell migration, the fibroblasts were observed under a phase‐contrast microscope at 0 and 24 hours. The wound closure was assessed by calculating the ratio of the culture area after a 24 hour migration to the culture area at 0 hours.

Quantitative real time polymerase chain reaction (qRT‐PCR) analysis

The RNA of fibroblasts was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. One microgram of RNA was reverse‐transcribed using Reverse Transcriptase II (Invitrogen). Various marker genes, such as TGF‐β1, TGF‐β2, TGF‐β3, collagen I, collagen III, MMP2 and MMP9, TIMP1 and TIMP2 and α‐SMA, were amplified using specific oligonucleotide primers (Table 1). Reactions were performed with SYBR Green PCR reagents on an ABI Prism 7300 detection system (Applied Biosystems, Foster City, CA). Normalisation and fold changes were evaluated using the ΔΔC _t method.

Table 1.

Primer sequences used for real time RT‐PCR

Gene	Species	Forward primer	Reverse primer
TGF‐β1	Human	AGTTGTGCGGCAGTGGTTGA	GCCATGAATGGTGGCCAGGT
TGF‐β2	Human	TAGACATGCCGCCCTTCTTCC	AGCACCTGGGACTGTCTGGA
TGF‐β3	Human	AGCACCTGGGACTGTCTGGA	CAATGTAGAGGGGGCGCACA
Collagen I	Human	CCTCAAGAGAAGGCTCACGATGGTG	AGGTCTCACCAGTCTCCATGTTGCA
Collgen III	Human	GCTCTGCTTCATCCCACTATTA	TGCGAGTCCTCCTACTGCTAC
MMP2	Human	CCTACACCAAGAACTTCCGACTATC	CACTGTCCGCCAAATAAACCGA
MMP9	Human	CGACTCCAGTAGACAATCCTTGC	AACTTCCAATACCGACCGTCCT
TIMP1	Human	CCAAAGCAGTGAGCGAGA	ACGCTGGTATAAGGTGGTCTG
TIMP2	Human	GCTGCGAGTGCAAGATCAC	TGGTGCCCGTTGATGTTCTTC
α‐SMA	Human	GCTACTCCTTCGTGACCACAG	GCCGTCGCCATCTCGTTCT

PCR, polymerase chain reaction; RT, real time; TGF‐β, TIMP.

Western blot analysis

To detect protein expression in response to UC‐MSC‐CM, fibroblasts with and without UC‐MSC‐CM treatment were lysed in a radioimmunoprecipitation assay (RIPA) buffer. Lysates were then centrifuged at 12 000g for 30 minutes at 4°C. Protein concentrations were determined by a Bio‐Rad protein kit (Bio‐Rad; Hercules, CA). Proteins were separated using a precast gradient dodecyl sulfate,sodium salt (SDS)‐Polyacrylamide gel electrophoresis (PAGE) gel and transferred to a polyvinylidene difluoride (PVDF) membrane. After blocking, the membrane was incubated with primary antibodies against TGF‐β1, TGF‐β2, TGF‐β3, α‐SMA, collagen Iα and collagen III at 4°C (Cell Signaling Technology, Inc.; Danvers, MA) and then incubated with horseradish peroxidase‐conjugated anti‐mouse and anti‐rabbit secondary antibodies at room temperature (RT) (Santa Cruz Biotech, Dallas, Texas, USA). Blots were visualised using a chemiluminescence detection system (ECL Kit; Pierce, Rockford, IL).

Collagen gel contraction assay

Fibroblasts before five passages were trypsinised and seeded into a 1 mg/ml collagen Type I solution (BD Biosciences) in serum‐free DMEM basal media at a concentration of 1 × 10⁵ cells/ml. The fibroblast‐collagen mixture was then plated into 12‐well culture dishes (1 ml/well), and the solution was allowed to polymerise for 30–45 minutes at 37°C. The solidified gels were gently detached from the plastic surface to allow for contraction, and 1 ml of serum‐deprived medium (containing different UC‐MSC‐CM concentrations) was added to each well. The gels were then incubated overnight at 37°C in 5% CO₂. Then, the cells were treated with or without 5 ng/ml of recombinant human TGF‐β1 for an additional 24 hours. The surface area of collagen gel was measured using Image‐Pro Plus software, Rockville, Maryland, USA. The collagen gels were collected at 8 and 24 hours, respectively, and divided into two parts. One part was embedded in opti‐mum cutting temperature compound (OCT) in liquid nitrogen to detect vimentin with a fluorescence microscope, and the other part extracted protein and detected α‐SMA.

Immunofluorescence (IF)

Fibroblasts before five passages were trypsinised and plated on 24‐well culture dishes (5 × 10⁴/well) for 24 hours. Afterward, the culture medium was changed into a serum‐free DMEM and incubated for an additional 12 hours. Then, UC‐MSC‐CM (at CM1, CM2, CM3) was added to the culture system for another 24 hours before an additional 48 hours of treatment with or without 5 ng/ml of recombinant human TGF‐β1. The fibroblasts were subjected to IF staining and incubated overnight with α‐SMA. Then, the induced cells were incubated with DyLight 488‐conjugated goat anti‐mouse IgG. Additionally, the collagen gels slices embedded in OCT were stained for vimentin. To determine the percentage of cells expressing a given marker protein, at least three fields in any given experiment were imaged, and the number of positive cells relative to the total number of 4′,6‐diamidino‐2‐phenylindole (DAPI)‐labeled nuclei was determined.

In vivo wound‐healing assay

C57BL mice (eight weeks old, male, body weight 20–22 g) were obtained from SPF Laboratory Animal Technology Co. LTD (Beijing, China). The backs of the animals were shaved and disinfected with a povidone‐iodine solution under anaesthesia. Full‐thickness skin excisional wounds (approximately 1·0 × 1·0 cm²) were made on the shaved skins of 27 C57BL mice. The animals were randomly divided into three groups, CM1 treatment (n = 9), CM2 treatment (n = 9), and sham (N‐CM, n = 9), and were injected intradermally into the adjacent skin. The wound samples were collected individually at 5, 7 and 14 days for histological analyses using haematoxylin & eosin (H&E) staining and Masson's trichrome staining. The wound area was measured by tracing the wound margin and calculating using an image analysis program.

Statistical analysis

All values are expressed as the mean ± SD. Comparisons of results between two groups were analysed by a Student's t‐test and by Analysis of Variance (ANOVA) for comparison between more than two groups. Statistical analyses were performed with SPSS 16.0 software package. Probability (P) values of <0·05 were considered significant.

Results

UC‐MSC‐CM promotes dermal fibroblast proliferation

To confirm the effect of UC‐MSC‐CM on the proliferation of dermal fibroblasts, we performed a CCK‐8 assay. Increased proliferation was detected in the fibroblast culture at day 1 after treatment with UC‐MSC‐CM. At days 3 and 5, the proliferation rates more significantly increased. The fibroblast proliferation rates further increased for higher UC‐MSC‐CM concentrations compared with the rates observed for low UC‐MSC‐CM concentrations (Figure 1A). These results indicate that the cell proliferation was enhanced by UC‐MSC‐CM in a time‐ and dose‐dependent manner.

Figure 1.

Effects of umbilical cord (UC)‐mesenchymal stem cells (MSC)‐CM on dermal fibroblast proliferation and migration. (A) After incubation for 1, 3 and 5 days with three concentrations of UC‐MSC‐CM (at 5%, 10% and 20% as CM1, CM2 and CM3 respectively), dermal fibroblast cell viability was assessed using the CCK‐8 assay; data shown represent mean ± SD of five representative experiments; (B) the effects of UC‐MSC‐CM on dermal fibroblast motility in a ‘wound’ scratch‐wound assay. Representative micrographs of dermal fibroblasts were captured at day 0 immediately post‐scratch and at day 1 after scratching (original magnification × 10). (C) Data are shown as mean ± SD (n = 5) and are representative of five independent experiments. *P < 0·05, ^**,## P < 0·01 versus control group. Scale bar = 50 µm.

UC‐MSC‐CM enhances dermal fibroblast migration

To further examine whether UC‐MSC‐CM promoted wound closure, we adopted a wound scratch assay (Figure 1B and C). The images showed that dermal fibroblasts in the presence of UC‐MSC‐CM coated scratch wounds significantly more rapidly 24 hours after scratching than cultures treated with N‐CM. This suggests that UC‐MSC‐CM accelerated dermal fibroblast migration. Additionally, we further quantified the scratch wound area and found a statistically significant increase in fibroblast migration rate in the experimental group. Fast migration of fibroblasts is an essential step for wound healing. These results suggested that the enhanced fibroblast proliferation and migration rates will consequently accelerate wound closure.

UC‐MSC‐CM regulates the dermal fibroblast expression of genes involved in scarless wound healing

Foetal wounds heal without scars. The transforming growth factor‐beta (TGF‐β) superfamily has been shown to be closely related to scar formation and that TGF‐β3 is more profibrotic than TGF‐β1 and 2 in foetal wounds 6. In this study, we found that the expressions of TGF‐β1 and 2 decreased, and the expression of TGF‐β3 increased in UC‐MSC‐CM‐treated fibroblasts compared with N‐CM‐treated dermal fibroblasts (Figure 2A and B). Moreover, this regulatory effect was dose‐dependent.

Figure 2.

Effects of umbilical cord (UC)‐mesenchymal stem cell (MSC)‐CM on the expression of wound‐healing‐related genes in dermal fibroblast. (A) Evaluation of relative TGF‐β1, TGF‐β2, TGF‐β3, collagen I, collagen III, MMP2, MMP9, TIMP1 and TIMP2 mRNA expression. (B) The relative protein expression of TGF‐β1, TGF‐β2, TGF‐β3, collagen I and collagen III in fibroblasts treated with UC‐MSC‐CM was obtained by densitometric scanning of the representative immunoblot shown in the figure after adjusting for internal control. The densitometric analyses (mean ± SD) are obtained from three independent experiments. *P < 0·05, ^{**,##,$$, &&,^^} P < 0·01 versus control group.

Additionally, the effect of UC‐MSC‐CM on the expression of ECM was determined by comparing the expressions of ECM collagen genes. There was an increased ratio of collagen type III to collagen type I in fibroblasts after UC‐MSC‐CM treatment (Figure 2A and B). As observed in previously presented data, higher levels of collagen type III yields smaller, reticular structures with more cross‐linking than collagen type I and contributed toward scarless wound healing. This characteristic of ECM collagen was also discovered in foetal fibroblasts.

Moreover, ECM remodelling is an important component of scar‐free wound healing in foetal tissue. As shown in Figure 2A, the transcriptions of MMP2 and MMP9 were upregulated, while TIMP1 and TIMP2 were downregulated under UC‐MSC‐CM treatment. These results illustrate that the activity of MMP was higher in UC‐MSC‐CM‐treated fibroblasts, which resulted in greater rates of collagen degradation than collagen synthesis. These findings demonstrate that dermal fibroblasts represent a phenotype similar to foetal fibroblast.

UC‐MSC‐CM inhibits the dermal fibroblast differentiation in vitro

The differentiation of fibroblasts into myofibroblasts is very important for adult wound healing. However, myofibroblasts possess the ability to secrete more collagen molecules, especially collagen type I, thereby inducing wound contraction, which results in scar formation. TGF‐β1 is a known inducer of fibroblast differentiation, and α‐SMA is a common marker for myofibroblasts 23. Western blot and IF analyses demonstrated that the expression of α‐SMA is upregulated after TGF‐β1 treatment. UC‐MSC‐CM suppressed the TGF‐β1‐driven expression of the myofibroblast marker protein (Figure 3). Additionally, when the collagen lattice contraction model was further used to measure fibroblast contraction, we found that gel contraction decreased with the increasing concentrations of UC‐MSC‐CM. This indicates that UC‐MSC‐CM significantly blocked the TGF‐β1‐induced collagen contraction (Figure 4A, P < 0·05). However, the final contraction was statistically significant between collagen gels treated with and without TGF‐β1 and UC‐MSC‐CM. Given the inherent contractile ability of fibroblasts 24, 25, we speculate that the observed gel contraction in the group supplemented with TGF‐β1 and UC‐MSC‐CM may be caused by fibroblast proliferation. On the other hand, this phenomenon may be caused by a small degree of fibroblast‐myofibroblast differentiation. In the OCT gel slices, we further found that the number of cells increased in the groups treated with TGF‐β1 and UC‐MSC‐CM (Figure 4B). These results suggest that the inhibitory effect of UC‐MSC‐CM is partly abolished by its effect for proliferation promotion.

Figure 3.

Umbilical cord (UC)‐mesenchymal stem cell (MSC)‐CM inhibits fibroblast differentiation in response to TGF‐β1. (A) Immunofluorescence of fibroblasts showed that induction of α‐SMA expression by TGF‐β1 is inhibited in the presence of UC‐MSC‐CM. Cells were immunostained for α‐SMA (green) and cell nuclei (blue). (B) The α‐SMA positive cells are significantly lower in the UC‐MSC‐CM‐treated group in a dose‐dependent manner. (C) The transcription of myofibroblast markers (α‐SMA and collagen I) was significantly decreased in the experimental group compared with the control. Data are expressed as the mean ± SD. *P < 0·05, **P < 0·01. (d) Analysed by immunoblotting, increasing concentrations of UC‐MSC‐CM reduce the TGF‐β1‐induced dermal fibroblast differentiation as the expression of myofibroblast marker proteins, including α‐SMA and collagen Iα, decreased. Quantitation of changes in protein expressions of α‐SMA and collagen I are expressed as the mean ± SD. *P < 0·05, **^{, ##} P < 0·01. Scale bar = 30 µm.

Figure 4.

Umbilical cord (UC)‐mesenchymal stem cell (MSC)‐CM inhibits fibroblast‐populated collagen lattice contraction. (A) Representative photographs of collagen gels at 8 hours and 24 hours following the seeding of cells is shown. Quantification revealed that UC‐MSC‐CM significantly inhibited the TGF‐β1‐induced gel contraction (P < 0·05). Data are shown as mean ± SD and are representative of three independent experiments. (B) All cells in collagen gels expressed vimentin, and the number of positive cells in experimental group obviously increased. Moreover, the representative immunoblot of α‐SMA showed that the UC‐MSC‐CM inhibited the fibroblast differentiation in gels. Scale bar = 30 µm.

MSCs promote wound healing in vivo

To evaluate the wound healing ability of UC‐MSC‐CM, we performed quantitative measurements of the wound area (Figure 5A). Compared with the control group, on days 5, 7 and 9 postoperatively, the wound areas were much smaller in the UC‐MSC‐CM‐treated groups. Statistical analysis showed that the wound area in the CM2 group decreased significantly at day 5, while the wound area of CM1 group was not significantly reduced compared with the control group. Additionally, the wounds in the CM2 group were healed within 13 days, while the control group had not healed in 14 days. Therefore, the healing process was shortened in the CM2 group (Figure 5B and C).

Figure 5.

Treatment with umbilical cord (UC)‐mesenchymal stem cell (MSC)‐CM enhances skin scarless repair. (A, B) Measurement of wound sizes treated with UC‐MSC‐CM or N‐CM respectively, showing that wound closure was promoted after being treated with UC‐MSC‐CM. (C) The biopsies of cutaneous wound‐healed tissues were taken, the samples were fixed and sectioned with haematoxylin and eosin or Masson's trichrome staining. Histomorphometric analysis showed that complete re‐epithelialization was found in the CM2‐treated wounds at day 14 (the basement membrane is indicated by red dotted line). Higher vascular density (red arrow) and less collagen deposition were found in UC‐MSC‐CM treated group compared with N‐CM treated group at day 7.

In addition, histological results showed that complete re‐epithelialisation and higher vascularisation level in formed granulation tissue were observed in the CM2‐treated wounds (Figure 5C). Moreover, the wound contractions of the experimental animals were much less than that of the control (Figure 5B). Tissues were also examined with Masson''s trichrome staining for collagen deposition, which indicated a lack of collagen accumulation at the wound site in the CM2 group (Figure 5C). Therefore, CM2‐treated wounds tended to form a less dense and more organised ECM when compared to the natural control. These results showed that the wound healing is faster and scars less after treated with UC‐MSC‐CM.

Discussion

The healing characteristics of foetal and adult skin tissues are different. Several distinctions between foetal and adult fibroblasts have been observed that may contribute to the different patterns of wound healing 26, 27. Conventionally, wound treatment strategies generally focus on promoting wound repair and reducing scar formation 28. Little attention has been given toward the conversion of cell phenotypes during wound repair.

Dermal fibroblast responses normal to injury are vital for wound repair 29, 30. Moreover, foetal fibroblasts responded to injury differently than adult fibroblasts in skin wound healing and scarring 31. Thus, we speculated that an effective way to promote wound healing would be to convert the phenotypes of adult fibroblasts into foetal‐like phenotypes. Because UC‐MSC have been shown to have therapeutic effects in wound repair 15, 32, 33, 34, we further explored their effects on dermal fibroblasts. As is well‐known, the initial response of dermal fibroblasts adjacent to the wound sites is proliferation and subsequent migration into the wound bed. Fibroblasts derived from foetal tissue possessed higher proliferation and migration rates than fibroblast derived from adult tissue. In our study, we observed that the proliferation and migration of fibroblasts were significantly increased after treatment with UC‐MSC‐CM for 1 day. Additionally, the viability and migration of dermal fibroblasts was enhanced by UC‐MSC‐CM in time‐ and dose‐dependent manners. This indicated that the concentration of UC‐MSC‐CM is positively related to the proliferation and migration rate of fibroblasts.

In addition to proliferation and migration, once in the wound, dermal fibroblasts differentiate into myofibroblasts, which are the primary cells involved in wound contraction and scar formation 6. Our data showed that UC‐MSC‐CM reduced the TGF‐β1‐induced collagen gels contraction in a dose‐dependent manner but induced the proliferation of fibroblasts in gels. In addition, we found that the α‐SMA‐positive cells significantly downregulated the UC‐MSC‐CM‐treated groups. These data indicated that UC‐MSC‐CM prevented or abated the TGF‐β1‐induced fibroblasts differentiation, which resulted in fewer myofibroblasts at the wound site. In this way, UC‐MSC‐CM achieves its anti‐fibrotic properties. These results were further supported in an excisional animal model in vivo. The wounds treated with UC‐MSC‐CM healed faster and with less collagen deposition compared with the control group. These results demonstrate that UC‐MSC‐CM may have significant promise for improving wound healing with fewer fibrosis and contractures. Moreover, the healing effect was much stronger in the high concentration group (CM2) than in the low concentration group (CM1). Furthermore, the CM was injected into the wounds just once in this study. Using a higher concentration and applying more than once in wounds should be tested in a further study.

The secretion and remodelling of ECM is another important function of fibroblasts. Collagen is a pivotal molecule that builds a scaffold in wounds and is involved in all stages of wound healing 35. Unlike foetal fibroblasts, adult fibroblasts synthesise more collagen type I molecules. We found that the synthesis of collagen types I decreased and the synthesis of collagen type III increased in adult fibroblasts after UC‐MSC‐CM treatment. Therefore, UC‐MSC‐CM could regulate the accumulation of collagen types I and III and decrease their relative ratios. Furthermore, ECM remodelling requires the co‐ordinated regulation of MMPs and their inhibitors 36. Fibrosis has been correlated with low MMP activity and high TIMP activity. We found that the TIMPs/MMPs ratio decreased in adult dermal fibroblasts in the presence of UC‐MSC‐CM. Therefore, after UC‐MSC‐CM treatment, adult fibroblasts prefer to form a loose, regular ECM structure that creates a microenvironment permissive for cell migration and proliferation and reduces the mechanical stress to the cells involved in wound repair. Unfortunately, we did not compare the treated adult fibroblasts with the foetal‐derived fibroblasts and, thus, cannot confirm the concentration at which UC‐MSC‐CM treatment is more suitable.

Finally, accumulating evidence has shown that the secretion of soluble mediators is also different between foetal and adult fibroblasts 27. TGF‐β has a distinctively different expression pattern in foetal and adult fibroblasts 27, 36. As in foetal fibroblasts, the levels of TGF‐β1 and TGF‐β2 in adult fibroblasts, that is, the so‐called fibrotic isoforms, were downregulated, whereas the levels of TGF‐β3 in adult fibroblasts, that is, the so‐called anti‐firotic isoform, were upregulated in the experimental groups. A variety of cell types, such as platelets 37, macrophages 38 and keratinocytes 39, secrete TGF‐β isoforms during wound healing. The role of UC‐MSC‐CM in regulating the ratio of anti‐firotic/fibrotic isoforms of TGF‐β in these cells requires further study. Additionally, we will further examine the dynamic expressions of the above‐mentioned healing‐related genes in the process of wound repair in vivo in future research.

Perspective

Under UC‐MSC‐CM stimulation, the characteristics of adult fibroblasts were altered to produce high ratios of collagen types III and I, low levels of myofibroblasts, low ratios of TGF‐β1,2/ TGF‐β3 and a high MMPs/TIMPs ratio. These phenotypical characteristics were similar to those of foetal fibroblasts 40. These results showed that the transformation of adult cells into foetal cells may be a means by which UC‐MSC‐CM promotes wound healing. However, the mechanism by which UC‐MSC‐CM effects the phenotypes of other cells involved in wound repair requires further research. Moreover, other biological characteristics, such as immunological responses and the secretion of other pleiotropic cytokines, should also be compared between foetal fibroblasts and UC‐MSC‐CM‐treated adult fibroblasts. Finally, skin damage can also be induced by burns, cuts, abrasions and ulcers. Hypertropic scars usually typically occur in burn wounds 41, and non‐healing wounds are typically observed in diabetes 42. The data from this work suggests that UC‐MSC‐CM can be used in the treatment of wound healing and be applied to ease scars.