Skip to main content
NCBI home page
Physiological Reports logoLink to Physiological Reports
. 2021 Mar 13;9(5):e14766. doi: 10.14814/phy2.14766

Homoarginine ameliorates diabetic nephropathy independent of nitric oxide synthase‐3

Michael D Wetzel 1, Kristen Stanley 1, Soumya Maity 1, Muniswamy Madesh 1, Jean C Bopassa 2, Alaa S Awad 1,✉
PMCID: PMC7955794  PMID: 33713581

Abstract

Recently we showed that homoarginine supplementation confers kidney protection in diabetic mouse models. In this study we tested whether the protective effect of homoarginine is nitric oxide synthase‐3 (NOS3)‐independent in diabetic nephropathy (DN). Experiments were conducted in NOS3 deficient (NOS3−/−) mice and their wild type littermate using multiple low doses of vehicle or streptozotocin and treated with homoarginine via drinking water for 24 weeks. Homoarginine supplementation for 24 weeks in diabetic NOS3−/− mice significantly attenuated albuminuria, increased blood urea nitrogen, histopathological changes and kidney fibrosis, kidney fibrotic markers, and kidney macrophage recruitment compared with vehicle‐treated diabetic NOS3−/− mice. Furthermore, homoarginine supplementation restored kidney mitochondrial function following diabetes. Importantly, there were no significant changes in kidney NOS1 or NOS2 mRNA expression between all groups. In addition, homoarginine supplementation improved cardiac function and reduced cardiac fibrosis following diabetes. These data demonstrate that the protective effect of homoarginine is independent of NOS3, which will ultimately change our understanding of the mechanism(s) by which homoarginine induce renal and cardiac protection in DN. Homoarginine protective effect in DN could be mediated via improving mitochondrial function.

Keywords: cardiac function, diabetic nephropathy, homoarginine, NOS3

Our results indicate that homoarginine mediates renal and cardiac protection in diabetic NOS3‐/‐ mice which will ultimately change our understanding of the mechanism(s) by which homoarginine ameliorate diabetic kidney injury. Homoarginine protective effect in diabetic nephropathy could be mediated via improving mitochondrial function.

graphic file with name PHY2-9-e14766-g002.jpg

1. INTRODUCTION

Diabetes is a serious and increasingly prevalent cause of morbidity and mortality in the United States, with an estimated 12–14% of adults being diabetic, with even higher rates among ethnic minorities (Gao et al., 2016; Menke et al., 2015). Economic and productivity losses due to diabetic complications are over $245 billion and leads to physiological and psychological effects including systemic inflammation, renal and cardiac dysfunction, depression, and social anxiety (Jha et al., 2018; Menke et al., 2015; Moreno et al., 2018; Tao et al., 2015; Vanstone et al., 2015). Diabetic nephropathy (DN) is a chronic progressive disorder leading to a rapid decline and end‐stage kidney failure. Over the last decade, the incidence of kidney failure due to diabetes has doubled. Traditional therapies, including blood pressure and glucose control and other lifestyle changes, have only been modestly successful in delaying the progression of renal failure. Thus, it is important to identify the mechanisms involved in the development and progression of diabetic kidney disease.

Homoarginine, an endogenous arginine analog, not involved in protein synthesis, has emerged as a new player in health and disease (Pilz et al., 2015). Homoarginine is synthesized by mitochondrial arginine:glycine amidinotransferase (AGAT) in kidneys using l‐arginine and l‐lysine as substrates (Choe et al., 2013; Ryan & Wells, 1964), and catabolized using alanine:glyoxylate aminotransferase 2 (AGXT2) (Rodionov et al., 2016). Plasma concentrations of homoarginine are inversely correlated with the risk of cardiovascular disease and overall mortality (Jud et al., 2018; Marz et al., 2010), increased risk for fatal strokes (Haghikia et al., 2017), congestive heart failure and left ventricular hypertrophy (Atzler et al., ,2013, 2017; Bahls et al., 2018; Pilz, Edelmann, et al., 2014), aging (Atzler, Schwedhelm, et al., 2014; Marz et al., 2010), smoking (Atzler, Gore, et al., 2014; Sobczak et al., 2014; Vogl et al., 2015; Zwan et al., 2013), body mass index (Atzler, Gore, et al., 2014; Marz et al., 2010; Pilz, Teerlink, et al., 2014), and pregnancy (Valtonen et al., 2008). Low homoarginine levels act as an indicator of cardiac dysfunction, with associated high levels of asymmetric dimethylarginine (ADMA) (Atzler, Schwedhelm, et al., 2014; Jud et al., 2018; Kayacelebi et al., 2014; Pilz et al., 2015; Vogl et al., 2015). The effects of low homoarginine on nitric oxide (NO) production/action have been linked with increased risk of stroke and atherosclerosis (Haghikia et al., 2017). Endothelial nitric oxide synthase (NOS3) is constitutively expressed in endothelial cells, and it functions to adjust intracellular NO levels in response to calcium levels (Zanchi et al., 2000). Homoarginine may contribute to NO synthesis by serving as a substrate for NOS because homoarginine, even with its weaker affinity to NOS as compared to arginine, can be metabolized to NO and homocitrulline (Drechsler et al., 2011). In the kidney, low homoarginine is a strong risk factor for sudden cardiac death and death due to heart failure in hemodialysis patients (Drechsler et al., 2011). Furthermore, low homoarginine levels are associated with increased cardiovascular risk in renal transplant patients (Kayacelebi et al., 2017). In both animal (Banchaabouchi et al., 2001; Tofuku et al., 1985) and human (Drechsler et al., 2013) with chronic kidney injuries, homoarginine levels are reduced and low plasma homoarginine levels were significantly related to reduced glomerular filtration rate (GFR) and proteinuria (Ravani et al., 2013). Although epidemiological data showed that decreased homoarginine levels were associated with increased mortality in kidney and cardiovascular disease (Drechsler et al., 2015; Jud et al., 2018; Marz et al., 2010; Ravani et al., 2013), the direct physiologic mechanism(s) of homoarginine remain unclear. We previously showed that homoarginine is an effective treatment for DN (Wetzel et al., 2019). However, the mechanism of homoarginine action in kidney and cardiac dysfunction is not known.

In the current study, we tested the hypothesis that the protective effect of homoarginine in renal and cardiac functions in diabetes is independent of NOS3. Our results indicate that homoarginine mediates renal and cardiac protection in diabetic NOS3−/− mice which will ultimately change our understanding of the mechanism(s) by which homoarginine ameliorate diabetic kidney injury. The protective effect of homoarginine in DN could be mediated via improving mitochondrial function.

2. MATERIALS AND METHODS

2.1. Diabetic mouse model

All animal experiments were performed in male 6‐week‐old C57BL/6J or NOS3−/− mice (The Jackson Laboratory, Bar Harbor, ME). Mice were kept at 23°C and a 12:12 light–dark cycle with free access to standard chow and water. Diabetes was induced by intraperitoneal injection of 50 mg/kg streptozotocin (STZ) or saline control following a 6‐h fast for 5 consecutive days. All procedures were done in the morning throughout the study. Blood glucose levels were measured from non‐fasting mice using a Contour Next EZ glucometer with Contour Next strips from mice tail vein, with diabetic mice being defined as having a blood glucose level over 350 mg/dl. l‐Homoarginine (Sigma, St. Louis MO, Cat #: H1007) was supplemented in drinking water at a concentration of 50 mg/L as previously described (Wetzel et al., 2019) and replaced every 4 days. At the end of the study (24 weeks), 24‐h urine samples were collected, mice were euthanized using an intraperitoneal injection of ketamine/xylazine cocktail; plasma was obtained by cardiac puncture, and kidneys and hearts were removed for further studies. For urine collections mice were placed individually in metabolic cages for 16 h with free access to drinking water, and urine was collected in collecting tubes containing 200 µl of mineral oil that prevents urine evaporation. Blood was collected by cardiac puncture and centrifuged at 3000 g for 3 min at 4°C to separate plasma. Following collection all samples were stored at −80°C until analysis. The number of mice per group is given in Table 1. Samples derived from Ins2Akita mice were obtained as previously described (You et al., 2015). All the animal experiments were approved by the University of Texas Health Science Center at San Antonio Institutional Animal Care and Use Committee.

TABLE 1.

Mouse characteristics

WT WT + Diabetes WT + Diabetes + HA NOS3−/− NOS3−/− + Diabetes NOS3−/− + Diabetes + HA
No. per group 5 8 8 4 8 5
Body weight: Baseline (g) 21.8 ± 0.4 23.4 ± 0.9 20.3 ± 0.4 19.5 ± 0.9 21.1 ± 0.7 21.6 ± 0.5
Body weight: % change from baseline 140 ± 6 112 ± 3 a 123 ± 6 a 147 ± 5 101 ± 7 b , c 122 ± 7 c
Blood glucose (mg/dl) 160 ± 8 463 ± 73 a 429 ± 62 a 151 ± 13 523 ± 51 b , c 386 ± 58 b , c
Kidney/body weight ratio 0.63 ± 0.02 0.68 ± 0.02 0.66 ± 0.05 0.58 ± 0.03 0.74 ± 0.05 b , c 0.65 ± 0.04
Heart/body weight ratio 0.53 ± 0.02 0.53 ± 0.02 0.51 ± 0.03 0.50 ± 0.02 0.57 ± 0.02 0.46 ± 0.03 c
SBP (mmMg) 122 ± 8 114 ± 10 117 ± 7 138 ± 10 170 ± 5 b , c 150 ± 7
Water Intake: Baseline (ml) 5.5 ± 0.6 4.2 ± 0.6 2.7 ± 0.6 3.0 ± 0.4 1.1 ± 0.3 1.1 ± 0.2
Water Intake: % change from baseline 208 ± 46 202 ± 17 242 ± 51 334 ± 68 519 ± 129 581 ± 157
Open in a new tab

Mice were injected with streptozotocin for 5 consecutive days, then treated with or without homoarginine in drinking water for 24 weeks. Data are presented as mean ± SEM.

Baseline measurement were obtained at week zero.

Abbreviations: HA, homoarginine; SBP, systolic blood pressure; WT, wild type.

a

p<0.05 versus WT.

b

p<0.05 versus NOS3−/−.

c

p<0.05 versus NOS3−/− + Diabetes.

2.2. Immunohistochemistry

Mouse kidney tissues were fixed in 10% formalin and embedded in paraffin, and 3‐μm sections were cut. Immunohistochemistry was performed on paraffin‐embedded sections with anti‐mouse Mac‐2 antibody (clone M3/38; Cedarlane, Burlington, NC) as previously described (You et al., 2013, 2014). Images were taken with an Olympus BX60 microscope and Olympus Q‐Color3 digital camera using Q‐capture Pro 7 image software. The number of glomerular macrophages was counted in 20 glomeruli/section (no. of macrophages in glomeruli divided by the no. of glomeruli) in a blinded fashion under 40× magnification and averaged as described previously (Morris et al., 2011; Wetzel et al., 2019; You et al., 2013, 2014).

2.3. Renal and cardiac histopathology

Kidneys and hearts were fixed in 4% paraformaldehyde, embedded in paraffin, and 5‐μm sections were cut. Sections were stained with Masson's trichrome or periodic acid‐Schiff (PAS) stain, examined in a blinded manner, and scores were averaged. To determine percent area fibrosis, Masson's trichrome pictures were obtained at 10x and analyzed in ImageJ to measure percent area of fibrosis. Representative images were taken with an Olympus BX60 microscope and Olympus Q‐Color3 digital camera using Q‐capture Pro 7 image software. Glomerular characteristics were measured using Bioquant Osteo software (Bioquant Image Analysis Corporation, Nashville, TN), and percent injury index was calculated as described previously (Mohan et al., 2008). For each kidney, we obtained 12 images and analyzed a glomerulus for each field to be averaged for each animal for statistical analysis.

2.4. Analytical methodology

Urine albumin concentration was measured by ELISA using an Albuwell M kit (Exocell, Philadelphia, PA) as described previously (Awad, You, Gao, Gvritishvili, et al., 2015). Urine creatinine was measured using Diazyme Creatinine Assay (Diazyme Laboratories, Poway, CA) (Awad et al., 2011; Awad, You, Gao, Cooper, et al., 2015). Blood urea nitrogen (BUN) was determined using a QuantiChrom urea assay kit (BioAssay Systems, Hayward, CA) as previously described (You et al., 2017). Mouse systolic pressures were measured using CODA Non‐invasive Blood Pressure system (Kent Scientific Corporation, Torrington CT) as previously described (Awad, You, Gao, Gvritishvili, et al., 2015). Mice were acclimated for 10 min at 26°C before readings began. Readings were taken at the same time of day for all groups to prevent any diurnal variations.

2.5. Cardiac function measurements

Serial B‐Mode and M‐Mode echocardiography was performed using a Vevo 2100 Imaging Platform (VisualSonics, Toronto, Canada) using a 30‐MHz linear transducer to accurately monitor cardiac hemodynamic parameters and assess heart structure of mice after 22 weeks of homoarginine treatment. The left ventricular ejection fraction (EF) and left ventricle fractional shrinkage (FS) were quantified using M‐mode as previously described (Iorga et al., 2016, 2018).

2.6. RNA isolation and real‐time PCR

RNA was isolated by Trizol extraction from whole kidney sections and reverse‐transcribed to cDNA using the Bio‐Rad (Hercules, CA) iScript cDNA synthesis kit. Real‐time PCR was performed on a CFX384 real‐time system (Bio‐Rad, Hercules, CA) using Taqman primers for mouse MCU (Mm0116873_m1), fibronectin (Mm01256744_m1), tumor growth factor β (TGFβ, Mm01178820_m1), NOS1 (Mm00435175_m1), NOS2 (Mm00440502_m1), and Rn18S (Mm03928990_g1) (Thermo Fisher, Waltham, MA). Ct values were normalized to 18S and compared with NOS3−/− samples. Primers for smooth muscle actin (FW: 5′‐CTGCCGTTTTCCCCCTTCCTG‐3′, RV: 5′‐TTGCTTCCTCCTCCTTTG‐3′), E‐cadherin (FW: 5′‐TGAGTGTGTGGGTGCTGA‐3′, RV: 5′‐CGGTTTCAATGGCTTACCTTTTCC‐3′), and β‐actin (FW: 5′‐GCTGGTTGTGTAAGGTAAGGTGTGC‐3′, RV: 5′‐GAGGGGGTTGAGGTGTTGAGG‐3′) were obtained from Integrated DNA Technologies (Coralville, IA). cDNA samples were analyzed using SYBR Green Master Mix (Thermo Scientific, Rockford IL), as previously described (Morris et al., 2011), and normalized to β‐actin for comparison to NOS3−/− samples.

2.7. Western blotting

Kidney tissue was homogenized in RIPA buffer containing 0.1% Triton X‐100 supplemented with protease inhibitors (Roche Diagnostics, Indianapolis, IN) and cleared by centrifugation at 10,000 g for 10 min at 4°C, and supernatant was collected. Protein concentration was determined by Bicinchonic Acid (BCA) assay (Thermo Scientific, Waltham, MA). A sample of 50 μg of kidney lysate was separated on 4–12% Bis–Tris gel (Life Technologies, Carlsbad, CA) and transferred onto PVDF membranes before blocking with 5% dry milk. Western blots were performed using the following antibodies: MiCU1 (0.4 µg/ml; Sigma‐Aldrich, St Louis, MO) and β‐actin (1:1000; Cell Signaling, Danvers, MA) antibodies. Western blots were quantitated using ImageJ software (NIH, Bethesda, MD) and normalized to β‐actin protein expression.

2.8. Statistical analysis

Comparisons between all groups were conducted using GraphPad Prism software (version 7.04, San Diego, CA). Results are expressed as mean ± SEM. One‐way ANOVA followed by Fisher's least significance difference test was used to compare significance between groups. A value of p < 0.05 represented significant difference.

3. RESULTS

3.1. Mouse characteristics

Diabetic wild type and NOS3−/− mice had significantly less body weight compared with non‐diabetic mice after 24 weeks, which was significantly increased by homoarginine in diabetic NOS3−/− mice. Blood glucose was higher in all diabetic wild type and NOS3−/− mice. Kidney/body weight ratio was significantly higher in diabetic NOS3−/− mice, while homoarginine treatment significantly reduced cardiac/body weight ratio in diabetic NOS3−/− mice. Systolic blood pressure was significantly increased in NOS3−/− mice compared with wild type and showed a trend of reduction; albeit not significant by homoarginine treatment in diabetic NOS3−/− mice. (Table 1).

3.2. Homoarginine reduces albuminuria in diabetic NOS3−/− mice

Diabetes significantly increased albuminuria in both wild type and NOS3−/− mice compared with normal, an effect significantly reduced by homoarginine treatment (Figure 1). Since the results observed in wild type mice were consistent with our previous study (Wetzel et al., 2019) about the protective effect of homoarginine in DN, we only analyzed NOS3−/− mice for the remainder of this study.

FIGURE 1.

FIGURE 1

Open in a new tab

Homoarginine reduces albuminuria in diabetic mice. Urine was collected from wild type and NOS3−/− mice after 24 weeks of diabetes and analyzed for albumin/creatinine ratio. Data are presented as mean ± SEM. *p < 0.05 versus normal, # p < 0.05 versus diabetes.

3.3. Homoarginine reduces plasma BUN levels in diabetic NOS3−/− mice

We next evaluated the effects of homoarginine administration on plasma BUN levels in NOS3−/− mice. Plasma BUN levels were increased in diabetic mice and reduced by homoarginine treatment (Figure 2).

FIGURE 2.

FIGURE 2

Open in a new tab

Homoarginine reduces plasma BUN in diabetic NOS3−/− mice. Plasma BUN was determined in NOS3−/− mice after 24 weeks of diabetes. Data are presented as mean ± SEM. *p < 0.05 versus normal, # p < 0.05 versus diabetes.

3.4. NOS1 and NOS2 expressions are not altered in diabetic NOS3−/− mice

Next we determined if diabetes and/or homoarginine altered the expression of other NOS isoforms in kidneys from NOS3 −/− mice. Our results show that neither diabetes nor homoarginine affected NOS1 or NOS2 gene expression in NOS3−/− mice (Figure 3).

FIGURE 3.

FIGURE 3

Open in a new tab

Expression of NOS1 and NOS2 are not altered in diabetic NOS3−/− mice. RT‐PCR was performed on cDNA extracted from kidney samples of mice and analyzed for (a) NOS1 and (b) NOS2. Data are presented as mean ± SEM.

3.5. Homoarginine reduces glomerular pathology and fibrosis in diabetic NOS3−/− mice

Analysis of PAS‐stained glomerular sections showed that diabetic NOS3−/− mice were associated with increased glomerular volume, glomerular cellularity, glomerular basement membrane (GBM) thickness, and glomerular injury index compared with non‐diabetic NOS3−/− mice; an effect significantly reduced using homoarginine treatment (Table 2 and Figure 4a). Furthermore, diabetic NOS3−/− mice displayed an increased percent of fibrosis (using ImageJ) in Masson's trichrome (Figure 4b,c)‐stained sections 24 weeks after diabetes, which was reduced by treatment with homoarginine.

TABLE 2.

Homoarginine reduces glomerular injury index in NOS3−/− mice.

NOS3−/− NOS3−/− + Diabetes NOS3−/− + Diabetes + HA
Glomerular volume/µM2 3838 ± 299 4711±269 a 4356 ± 169
Cellularity (cgs) 18.7 ± 1.2 29.4 ± 0.7 a 23.1 ± 0.6 a , b
Injury index % 4.2 ± 2.4 22.9 ± 4.1 a 8.3 ± 4.1 b
GBM thickness (µM) 0.34 ± 0.01 0.50 ± 0.02 a 0.39 ± 0.02 b
Open in a new tab

Note: PAS‐stained sections were analyzed using Bioquant Osteo for the indicated parameters of glomerular pathology.

HA, homoarginine; GBM, glomerular basement membrane.

a

p < 0.05 versus NOS3−/−.

b

p < 0.05 versus NOS3−/− + Diabetes.

FIGURE 4.

FIGURE 4

Open in a new tab

Homoarginine reduces glomerular pathology and fibrosis in diabetic NOS3−/− mice. (a) Paraffin‐embedded mouse kidney sections were subjected to periodic acid‐Schiff (PAS) staining. (b) Kidney sections were fixed in formaldehyde and stained with Masson's Trichrome. (c) Images from b were quantified for percent area fibrosis using ImageJ. Data are presented as mean ± SEM. *p < 0.05 versus normal, # p < 0.05 versus diabetes. Pictures taken at 40× magnification. Black arrow: area of fibrosis.

3.6. Homoarginine reduces kidney fibrotic markers in diabetic NOS3−/− mice

Real‐time PCR analysis show marked increases in kidney fibronectin (Figure 5a), TGFβ (Figure 5b), smooth muscle actin (Figure 5c), and E‐cadherin (Figure 5d) following diabetes in NOS3−/− mice. Homoarginine supplementation significantly blunted the increase in these fibrosis markers.

FIGURE 5.

FIGURE 5

Open in a new tab

Homoarginine reduces fibrotic markers in diabetic NOS3−/− mice. RT‐PCR was performed on cDNA extracted from kidney samples of mice and analyzed for (a) fibronectin, (b) TGFβ, (c) smooth muscle actin, (d) E‐cadherin. Data are presented as mean ± SEM. *p < 0.05 versus normal, # p < 0.05 versus diabetes.

3.7. Homoarginine reduces glomerular macrophage infiltration in diabetic NOS3−/− mice

Diabetic NOS3−/− mice displayed a marked increase in infiltrating kidney macrophages following diabetes (Figure 6) compared with non‐diabetic mice. Homoarginine treatment significantly reduced macrophage infiltration 24 weeks after diabetes.

FIGURE 6.

FIGURE 6

Open in a new tab

Homoarginine reduces glomerular macrophage infiltration in diabetic NOS3−/− mice. Glomerular macrophage recruitment was visualized by immunohistochemical staining using Mac‐2 antibody. The number of glomerular macrophages was counted in 40 glomeruli per section (number of macrophages in glomeruli divided by the number of glomeruli) in blinded fashion under 40× magnification and averaged. Data are presented as mean ± SEM. *p < 0.05 versus normal, # p < 0.05 versus diabetes. Pictures taken at 100× magnification. Black arrow: macrophage.

3.8. Homoarginine reduces cardiac fibrosis and improves cardiac function in diabetic NOS3−/− mice

Diabetic NOS3−/− mice displayed an increased percent of fibrosis (using ImageJ) in Masson's trichrome (Figure 7a,b)‐stained sections 24 weeks after diabetes, which was reduced by treatment with homoarginine. Furthermore, diabetic NOS3−/− mice had a significant reduction in ejection fraction (EF) and fractional shrinking (FS) (Figure 7c–e) compared with non‐diabetic controls at 22 weeks of diabetes, an effect significantly restored using homoarginine treatment.

FIGURE 7.

FIGURE 7

Open in a new tab

Homoarginine reduces cardiac fibrosis and improves cardiac function in diabetic NOS3−/− mice. (a) Masson's Trichrome staining of heart sections. Pictures taken at 40× magnification. (b) Fibrosis scoring of Masson's Trichrome heart sections from A using ImageJ. (c) Vevo 2100 Imaging Platform was used to image mouse hearts and determine percentage of left ventricular ejection fraction (EF) and fractional shrinking (FS). Data are presented as mean ± SEM. *p < 0.05 versus normal, # p < 0.05 versus diabetes.

3.9. Homoarginine restores MCU complex and its regulators in diabetic Ins2Akita mice

Kidney samples derived from our previous publication (Wetzel et al., 2019) were analyzed for MCU complex and its regulators. Diabetic mice had a significant increase in kidney MCU and its positive regulator, MCUR1 expression, along with a reduction in kidney MCU negative regulator, MICU1 expression (Figure 8), compared with non‐diabetic controls at 18 weeks of age in Ins2Akita mice, whereas diabetic mice treated with homoarginine supplementation restored MCU complex and its regulators to normal levels.

FIGURE 8.

FIGURE 8

Open in a new tab

Homoarginine restores kidney MCU complex and its regulators in diabetic Ins2Akita mice. RT‐PCR was performed on cDNA extracted from kidney samples derived from our previous publication (Wetzel et al., 2019) and were analyzed for (a) MCU complex, (b) MCU positive regulator, MCUR1, and (c) MCU negative regulator, MICU1. Data are presented as mean ± SEM. *p < 0.05 versus normal, # p < 0.05 versus diabetes.

3.10. Homoarginine restores MCU complex and its regulators in diabetic NOS3−/− mice

Diabetic NOS3−/− mice had a significant increase in kidney MCU (Figure 9a) along with a significant reduction in its negative regulator, MICU1 expression (Figure 9b,c), compared with non‐diabetic controls after 24 weeks of diabetes, whereas diabetic NOS3−/− mice treated with homoarginine supplementation restored MCU complex and its negative regulator to normal levels.

FIGURE 9.

FIGURE 9

Open in a new tab

Homoarginine restores MCU complex and its regulators in diabetic NOS3−/− mice. (a) RT‐PCR analysis of MCU gene expression from mouse kidneys. (b) Protein was isolated from kidneys of NOS3−/− mice. Western blotted for MICU1 with β‐actin as protein‐loading control. (c) Quantification of MICU1 protein expression. Data are presented as mean ± SEM. *p < 0.05 versus normal, # p < 0.05 versus diabetes.

4. DISCUSSION

Diabetic nephropathy remains an important and unresolved complication of diabetes. Our previous publication demonstrated that homoarginine supplementation confers kidney protection in diabetic mouse models (Wetzel et al., 2019). However, the exact mechanism by which homoarginine mediates these effects was not clear. The current study shows that homoarginine supplementation mediates renal tissue protection in DN independent of NOS3 which will ultimately change our understanding of the mechanism(s) by which homoarginine induce renal and cardiac protection in DN. The protective effect of homoarginine in DN could be mediated via improving mitochondrial function.

Endothelial dysfunction, characterized by reduced bioavailability of NO, and increased oxidative stress is a hallmark characteristic in diabetes (Creager et al., 2003) and DN (Goligorsky et al., 2001). The role of NOS3 expression and action in DN is controversial; therefore although low or lack of NOS3 has been shown to exacerbate DN (Wang et al., 2011; Zhao et al., 2006), a recent publication (Natarajan et al., 2019) showed that overexpression of NOS3 in Ins2Akita mice exacerbates DN probably via increased NOS3 uncoupling and oxidative stress rather than by increased renal NO production/action. Because homoarginine could be a substrate for NOS by increasing l‐arginine (Hecker et al., 1991; Moali et al., 1998), it could also mediate its effect via NO action/production. However, our previous publication showed that oral arginine supplementation surprisingly did not prevent or reduce any markers of renal injury in diabetic mouse model, despite successfully increasing arginine levels in plasma and kidney (You et al., 2014). Direct interaction between homoarginine levels and NO production is controversial. Homoarginine could reduce NO synthesis from arginine by (a) competition of arginine and homoarginine for cellular uptake by cationic amino acid transporters (CAT) (Chafai et al., 2017; Hagos et al., 2006); (b) by trans‐stimulation of CAT, which in turn could increase cellular efflux of arginine; and (c) by competition of homoarginine and arginine for NOS (Pilz et al., 2015), although homoarginine is a less efficient substrate for this enzyme (Moali et al., 1998; Zwan et al., 2013). Although homoarginine may increase arginine availability and thus NO synthesis by inhibition of arginase, this is unlikely because of the weak affinity of homoarginine for arginase (Marz et al., 2010). Nonetheless, homoarginine may contribute to NO synthesis by serving as a substrate for NOS because homoarginine, even with its weaker affinity to NOS as compared with arginine, can be metabolized to NO and homocitrulline (Drechsler et al., 2011).

To examine the mechanism of homoarginine's protective effect in DN, we investigated the effects of homoarginine supplementation on kidney dysfunction, glomerular histopathological changes, and macrophage recruitment in NOS3−/− and their wild type littermate diabetic mouse model. Homoarginine supplementation significantly ameliorated diabetic albuminuria in diabetic wild type and NOS3−/− mice, confirming our previous finding (Wetzel et al., 2019) and was associated with reduced glomerular pathology and kidney fibrotic markers expression in diabetic NOS3−/− mice. Taken together, our results indicate a direct role of homoarginine's protective effect in DN and support the concept that homoarginine mediates renal tissue protection independent of NOS3.

Both cardiovascular morbidity and mortality are increased in patients with DN. In the heart, lower homoarginine levels are related to increased left ventricular thickening, lower EF, and higher NTproBNP (Bahls et al., 2018). Inversely, homoarginine supplementation preserve cardiac function in murine model of post‐myocardial infarction heart failure (Atzler et al., 2017). In the current study, we also demonstrate that the protective effect of homoarginine to improve cardiac function and reduce cardiac fibrosis is independent of NOS3 expression in a similar way to its effect on the kidney. We cannot however exclude the hemodynamic effect of homoarginine in DN given its trend to reduce blood pressure; albeit not significant.

The mechanism of homoarginine protective effect appears to be linked to modulations of mitochondrial function regulated by MCU complex and its regulators. Mitochondrial dysfunction plays a pivotal role in renal injury (Brooks et al., 2009; Coughlan & Sharma, 2016; Hallan & Sharma, 2016; Long et al., 2016; Sharma, 2015; Sun et al., 2008; Wang et al., 2012; You et al., 2016; Yu et al., 2006; Zhan et al., 2013). In the kidney, endothelial cells are especially vulnerable to mitochondrial dysfunction (Hong et al., 2012) and contributes to oxidative stress, persistent energy depletion, impairment of energy‐dependent repair mechanisms, and cell death in kidney injury (Funk et al., 2010; Funk & Schnellmann, 2012). MCU is a multimeric complex involved in rapid Ca2+ uptake in mitochondria and has been shown to be dysregulated in cardiac pathology (Liao et al., 2015; Luongo et al., 2015; Nemani et al., 2018; Tomar et al., 2019; Woods et al., 2019). Mitochondrial Ca2+ uptake mediated by MCU complex plays a critical role in signal transduction, bioenergetics, and cell death, and its dysregulation is linked to several human diseases. Although podocyte apoptosis has been linked to MCU dysregulation (Xu et al., 2018; Yuan et al., 2017), the role of MCU complex and its interaction with homoarginine supplementation in DN are not known. Our current data in diabetic mice demonstrated that homoarginine administration significantly reduced the expression of MCU, increased the MCU‐negative regulator (MICU1), and reduced the MCU‐positive regulator (MCUR1) in DN, and this effect is independent of NOS3 expression. Therefore, we speculate that there is an association between mitochondrial Ca2+ signaling and adverse clinical outcomes in DN. Normalization of mitochondrial function is necessary to restore oxidative metabolism during DN. Additional studies are needed to confirm the direct effect of homoarginine on mitochondrial function.

In conclusion, our study demonstrates for the first time that the mechanism of renal and cardiac tissue protection using homoarginine supplementation in DN is independent of NOS3, and it is likely mediated by improving mitochondrial dysfunction. Results of our study may ultimately result in novel therapeutic interventions designed to augment homoarginine in the treatment of DN.

DISCLOSURE

The authors declare no conflicts of interest, financial, or otherwise.

AUTHOR CONTRIBUTIONS

AA designed research studies. MW, KS, and SM conducted experiments and acquired and analyzed data. AA, JB, and MM analyzed data. MW and AA wrote manuscript. MW, KS, SM, MM, JB, and AA reviewed and edited manuscript.

ACKNOWLEDGMENTS

We thank Drs. Mojan Natarajan and Caroline Xavier Paul Ezhilan for allowing us to use the Bioquant Osteo program.

Funding information

This study was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK‐094930 and DK‐094930S1.

REFERENCES

  1. Atzler, D. , Gore, M. O. , Ayers, C. R. , Choe, C. U. , Boger, R. H. , de Lemos, J. A. , McGuire, D. K. , & Schwedhelm, E. (2014). Homoarginine and cardiovascular outcome in the population‐based Dallas Heart Study. Arteriosclerosis, Thrombosis, and Vascular Biology, 34, 2501–2507. [DOI] [PubMed] [Google Scholar]
  2. Atzler, D. , McAndrew, D. J. , Cordts, K. , Schneider, J. E. , Zervou, S. , Schwedhelm, E. , Neubauer, S. , & Lygate, C. A. (2017). Dietary supplementation with homoarginine preserves cardiac function in a murine model of post‐myocardial infarction heart failure. Circulation, 135, 400–402. [DOI] [PubMed] [Google Scholar]
  3. Atzler, D. , Rosenberg, M. , Anderssohn, M. , Choe, C. U. , Lutz, M. , Zugck, C. , Boger, R. H. , Frey, N. , & Schwedhelm, E. (2013). Homoarginine – An independent marker of mortality in heart failure. International Journal of Cardiology, 168, 4907–4909. [DOI] [PubMed] [Google Scholar]
  4. Atzler, D. , Schwedhelm, E. , Nauck, M. , Ittermann, T. , Boger, R. H. , & Friedrich, N. (2014). Serum reference intervals of homoarginine, ADMA, and SDMA in the study of health in Pomerania. Clinical Chemistry and Laboratory Medicine (CCLM), 52, 1835–1842. [DOI] [PubMed] [Google Scholar]
  5. Awad, A. S. , Kinsey, G. R. , Khutsishvili, K. , Gao, T. , Bolton, W. K. , & Okusa, M. D. (2011). Monocyte/macrophage chemokine receptor CCR2 mediates diabetic renal injury. American Journal of Physiology‐Renal Physiology, 301(6), F1358–F1366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Awad, A. S. , You, H. , Gao, T. , Cooper, T. K. , Nedospasov, S. A. , Vacher, J. , Wilkinson, P. F. , Farrell, F. X. , & Brian, R. W. (2015). Macrophage‐derived tumor necrosis factor‐α mediates diabetic renal injury. Kidney International, 88, 722–733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Awad, A. S. , You, H. , Gao, T. , Gvritishvili, A. , Cooper, T. K. , & Tombran‐Tink, J. (2015). Delayed treatment with a small pigment epithelium derived factor (PEDF) peptide prevents the progression of diabetic renal injury. PLoS One, 10, e0133777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bahls, M. , Atzler, D. , Markus, M. R. P. , Friedrich, N. , Boger, R. H. , Volzke, H. , Felix, S. B. , Schwedhelm, E. , & Dorr, M. (2018). Low‐circulating homoarginine is associated with dilatation and decreased function of the left ventricle in the general population. Biomolecules, 8(3), 63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Banchaabouchi, M. A. , Marescau, B. , Van Marck, E. , D'Hooge, R. , & De Deyn, P. P. (2001). Long‐term effect of partial nephrectomy on biological parameters, kidney histology, and guanidino compound levels in mice. Metabolism, 50(12), 1418–1425. 10.1053/meta.2001.26763 [DOI] [PubMed] [Google Scholar]
  10. Brooks, C. , Wei, Q. , Cho, S. G. , & Dong, Z. (2009). Regulation of mitochondrial dynamics in acute kidney injury in cell culture and rodent models. Journal of Clinical Investigation, 119, 1275–1285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chafai, A. , Fromm, M. F. , Konig, J. , & Maas, R. (2017). The prognostic biomarker L‐homoarginine is a substrate of the cationic amino acid transporters CAT1, CAT2A and CAT2B. Scientific Reports, 7, 4767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Choe, C. U. , Atzler, D. , Wild, P. S. , Carter, A. M. , Boger, R. H. , Ojeda, F. , Simova, O. , Stockebrand, M. , Lackner, K. , Nabuurs, C. , Marescau, B. , Streichert, T. , Muller, C. , Luneburg, N. , De Deyn, P. P. , Benndorf, R. A. , Baldus, S. , Gerloff, C. , Blankenberg, S. , … Schwedhelm, E. (2013). Homoarginine levels are regulated by L‐arginine:glycine amidinotransferase and affect stroke outcome: Results from human and murine studies. Circulation, 128, 1451–1461. [DOI] [PubMed] [Google Scholar]
  13. Coughlan, M. T. , & Sharma, K. (2016). Challenging the dogma of mitochondrial reactive oxygen species overproduction in diabetic kidney disease. Kidney International, 90, 272–279. [DOI] [PubMed] [Google Scholar]
  14. Creager, M. A. , Luscher, T. F. , Cosentino, F. , & Beckman, J. A. (2003). Diabetes and vascular disease: Pathophysiology, clinical consequences, and medical therapy: Part I. Circulation, 108, 1527–1532. [DOI] [PubMed] [Google Scholar]
  15. Drechsler, C. , Kollerits, B. , Meinitzer, A. , Marz, W. , Ritz, E. , Konig, P. , Neyer, U. , Pilz, S. , Wanner, C. , & Kronenberg, F. ; Group MS . (2013). Homoarginine and progression of chronic kidney disease: Results from the Mild to Moderate Kidney Disease Study. PLoS One, 8, e63560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Drechsler, C. , Meinitzer, A. , Pilz, S. , Krane, V. , Tomaschitz, A. , Ritz, E. , Marz, W. , & Wanner, C. (2011). Homoarginine, heart failure, and sudden cardiac death in haemodialysis patients. European Journal of Heart Failure, 13, 852–859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Drechsler, C. , Pihlstrom, H. , Meinitzer, A. , Pilz, S. , Tomaschitz, A. , Abedini, S. , Fellstrom, B. , Jardine, A. G. , Wanner, C. , Marz, W. , & Holdaas, H. (2015). Homoarginine and clinical outcomes in renal transplant recipients: Results from the assessment of lescol in renal transplantation study. Transplantation, 99, 1470–1476. [DOI] [PubMed] [Google Scholar]
  18. Funk, J. A. , Odejinmi, S. , & Schnellmann, R. G. (2010). SRT1720 induces mitochondrial biogenesis and rescues mitochondrial function after oxidant injury in renal proximal tubule cells. Journal of Pharmacology and Experimental Therapeutics, 333, 593–601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Funk, J. A. , & Schnellmann, R. G. (2012). Persistent disruption of mitochondrial homeostasis after acute kidney injury. American Journal of Physiology‐Renal Physiology, 302, F853–F864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gao, H. X. , Regier, E. E. , & Close, K. L. (2016). Prevalence of and trends in diabetes among adults in the United States, 1988–2012. Journal of Diabetes, 8, 8–9. [PubMed] [Google Scholar]
  21. Goligorsky, M. S. , Chen, J. , & Brodsky, S. (2001). Workshop: Endothelial cell dysfunction leading to diabetic nephropathy: Focus on nitric oxide. Hypertension, 37, 744–748. [DOI] [PubMed] [Google Scholar]
  22. Haghikia, A. , Yanchev, G. R. , Kayacelebi, A. A. , Hanff, E. , Bledau, N. , Widera, C. , Sonnenschein, K. , Weissenborn, K. , Bauersachs, J. , Bavendiek, U. , & Tsikas, D. (2017). The role of L‐arginine/L‐homoarginine/nitric oxide pathway for aortic distensibility and intima‐media thickness in stroke patients. Amino Acids, 49, 1111–1121. [DOI] [PubMed] [Google Scholar]
  23. Hagos, Y. , Steffgen, J. , Rizwan, A. N. , Langheit, D. , Knoll, A. , Burckhardt, G. , & Burckhardt, B. C. (2006). Functional roles of cationic amino acid residues in the sodium‐dicarboxylate cotransporter 3 (NaDC‐3) from winter flounder. American Journal of Physiology‐Renal Physiology, 291, F1224–F1231. [DOI] [PubMed] [Google Scholar]
  24. Hallan, S. , & Sharma, K. (2016). The role of mitochondria in diabetic kidney disease. Current Diabetes Reports, 16, 61. [DOI] [PubMed] [Google Scholar]
  25. Hecker, M. , Walsh, D. T. , & Vane, J. R. (1991). On the substrate specificity of nitric oxide synthase. FEBS Letters, 294, 221–224. [DOI] [PubMed] [Google Scholar]
  26. Hong, Q. , Qi, K. , Feng, Z. , Huang, Z. , Cui, S. , Wang, L. , Fu, B. , Ding, R. , Yang, J. , Chen, X. , & Wu, D. (2012). Hyperuricemia induces endothelial dysfunction via mitochondrial Na+/Ca2+ exchanger‐mediated mitochondrial calcium overload. Cell Calcium, 51, 402–410. [DOI] [PubMed] [Google Scholar]
  27. Iorga, A. , Li, J. , Sharma, S. , Umar, S. , Bopassa, J. C. , Nadadur, R. D. , Centala, A. , Ren, S. , Saito, T. , Toro, L. , Wang, Y. , Stefani, E. , & Eghbali, M. (2016). Rescue of pressure overload‐induced heart failure by estrogen therapy. Journal of the American Heart Association, 5(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Iorga, A. , Umar, S. , Ruffenach, G. , Aryan, L. , Li, J. , Sharma, S. , Motayagheni, N. , Nadadur, R. D. , Bopassa, J. C. , & Eghbali, M. (2018). Estrogen rescues heart failure through estrogen receptor Beta activation. Biology of Sex Differences, 9, 48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Jha, J. C. , Ho, F. , Dan, C. , & Jandeleit‐Dahm, K. (2018). A causal link between oxidative stress and inflammation in cardiovascular and renal complications of diabetes. Clinical Science, 132, 1811–1836. [DOI] [PubMed] [Google Scholar]
  30. Jud, P. , Hafner, F. , Verheyen, N. , Meinitzer, A. , Gary, T. , Brodmann, M. , Seinost, G. , & Hackl, G. (2018). Homoarginine/ADMA ratio and homoarginine/SDMA ratio as independent predictors of cardiovascular mortality and cardiovascular events in lower extremity arterial disease. Scientific Reports, 8, 14197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kayacelebi, A. A. , Beckmann, B. , Gutzki, F. M. , Jordan, J. , & Tsikas, D. (2014). GC‐MS and GC‐MS/MS measurement of the cardiovascular risk factor homoarginine in biological samples. Amino Acids, 46, 2205–2217. [DOI] [PubMed] [Google Scholar]
  32. Kayacelebi, A. A. , Minovic, I. , Hanff, E. , Frenay, A. S. , de Borst, M. H. , Feelisch, M. , van Goor, H. , Bakker, S. J. L. , & Tsikas, D. (2017). Low plasma homoarginine concentration is associated with high rates of all‐cause mortality in renal transplant recipients. Amino Acids, 49, 1193–1202. [DOI] [PubMed] [Google Scholar]
  33. Liao, Y. , Hao, Y. , Chen, H. , He, Q. , Yuan, Z. , & Cheng, J. (2015). Mitochondrial calcium uniporter protein MCU is involved in oxidative stress‐induced cell death. Protein & Cell, 6, 434–442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Long, J. , Badal, S. S. , Ye, Z. , Wang, Y. , Ayanga, B. A. , Galvan, D. L. , Green, N. H. , Chang, B. H. , Overbeek, P. A. , & Danesh, F. R. (2016). Long noncoding RNA Tug1 regulates mitochondrial bioenergetics in diabetic nephropathy. Journal of Clinical Investigation, 126(11), 4205–4218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Luongo, T. S. , Lambert, J. P. , Yuan, A. , Zhang, X. , Gross, P. , Song, J. , Shanmughapriya, S. , Gao, E. , Jain, M. , Houser, S. R. , Koch, W. J. , Cheung, J. Y. , Madesh, M. , & Elrod, J. W. (2015). The mitochondrial calcium uniporter matches energetic supply with cardiac workload during stress and modulates permeability transition. Cell Reports, 12, 23–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Marz, W. , Meinitzer, A. , Drechsler, C. , Pilz, S. , Krane, V. , Kleber, M. E. , Fischer, J. , Winkelmann, B. R. , Bohm, B. O. , Ritz, E. , & Wanner, C. (2010). Homoarginine, cardiovascular risk, and mortality. Circulation, 122, 967–975. [DOI] [PubMed] [Google Scholar]
  37. Menke, A. , Casagrande, S. , Geiss, L. , & Cowie, C. C. (2015). Prevalence of and trends in diabetes among adults in the United States, 1988–2012. JAMA, 314, 1021–1029. [DOI] [PubMed] [Google Scholar]
  38. Moali, C. , Boucher, J. L. , Sari, M. A. , Stuehr, D. J. , & Mansuy, D. (1998). Substrate specificity of NO synthases: Detailed comparison of L‐arginine, homo‐L‐arginine, their N omega‐hydroxy derivatives, and N omega‐hydroxynor‐L‐arginine. Biochemistry, 37, 10453–10460. [DOI] [PubMed] [Google Scholar]
  39. Mohan, S. , Reddick, R. L. , Musi, N. , Horn, D. A. , Yan, B. , Prihoda, T. J. , Natarajan, M. , & Abboud‐Werner, S. L. (2008). Diabetic eNOS knockout mice develop distinct macro‐ and microvascular complications. Laboratory Investigation, 88, 515–528. [DOI] [PubMed] [Google Scholar]
  40. Moreno, J. A. , Gomez‐Guerrero, C. , Mas, S. , Sanz, A. B. , Lorenzo, O. , Ruiz‐Ortega, M. , Opazo, L. , Mezzano, S. , & Egido, J. (2018). Targeting inflammation in diabetic nephropathy: A tale of hope. Expert Opinion on Investigational Drugs, 27, 917–930. [DOI] [PubMed] [Google Scholar]
  41. Morris, S. M. Jr , Gao, T. , Cooper, T. K. , Kepka‐Lenhart, D. , & Awad, A. S. (2011). Arginase‐2 mediates diabetic renal injury. Diabetes, 60, 3015–3022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Natarajan, M. , Habib, S. L. , Reddick, R. L. , Delma, C. R. , Manickam, K. , Prihoda, T. J. , Werner, S. L. , & Mohan, S. (2019). Endothelial cell‐specific overexpression of endothelial nitric oxide synthase in Ins2Akita mice exacerbates diabetic nephropathy. Journal of Diabetes and Its Complications, 33, 23–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Nemani, N. , Shanmughapriya, S. , & Madesh, M. (2018). Molecular regulation of MCU: Implications in physiology and disease. Cell Calcium, 74, 86–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Pilz, S. , Edelmann, F. , Meinitzer, A. , Gelbrich, G. , Doner, U. , Dungen, H. D. , Tomaschitz, A. , Kienreich, K. , Gaksch, M. , Duvinage, A. , Stahrenberg, R. , Kunde, J. , Schmidt, A. , Marz, W. , Wachter, R. , & Pieske, B. (2014). Associations of methylarginines and homoarginine with diastolic dysfunction and cardiovascular risk factors in patients with preserved left ventricular ejection fraction. Journal of Cardiac Failure, 20, 923–930. [DOI] [PubMed] [Google Scholar]
  45. Pilz, S. , Meinitzer, A. , Gaksch, M. , Grübler, M. , Verheyen, N. , Drechsler, C. , Hartaigh, B. , Lang, F. , Alesutan, I. , Voelkl, J. , März, W. , & Tomaschitz, A. (2015). Homoarginine in the renal and cardiovascular systems. Amino Acids, 47, 1703–1713. [DOI] [PubMed] [Google Scholar]
  46. Pilz, S. , Teerlink, T. , Scheffer, P. G. , Meinitzer, A. , Rutters, F. , Tomaschitz, A. , Drechsler, C. , Kienreich, K. , Nijpels, G. , Stehouwer, C. D. , Marz, W. , & Dekker, J. M. (2014). Homoarginine and mortality in an older population: The Hoorn study. European Journal of Clinical Investigation, 44, 200–208. [DOI] [PubMed] [Google Scholar]
  47. Ravani, P. , Maas, R. , Malberti, F. , Pecchini, P. , Mieth, M. , Quinn, R. , Tripepi, G. , Mallamaci, F. , & Zoccali, C. (2013). Homoarginine and mortality in pre‐dialysis chronic kidney disease (CKD) patients. PLoS One, 8, e72694. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Rodionov, R. N. , Oppici, E. , Martens‐Lobenhoffer, J. , Jarzebska, N. , Brilloff, S. , Burdin, D. , Demyanov, A. , Kolouschek, A. , Leiper, J. , Maas, R. , Cellini, B. , Weiss, N. , & Bode‐Boger, S. M. (2016). A Novel pathway for metabolism of the cardiovascular risk factor homoarginine by alanine: Glyoxylate aminotransferase 2. Scientific Reports, 6, 35277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Ryan, W. L. , & Wells, I. C. (1964). Homocitrulline and homoarginine synthesis from lysine. Science, 144, 1122–1127. [DOI] [PubMed] [Google Scholar]
  50. Sharma, K. (2015). Mitochondrial hormesis and diabetic complications. Diabetes, 64, 663–672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Sobczak, A. , Prokopowicz, A. , Radek, M. , Szula, M. , Zaciera, M. , Kurek, J. , & Goniewicz, M. L. (2014). Tobacco smoking decreases plasma concentration of the emerging cardiovascular risk marker, L‐homoarginine. Circulation Journal, 78, 1254–1258. [DOI] [PubMed] [Google Scholar]
  52. Sun, L. , Xie, P. , Wada, J. , Kashihara, N. , Liu, F. Y. , Zhao, Y. , Kumar, D. , Chugh, S. S. , Danesh, F. R. , & Kanwar, Y. S. (2008). Rap1b GTPase ameliorates glucose‐induced mitochondrial dysfunction. Journal of the American Society of Nephrology, 19, 2293–2301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Tao, Z. , Shi, A. , & Zhao, J. (2015). Epidemiological perspectives of diabetes. Cell Biochemistry and Biophysics, 73, 181–185. [DOI] [PubMed] [Google Scholar]
  54. Tofuku, Y. , Muramoto, H. , Kuroda, M. , & Takeda, R. (1985). Impaired metabolism of guanidinoacetic acid in uremia. Nephron, 41, 174–178. [DOI] [PubMed] [Google Scholar]
  55. Tomar, D. , Jaña, F. , Dong, Z. , Quinn, W. J. , Jadiya, P. , Breves, S. L. , Daw, C. C. , Srikantan, S. , Shanmughapriya, S. , Nemani, N. , Carvalho, E. , Tripathi, A. , Worth, A. M. , Zhang, X. , Razmpour, R. , Seelam, A. , Rhode, S. , Mehta, A. V. , Murray, M. , … Madesh, M. (2019). Blockade of MCU‐mediated Ca. Cell Reports, 26, 3709–3725.e3707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Valtonen, P. , Laitinen, T. , Lyyra‐Laitinen, T. , Raitakari, O. T. , Juonala, M. , Viikari, J. S. , Heiskanen, N. , Vanninen, E. , Punnonen, K. , & Heinonen, S. (2008). Serum L‐homoarginine concentration is elevated during normal pregnancy and is related to flow‐mediated vasodilatation. Circulation Journal, 72, 1879–1884. [DOI] [PubMed] [Google Scholar]
  57. van der Zwan, L. P. , Davids, M. , Scheffer, P. G. , Dekker, J. M. , Stehouwer, C. D. , & Teerlink, T. (2013). L‐Homoarginine and L‐arginine are antagonistically related to blood pressure in an elderly population: The Hoorn study. Journal of Hypertension, 31, 1114–1123. [DOI] [PubMed] [Google Scholar]
  58. Vanstone, M. , Rewegan, A. , Brundisini, F. , Dejean, D. , & Giacomini, M. (2015). Patient perspectives on quality of life with uncontrolled type 1 diabetes mellitus: A systematic review and qualitative meta‐synthesis. Ontario Health Technology Assessment Series, 15, 1–29. [PMC free article] [PubMed] [Google Scholar]
  59. Vogl, L. , Pohlhammer, J. , Meinitzer, A. , Rantner, B. , Stadler, M. , Peric, S. , Hammerer‐Lercher, A. , Klein‐Weigel, P. , Fraedrich, G. , Kronenberg, F. , & Kollerits, B. (2015). Serum concentrations of L‐arginine and L‐homoarginine in male patients with intermittent claudication: A cross‐sectional and prospective investigation in the CAVASIC Study. Atherosclerosis, 239, 607–614. [DOI] [PubMed] [Google Scholar]
  60. Wang, C. H. , Li, F. , Hiller, S. , Kim, H. S. , Maeda, N. , Smithies, O. , & Takahashi, N. (2011). A modest decrease in endothelial NOS in mice comparable to that associated with human NOS3 variants exacerbates diabetic nephropathy. Proceedings of the National Academy of Sciences of the United States of America, 108, 2070–2075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wang, W. , Wang, Y. , Long, J. , Wang, J. , Haudek, S. B. , Overbeek, P. , Chang, B. H. , Schumacker, P. T. , & Danesh, F. R. (2012). Mitochondrial fission triggered by hyperglycemia is mediated by ROCK1 activation in podocytes and endothelial cells. Cell Metabolism, 15, 186–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Wetzel, M. D. , Gao, T. , Venkatachalam, M. , Morris, S. M. , & Awad, A. S. (2019). L‐homoarginine supplementation prevents diabetic kidney damage. Physiological Reports, 7(17), e14235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Woods, J. J. , Nemani, N. , Shanmughapriya, S. , Kumar, A. , Zhang, M. , Nathan, S. R. , Thomas, M. , Carvalho, E. , Ramachandran, K. , Srikantan, S. , Stathopulos, P. B. , Wilson, J. J. , & Madesh, M. (2019). A selective and cell‐permeable mitochondrial calcium uniporter (MCU) inhibitor preserves mitochondrial bioenergetics after hypoxia/reoxygenation injury. ACS Central Science, 5, 153–166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Xu, H. , Guan, N. , Ren, Y. L. , Wei, Q. J. , Tao, Y. H. , Yang, G. S. , Liu, X. Y. , Bu, D. F. , Zhang, Y. , & Zhu, S. N. (2018). IP3R‐Grp75‐VDAC1‐MCU calcium regulation axis antagonists protect podocytes from apoptosis and decrease proteinuria in an Adriamycin nephropathy rat model. BMC Nephrology, 19, 140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. You, H. , Gao, T. , Cooper, T. K. , Brian Reeves, W. , & Awad, A. S. (2013). Macrophages directly mediate diabetic renal injury. American Journal of Physiology‐Renal Physiology, 305, F1719–F1727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. You, H. , Gao, T. , Cooper, T. K. , Morris, S. M. Jr , & Awad, A. S. (2014). Diabetic nephropathy is resistant to oral L‐arginine or L‐citrulline supplementation. American Journal of Physiology Renal Physiology, 307, F1292–F1301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. You, H. , Gao, T. , Cooper, T. K. , Morris, S. M. , & Awad, A. S. (2015). Arginase inhibition: A new treatment for preventing progression of established diabetic nephropathy. American Journal of Physiology Renal Physiology, 309, F447–F455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. You, H. , Gao, T. , Raup‐Konsavage, W. M. , Cooper, T. K. , Bronson, S. K. , Reeves, W. B. , & Awad, A. S. (2017). Podocyte‐specific chemokine (C‐C motif) receptor 2 overexpression mediates diabetic renal injury in mice. Kidney International, 91(3):671–682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. You, Y. H. , Quach, T. , Saito, R. , Pham, J. , & Sharma, K. (2016). Metabolomics reveals a key role for fumarate in mediating the effects of NADPH oxidase 4 in diabetic kidney disease. Journal of the American Society of Nephrology, 27, 466–481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Yu, T. , Robotham, J. L. , & Yoon, Y. (2006). Increased production of reactive oxygen species in hyperglycemic conditions requires dynamic change of mitochondrial morphology. Proceedings of the National Academy of Sciences of the United States of America, 103, 2653–2658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Yuan, Z. , Cao, A. , Liu, H. , Guo, H. , Zang, Y. , Wang, Y. , Wang, Y. , Wang, H. , Yin, P. , & Peng, W. (2017). Calcium uptake via mitochondrial uniporter contributes to palmitic acid‐induced apoptosis in mouse podocytes. Journal of Cellular Biochemistry, 118, 2809–2818. [DOI] [PubMed] [Google Scholar]
  72. Zanchi, A. , Moczulski, D. K. , Hanna, L. S. , Wantman, M. , Warram, J. H. , & Krolewski, A. S. (2000). Risk of advanced diabetic nephropathy in type 1 diabetes is associated with endothelial nitric oxide synthase gene polymorphism. Kidney International, 57, 405–413. [DOI] [PubMed] [Google Scholar]
  73. Zhan, M. , Brooks, C. , Liu, F. , Sun, L. , & Dong, Z. (2013). Mitochondrial dynamics: Regulatory mechanisms and emerging role in renal pathophysiology. Kidney International, 83, 568–581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Zhao, H. J. , Wang, S. , Cheng, H. , Zhang, M. Z. , Takahashi, T. , Fogo, A. B. , Breyer, M. D. , & Harris, R. C. (2006). Endothelial nitric oxide synthase deficiency produces accelerated nephropathy in diabetic mice. Journal of the American Society of Nephrology, 17, 2664–2669. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Physiological Reports are provided here courtesy of Wiley

RESOURCES