Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Apr 1.
Published in final edited form as: Prostaglandins Other Lipid Mediat. 2021 Jan 5;153:106524. doi: 10.1016/j.prostaglandins.2020.106524

Trisomy 21 impairs PGE2 production in dermal fibroblasts

John O Marentette 1,2, Colin C Anderson 1,2, Kendra M Prutton 1,2, Erin Q Jennings 3, Abhishek K Rauniyar 1,2, James J Galligan 3, James R Roede 1,2,*
PMCID: PMC7965340  NIHMSID: NIHMS1665092  PMID: 33418267

Abstract

The triplication of human chromosome 21 results in Down syndrome (DS), the most common genetic form of intellectual disability. This aneuploid condition also results in an enhanced risk of a spectrum of comorbid conditions, such as leukemia, early onset Alzheimer’s disease, and diabetes. Individuals with DS also display an increased incidence of wound healing complications and resistance to solid tumor development. Due to this unique phenotype and the involvement of eicosanoids in key comorbidities like poor healing and tumor development, we hypothesized that cells from DS individuals would display altered eicosanoid production. Using age- and sex-matched dermal fibroblasts we interrogated this hypothesis. Briefly, assessment of over 90 metabolites derived from cyclooxygenase (COX), lipoxygenase (LOX), and cytochrome p450 systems revealed a possible deficiency in the COX system. Basal gene expression and Western blotting experiments showed significantly decreased gene expression of COX1 and 2, and COX2 protein abundance in DS fibroblasts compared to euploid controls. Further, using two different stressors, scratch wound or LPS, we found that DS fibroblasts could not upregulate COX2 abundance and prostaglandin E2 production. Together, these findings show that dermal fibroblasts from DS individuals have a deficient COX2 response, which may contribute to wound healing complications and tumor resistance in DS.

Keywords: COX2, PGE2, arachidonic acid, prostaglandin, Down syndrome

Introduction

Down syndrome (DS) results from the triplication of all or part of chromosome 21 and occurs at a rate of approximately 1 in 700 live births in the United States. DS represents the most common cause of intellectual disability; however, these individuals also are at risk of developing a large number of additional comorbid conditions like early onset Alzheimer’s disease, leukemia, and diabetes1–4. Additionally, individuals with DS are reported to display immunological disorders, wound healing complications, and resistance to solid tumors5–10. Much research has been conducted in describing disease phenotypes in individuals with DS; however, mechanistic explanation for these pathologies is still lacking.

Arachidonic acid-derived eicosanoids, which include prostaglandins, leukotrienes and lipoxins, are enzymatically generated by three different enzyme systems: cytochrome P450 (CYP), cyclooxygenase (COX), and lipoxygenase (LOX)11,12. These enzyme systems produce an array of lipid mediators that play extremely important roles in controlling a wide range of processes like vasodilation, coagulation, and chemotaxis11. Because of these properties, eicosanoids like prostaglandin E2 (PGE2) have been demonstrated to be critically important for inflammation, embryonic development, tissue regeneration and cancer13–15. For example, increased COX2 levels are observed in many cancer types like colorectal, liver, pancreas, breast and lung14. Additionally, children with congenital heart defects are treated with PGE2 while waiting for surgical correction of the defect16.

While individuals with DS display multiple phenotypes, like tumor resistance and wound healing dysfunction, that are potentially indicative of altered eicosanoid metabolism, few studies have investigated the production of arachidonic acid-derived eicosanoids. Here, we investigate eicosanoid metabolism in DS cells. Using age- and sex-matched dermal fibroblasts from DS and euploid individuals, we show DS fibroblasts possess a significant deficiency in expression and activity of the COX system. These data indicate that impaired PGE2 production in DS is a candidate mechanism contributing to congenital heart defects, tumor resistance, and impaired wound healing.

Materials and Methods

Chemicals and reagents

Lipopolysaccharide (LPS) (L4391) and primary antibody against Actin (A5441) were purchased from Sigma. COX-1 (160110) and PTGES (160140) primary antibodies were purchased from Cayman Chemical Company. The primary antibody against COX-2 (12282S) was purchased from Cell Signaling Technologies. Anti-Rabbit-HRP (HAF008) was purchased from R&D Systems. Anti-Mouse-HRP (115-035-003) was purchased from Jackson Laboratories and Anti-Mouse-488 (A11001) was purchased from Invitrogen.

Cell culture

Twelve fibroblast cell lines were obtained from the Coriell Institute for Medical Research. Human, dermal fibroblasts (passage 6 to passage 11) were cultured in Minimum Essential Medium Eagle including L-glutamine and Earle’s salts (Corning, 10–010-CV), with 10% or 15% fetal bovine serum (FBS) (Gibco-A31160601) and 1% non-essential amino acids (Gibco-11140050). Cells were subjected to manual scratches prior to Western blot collection. Cell lines used were chosen to represent an age range from infant to adult and incorporate both genders:

ID # Genotype Age Sex
GM00302 CTL 10mo M
AG07438 DS 9mo M
GM00969 CTL 2y F
AG05024 DS 1y F
AG07095 CTL 2y M
AG06922 DS 2y M
GM01651 CTL 13y F
GM00201 DS 13y F
AG10803 CTL 22y M
AG08942 DS 21y M
AG06103 CTL 29y M
GM04928 DS 27y M
Open in a new tab

Mass spectrometry analysis of eicosanoids

Sample preparation

All standards and internal standards used for LC/MS/MS analysis of arachidonic acid, docosahexaenoic acid and linoleic acid derived lipid mediators were purchased from Cayman Chemical (Ann Arbor, Michigan, USA). All HPLC solvents and extraction solvents were HPLC grade or better.

Cell media samples were pretreated for solid phase extraction. Briefly, proteins were precipitated from 500 μl of media by adding 500 μl of ice cold methanol and 10 μl of the internal standard solution (10 pg/μl each of 5(S)-HETE-d8, 8-iso-PGF2a-d4, 9(S)-HODE-d4, LTB4-d4, LTD4-d5, LTE4-d5, PGE2-d4, PGF2a-d9 and RvD2-d5 in ethanol) in a 2.0 ml microfuge tube, followed by vortexing and then incubating on ice for 15 min. The samples were then centrifuged for 10 min at 4°C at 14,000 RPM. The supernatant was transferred to a new microfuge tube and an additional 250 μl of ice-cold methanol was added to the first tube and the pellet was resuspended. The samples were then placed in a microcentrifuge for 10 min at 4°C at 14,000 RPM and the supernantant was removed and combined with the first supernatant. The sample was then dried in a vacuum centrifuge at 55°C. The sample was then immediately reconstituted in 1.0 ml of 90:10 water:methanol before purification by solid phase extraction (SPE).

The reconstituted extracts were loaded on a Strata-X 33 μm 30 mg/1ml SPE column (Phenomenex, Torrance, California, USA) preconditioned with 1.0 ml of methanol followed by 1.0 ml of water. The SPE column was then washed with 10% methanol and then eluted directly into a reduced surface activity/maximum recovery glass autosampler vial with 1.0 ml of methyl formate. The methyl formate was evaporated completely from the vial with a stream of nitrogen and then the SPE cartridge was then eluted with 1.0 ml of methanol directly into the same autosampler vial. The methanol was evaporated under N2 and the sample was reconstituted with 20 μl of ethanol. The samples were analyzed immediately or frozen at −70°C until analysis.

LC-MS/MS

Quantitation of lipid mediators was performed using two-dimensional reverse phase HPLC tandem mass spectrometry (LC/MS/MS). The HPLC system consisted of an Agilent 1260 autosampler (Agilent Technologies, Santa Clara, CA), an Agilent 1260 binary loading pump (pump 1), an Agilent 1260 binary analytical pump (pump 2) and a 6-port switching valve. Pump 1 buffers consisted of 0.1% formic acid in water (solvent A) and 9:1 v:v acetonitrile:water with 0.1% formic acid (solvent B). Pump 2 buffers consisted of 0.01% formic acid in water (solvent C) and 1:1 v:v acetonitrile:isopropanol (solvent D).

10 μl of extracted sample was injected onto an Agilent SB-C18 2.1×5mm 1.8um trapping column using pump 1 at 2ml/min for 0.5 minutes with a solvent composition of 97% solvent A: 3% solvent B. At 0.51 minutes the switching valve changed the flow to the trapping column from pump 1 to pump 2. The flow was reversed and the trapped lipid mediators were eluted onto an Agilent Eclipse Plus C-18 2.1×150mm 1.8um analytical column using the following gradient at a flow rate of 0.3mls/min: hold at 75% solvent A:25% solvent D from 0–0.5 minutes, then a linear gradient from 25–75% D over 20 minutes followed by an increase from 75–100% D from 20–21 minutes, then holding at 100% D for 2 minutes. During the analytical gradient pump 1 washed the injection loop with 100% B for 22.5 minutes at 0.2ml/min. Both the trapping column and the analytical column were re-equilibrated at starting conditions for 5 minutes before the next injection.

MS was performed on an Agilent 6490 triple quadrupole mass spectrometer in negative ionization mode. The drying gas was 250C at a flow rate of 15ml/min. The sheath gas was 350C at 12ml/min. The nebulizer pressure was 35psi. The capillary voltage was 3500V. Data for lipid mediators was acquired in dynamic MRM mode using experimentally optimized collision energies obtained by flow injection analysis of authentic standards. Calibration standards for each lipid mediator were analyzed over a range of concentrations from 0.25–250pg on column. Calibration curves for each lipid mediator were constructed using Agilent Masshunter Quantitative Analysis software. Samples were quantitated using the calibration curves to obtain the on column concentration, followed by multiplication of the results by the appropriate dilution factor to obtain the concentration in pg/ml.

Gene expression analyses

Fibroblasts were allowed to grow to 80–90% confluency and RNA was extracted using Trizol (Life Technologies) and RNA content quantified using a NanoDrop2000 (Thermo Scientific). cDNA was reverse transcribed from 1 μg RNA using the iScript gDNA Clear cDNA kit (Bio-Rad,1725035) and T100 Thermal Cycler (Bio-Rad, Hercules, CA). Gene expression was measured using 10 ng cDNA, Sso Advanced Universal Green Supemix (Bio-Rad, 1725274) and the CFX Connect Real Time PCR System (Bio-Rad, Hercules, CA). Primer sequences were obtained from the Harvard Primer Bank and purchased from Integrated DNA Technologies (IDT). Primers used were:

COX-1 - F 5’ CTCTGTGCCTAAAGATTGCCC 3’
COX-1 - R 5’ GTCTCCATAAATGTGGCCGAG 3’
COX-2 - F 5’ ATGCTGACTATGGCTACAAAAGC 3’
COX-2 - R 5’ TCGGGCAATCATCAGGCAC 3’
PTGES - F 5’ TCCTAACCCTTTTGTCGCCTG 3’
PTGES - R 5’ CGCTTCCCAGAGGATCTGC 3’
cPLA2α - F 5’ ATGGATGAAACTCTAGGGACAGC 3’
cPLA2α - R 5’ CTGGGCATGAGCAAACTTCAA 3’
EP1 - F 5’ AGCTTGTCGGTATCATGGTGG 3’
EP1 - R 5’ AAGAGGCGAAGCAGTTGGC 3’
EP2 - F 5’ GAAACCTCTTCCCGAAAGGAAA 3’
EP2 - R 5’ GACTGAACGCATTAGTCTCAGAA 3’
EP3 - F 5’ CGCCTCAACCACTCCTACAC 3’
EP3 - R 5’ GACACCGATCCGCAATCCTC 3’
EP4 - F 5’ CCGGCGGTGATGTTCATCTT 3’
EP4 - R 5’ CCCACATACCAGCGTGTAGAA 3’
Open in a new tab

Western blotting

For Western blotting, 20–30 μg of cell homogenate was separated via SDS-PAGE utilizing a 15% polyacrylamide gel. Trans-Blot Turbo transfer apparatus (Bio-Rad) was used to transfer proteins to a nitrocellulose membrane. 5% nonfat dried milk in TBS-0.1% Tween (TBS-T) was used for 20 min at room temperature to block the membranes. Primary antibodies were diluted in TBS-T containing 10% Super Block T20 (Thermo Scientific, 37536) at appropriate dilutions (1:500–1:1000) and allowed to bind to membranes overnight at 4°C. Blots were washed (3x) for 10 min in TBS-T and blots were then incubated with a horseradish peroxidase (HRP) conjugated secondary antibody at 1:5000 or an Alexa Fluor 488® secondary antibody diluted in TBS-T containing 10% Super Block T20. Clarity Western ECL Substrate (Bio-Rad, 1705060) was used to detect the HRP of the secondary antibody. A ChemiDoc MP imaging system and Image Lab software (Bio-Rad) were used to image and quantify blots. These experiments were conducted independently at least twice by utilizing 2–3 technical replicates in each experiment, and the images presented are representative samples.

Scratch-wound assay and Incucyte S3 live cell analysis

Approximately 30,000 cells were plated on a 96-well ImageLock Microplate (Essen Bioscience, Cat# 4379) and allowed to adhere overnight. Once confluent, the cells were scratched using the Woundmaker 96 (Essen Bioscience) and wound closure was measured every hour for 7 days on the Incucyte S3 live cell system. Results are reported as the time (h) it takes for the cells to reach 95% confluence. This was determined by the number of cells/cm2 migrating into the wound area using the IncuCyte S3 software and scratch wound function.

Targeted PGE2 analysis

Cells were plated in 10 cm culture dishes and allowed to reach ~80% confluence before 24h LPS (1 μg/mL) treatment. After 24h treatment, 4 mL of cell culture media was collected, spiked with 500 pmol of PGE2-d4 as an internal standard, and extracted with with 8 mL of ethyl acetate + 0.05% acetic acid. After 15 min, the organic layer was removed and dried under nitrogen. Samples were resuspended in methanol and chromatographed with a Shimadzu LC system equipped with a 50 × 2.1mm, 3μm particle diameter Atlantis C18 column (Waters, Milford, MA). Mobile phase A: 0.1% formic acid in H2O; mobile phase B: 0.1% formic acid in acetonitrile. With a flow rate of 0.450 mL/min the following gradient was used: 0.25 min, 25% B; 3.00 min, 99% B; 6.00 min, 99% B; 6.50 min, 25% B. The column was equilibrated for 2.5 min at 25% B. MRM was conducted in positive mode using an AB SCIEX 4500 QTRAP with the following transitions: m/z 351.2 → 271.2 (PGE2); m/z 355.2 → 275.2 (PGE2 d4).

PGE2 was quantified using the internal standard and normalized to total protein calculated from the cell pellet. Data is presented as nmol PGE2/mg protein.

Statistics

All data sets were analyzed and graphed using GraphPad v7. Statistical significance was determined using an unpaired student’s t-test, and Welch’s correction was utilized when applicable or two-way ANOVA with Sidak’s multiple comparison test. Experiments were conducted using independent 2–3 replications per experiment.

Results

Assessment of basal eicosanoid production suggests COX dysfunction in DS fibroblasts.

Results from previous studies in DS models have shown inconsistent results regarding both basal and stress-induced eicosanoid production17–22. Due to these previous studies, we investigated basal eicosanoid production in age- and sex-matched dermal fibroblasts from DS and euploid individuals (Figure 1). We analyzed both intracellular (Figure 1A) and extracellular/media (Figure 1B) concentrations of a panel of 90 different lipid mediators that are generated by COX, LOX, and CYP using a targeted, quantitative MS approach. Assessment of cellular extracts resulted in the detection of 9 different metabolites derived from the COX1/2, 15-LOX, and 12-LOX pathways. No differences were observed in the LOX-derived metabolites; however, COX1/2 metabolites PGF2a, PGE2, 6-keto-PGF1a and 12-HHTrE were observed to be decreased in the DS cells (Figure 1A). Secreted/media levels of both LOX and COX1/2 metabolites were found to be similar (Figure 1B).

Figure 1. DS fibroblasts display a slight deficit in the COX system at baseline.

Figure 1.

Open in a new tab

Five age- and sex-matched DS and euploid fibroblasts were extracted and basal oxylipin production was determined. Intracellular (A) and media (B) concentrations were determined via mass spectrometry. (N=5, mean ± SEM)

DS fibroblasts have decreased basal expression and protein abundance of COX1/2.

After observing differences in COX metabolites in the basal eicosanoid screen, we next investigated the expression and protein abundance of key genes in the COX pathway (Figure 2). Basal gene expression of both COX1 and COX2 were significantly decreased in DS fibroblasts (Figure 2A). Expression of other critical genes like phospholipases (PLA), prostaglandin receptors (EP), and prostaglandin E synthase (PTGES) were not different between DS and euploid fibroblasts. Similar to the gene expression results, western blots definitively show significantly decreased COX2 protein abundance in DS fibroblasts (Figure 2B&C). The abundance of COX1 was also decreased; however, this difference was not statistically significant.

Figure 2. Basal gene expression and protein abundance of the components of the COX system.

Figure 2.

Open in a new tab

Basal gene expression (A) shows decreased expression of both COX1 and COX1 in DS fibroblasts. Western blots (B) show that protein abundance of both COX1 and COX2 are decreased in DS fibroblasts (C). (N=6, mean ± SEM) *p<0.05 by unpaired students t-test.

DS fibroblasts are unable to induce COX2 and PGE2 production in response to stress.

COX2 is an important early response gene, where a stressor, e.g. LPS or wound, causes an increase in COX2 expression in order to produce high levels of PGE2 and other lipid mediators. In order to test the inducibility of COX2 in DS fibroblasts we subjected both DS and euploid cells to a scratch-wound assay. Results of this assay clearly illustrate that DS cells take significantly longer to proliferate and fill the wound area (Figure 3A). Gene expression analyses following these scratch wound assays showed that euploid cells induce COX2 expression more than two-fold, while DS fibroblasts failed to raise their expression to basal control levels (Figure 3B). We next investigated a stronger stimulus for inducing COX2, LPS exposure. Fibroblasts were treated with 1 μg/mL LPS for 24 hours and COX2 protein abundance and PGE2 release were assessed. Similar to the gene expression changes observed in response to the scratch wound (Figure 3), LPS treatment of euploid fibroblasts caused in a significant increase in COX2 protein (Figure 4A&B), resulting in significantly increased PGE2 production (Figure 4C). Furthermore, as previously observed in Figure 3, the large dose of LPS failed to increase COX2 protein abundance or PGE2 release in DS fibroblasts. Together, these data indicate that DS cells possess a significant defect in the induction of COX2 gene expression and PGE2 production.

Figure 3. DS fibroblasts fail to significantly up-regulate expression of COX2 in response to a scratch wound in vitro.

Figure 3.

Open in a new tab

Euploid and DS fibroblasts were subjected to a scratch wound and gene expression was evaluated 24 hours after the wound. DS fibroblasts took significantly longer to achieve 95% confluency in the scratch-wound assay (A). COX2 gene expression was induced by the scratch-wound in euploid fibroblasts, but DS fibroblasts lacked induction (B). (N=6, mean ± SEM) **p<0.01, ***p<0.001 by two-way ANOVA with Sidak’s multiple comparison test.

Figure 4. DS fibroblasts fail to significantly upregulated COX2 and PGE2 production in response to LPS.

Figure 4.

Open in a new tab

DS and euploid fibroblasts were treated with LPS (1ug/ml) for 24 hours and then COX2 protein abundance (A&B) and PGE2 release into the media (C) were quantified. (N=6, mean ± SEM) ***p<0.001 by two-way ANOVA with Sidak’s multiple comparison test.

Discussion

The goal of this study was to investigate eicosanoid metabolism in DS compared to euploid controls. Our findings show that basal gene expression and protein abundance for COX1 and COX2 are decreased in DS fibroblasts regardless of donor age or sex. Further, we utilized two different stressors, scratch-wound and LPS, to assess inducibility of the COX system and found that DS fibroblasts were unable to significantly induce COX2 expression, protein abundance and PGE2 release. Together, our data indicate that COX2 gene expression is significantly hindered in dermal fibroblasts from individuals with DS. While it has been shown that COX-2 abundance23 and PGE2 production24 can vary with age, in our present study we utilized six pairs of age- and sex-matched dermal fibroblasts spanning an age range from infant to adult and found no significant age or sex related differences.

Previous research groups have reported COX2 expression and/or PGE2 production in DS models17–22. These reports do not provide a clear conclusion, as these studies report both increases and decreases in COX2 expression and PGE2 release. For example, due to an increased prevalence of gingivitis in individuals with DS, studies have shown increased expression of COX2 and increased PGE2 release in gingival fibroblasts21. Additionally, gingival crevicular fluid from individuals with DS has been reported to have significantly higher concentrations of PGE2 compared to euploid controls17,22. Further, COX2 has been shown to be induced in the DS brain, as well as the brain of a common DS mouse model, Ts65dn19,20. However, similar to the results presented here, cultured DS fibroblasts derived from amniotic cells displayed decreased PGE2 release compared to euploid controls18. Collectively, these observations confirm cell-type and organ specific COX2 expression25.

PGE2 is a critical inflammatory mediator that regulates a host of processes, like immune function and wound healing13. Examples of these processes include keratinocyte differentiation, fibroblast proliferation, vasodilation, coagulation, and neutrophil chemotaxis11,26,27. Via autocrine and paracrine mechanisms, PGE2 can regulate the production of other inflammatory mediators in a variety of cell types including fibroblasts, lymphocytes, macrophages and epithelial cells. For example, PGE2 is a negative regulator of proinflammatory cytokines, IFN-γ and TNF-α by switching the inflammatory response from a pro-inflammatory TH1 type to an anti-inflammatory TH2 response through the inhibition of interleukin 2 (IL-2) synthesis in lymphocytes28. With regard to DS, increased circulating levels of IFN-γ and TNF-α are observed in individuals with DS, and DS has been further characterized as an interferonopathy9,10,29. In addition, wound healing complications are reported to occur at a higher rate in individuals with DS6–8,30. Additionally, PGE2 is associated with promoting M2 macrophage activity accelerating tissue repair31. Furthermore, it has been well established that knockout of PTGES, and therefore a lack of PGE2 production, impairs epithelial proliferation and delays healing after chemical ulceration in mouse models32,33. These previous observations and our results presented here indicate that it is likely that the lack of adequate PGE2 production contributes to wound healing dysfunction and interferonopathy in DS.

A unique phenotype that has been observed in the population of individuals with DS is the decreased risk of solid tumor formation5. COX2 has been reported to be upregulated in many cancer types, like colorectal, lung, and breast. COX2-derived PGE2 also induces proliferation and epithelial-mesenchymal transition in tumor cells. Additionally, non-steroidal anti-inflammatory drugs have been reported to lower the risk of developing some solid tumors14. Therefore, it is quite possible that this PGE2 depletion phenotype could be a candidate mechanism for the investigation of reduced tumor risk in DS. Further, nearly one-half of all children with trisomy 21 will be born with congenital heart defects34. Interestingly, PGE2 therapy has been provided to children awaiting surgical correction of this defect35. Also, studies in zebrafish have shown that COX2 activity is necessary for heart development and inhibition of activity by celecoxib results in impaired cardiac development36. Again, these observations combined with our results indicate that the lack of COX2 induction and activity in DS cells are candidate mechanisms contributing to both decreased tumorigenesis and cardiac defects observed in the DS population.

In summary, we have definitively shown that DS dermal fibroblasts have a muted COX2 response to both mechanical and chemical stressors. Due to the pleiotropic effects of COX2-derived PGE2, it is possible that this PGE2 deficiency is mechanistically linked to altered physiology in DS like impaired wound healing and is a potential candidate mechanism for decreased risk of tumorigenesis.

Highlights.

  • Basal gene expression and protein abundance of COX1 and COX2 are decreased in dermal fibroblasts from Down syndrome individuals

  • Down syndrome fibroblasts proliferate slower in the context of a scratch wound, most likely due to deficient PGE2 production

  • LPS exposure fails to upregulate COX2 and PGE2 production in Down syndrome fibroblasts

Acknowledgements

The authors would like to thank Dr. Nichole Reisdorph, Michael Armstrong, and the School of Pharmacy Mass Spectrometry Core for their assistance with the initial oxylipin screen. This research was supported by funds provided by the National Institutes of Health (R01 ES027593-02S2 (JRR), T32 ES029074 (CCA), R35 GM137910 (JJG), T32 ES007091 (EQJ)).

References

  • 1.Real de Asua D, Quero M, Moldenhauer F, Suarez C. Clinical profile and main comorbidities of Spanish adults with Down syndrome. Eur J Intern Med. 2015;26(6):385–391. [DOI] [PubMed] [Google Scholar]
  • 2.Bittles AH, Bower C, Hussain R, Glasson EJ. The four ages of Down syndrome. Eur J Public Health. 2007;17(2):221–225. [DOI] [PubMed] [Google Scholar]
  • 3.Zipursky A, Poon A, Doyle J. Leukemia in Down syndrome: a review. Pediatr Hematol Oncol. 1992;9(2):139–149. [DOI] [PubMed] [Google Scholar]
  • 4.Hartley D, Blumenthal T, Carrillo M, et al. Down syndrome and Alzheimer’s disease: Common pathways, common goals. Alzheimers Dement. 2015;11(6):700–709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hasle H, Friedman JM, Olsen JH, Rasmussen SA. Low risk of solid tumors in persons with Down syndrome. Genet Med. 2016;18(11):1151–1157. [DOI] [PubMed] [Google Scholar]
  • 6.Caird MS, Wills BP, Dormans JP. Down syndrome in children: the role of the orthopaedic surgeon. J Am Acad Orthop Surg. 2006;14(11):610–619. [DOI] [PubMed] [Google Scholar]
  • 7.Doyle JS, Lauerman WC, Wood KB, Krause DR. Complications and long-term outcome of upper cervical spine arthrodesis in patients with Down syndrome. Spine (Phila Pa 1976). 1996;21(10):1223–1231. [DOI] [PubMed] [Google Scholar]
  • 8.Mik G, Gholve PA, Scher DM, Widmann RF, Green DW. Down syndrome: orthopedic issues. Curr Opin Pediatr. 2008;20(1):30–36. [DOI] [PubMed] [Google Scholar]
  • 9.Sullivan KD, Evans D, Pandey A, et al. Trisomy 21 causes changes in the circulating proteome indicative of chronic autoinflammation. Sci Rep. 2017;7(1):14818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sullivan KD, Lewis HC, Hill AA, et al. Trisomy 21 consistently activates the interferon response. Elife. 2016;5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Harizi H, Corcuff JB, Gualde N. Arachidonic-acid-derived eicosanoids: roles in biology and immunopathology. Trends Mol Med. 2008;14(10):461–469. [DOI] [PubMed] [Google Scholar]
  • 12.Tapiero H, Ba GN, Couvreur P, Tew KD. Polyunsaturated fatty acids (PUFA) and eicosanoids in human health and pathologies. Biomed Pharmacother. 2002;56(5):215–222. [DOI] [PubMed] [Google Scholar]
  • 13.Dennis EA, Norris PC. Eicosanoid storm in infection and inflammation. Nat Rev Immunol. 2015;15(8):511–523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wang D, Dubois RN. Eicosanoids and cancer. Nat Rev Cancer. 2010;10(3):181–193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Niringiyumukiza JD, Cai H, Xiang W. Prostaglandin E2 involvement in mammalian female fertility: ovulation, fertilization, embryo development and early implantation. Reproductive biology and endocrinology : RB&E. 2018;16(1):43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Singh Y, Mikrou P. Use of prostaglandins in duct-dependent congenital heart conditions. Arch Dis Child Educ Pract Ed. 2018;103(3):137–140. [DOI] [PubMed] [Google Scholar]
  • 17.Barr-Agholme M, Krekmanova L, Yucel-Lindberg T, Shinoda K, Modeer T. Prostaglandin E2 level in gingival crevicular fluid from patients with Down syndrome. Acta Odontol Scand. 1997;55(2):101–105. [DOI] [PubMed] [Google Scholar]
  • 18.Minc-Golomb D, Knobler H, Groner Y. Gene dosage of CuZnSOD and Down’s syndrome: diminished prostaglandin synthesis in human trisomy 21, transfected cells and transgenic mice. The EMBO journal. 1991;10(8):2119–2124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mulet M, Blasco-Ibanez JM, Crespo C, Nacher J, Varea E. Early increased density of cyclooxygenase-2 (COX-2) immunoreactive neurons in Down syndrome. Folia Neuropathol. 2017;55(2):154–160. [DOI] [PubMed] [Google Scholar]
  • 20.Oka A, Takashima S. Induction of cyclo-oxygenase 2 in brains of patients with Down’s syndrome and dementia of Alzheimer type: specific localization in affected neurones and axons. Neuroreport. 1997;8(5):1161–1164. [DOI] [PubMed] [Google Scholar]
  • 21.Otsuka Y, Ito M, Yamaguchi M, et al. Enhancement of lipopolysaccharide-stimulated cyclooxygenase-2 mRNA expression and prostaglandin E2 production in gingival fibroblasts from individuals with Down syndrome. Mech Ageing Dev. 2002;123(6):663–674. [DOI] [PubMed] [Google Scholar]
  • 22.Tsilingaridis G, Yucel-Lindberg T, Modeer T. Enhanced levels of prostaglandin E2, leukotriene B4, and matrix metalloproteinase-9 in gingival crevicular fluid from patients with Down syndrome. Acta Odontol Scand. 2003;61(3):154–158. [DOI] [PubMed] [Google Scholar]
  • 23.Li Y, Lei D, Swindell WR, et al. Age-Associated Increase in Skin Fibroblast-Derived Prostaglandin E2 Contributes to Reduced Collagen Levels in Elderly Human Skin. The Journal of investigative dermatology. 2015;135(9):2181–2188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Badawi AF, Liu Y, Eldeen MB, et al. Age-associated changes in the expression pattern of cyclooxygenase-2 and related apoptotic markers in the cancer susceptible region of rat prostate. Carcinogenesis. 2004;25(9):1681–1688. [DOI] [PubMed] [Google Scholar]
  • 25.Zidar N, Odar K, Glavac D, Jerse M, Zupanc T, Stajer D. Cyclooxygenase in normal human tissues--is COX-1 really a constitutive isoform, and COX-2 an inducible isoform? J Cell Mol Med. 2009;13(9B):3753–3763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Loynes CA, Lee JA, Robertson AL, et al. PGE2 production at sites of tissue injury promotes an anti-inflammatory neutrophil phenotype and determines the outcome of inflammation resolution in vivo. Sci Adv. 2018;4(9):eaar8320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Goessling W, North TE, Loewer S, et al. Genetic interaction of PGE2 and Wnt signaling regulates developmental specification of stem cells and regeneration. Cell. 2009;136(6):1136–1147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Betz M, Fox BS. Prostaglandin E2 inhibits production of Th1 lymphokines but not of Th2 lymphokines. Journal of immunology. 1991;146(1):108–113. [PubMed] [Google Scholar]
  • 29.Zhang Y, Che M, Yuan J, et al. Aberrations in circulating inflammatory cytokine levels in patients with Down syndrome: a meta-analysis. Oncotarget. 2017;8(48):84489–84496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Iwamoto T, Yamada A, Yuasa K, et al. Influences of interferon-gamma on cell proliferation and interleukin-6 production in Down syndrome derived fibroblasts. Arch Oral Biol. 2009;54(10):963–969. [DOI] [PubMed] [Google Scholar]
  • 31.Allen JE, Wynn TA. Evolution of Th2 immunity: a rapid repair response to tissue destructive pathogens. PLoS Pathog. 2011;7(5):e1002003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Hara S, Kamei D, Sasaki Y, Tanemoto A, Nakatani Y, Murakami M. Prostaglandin E synthases: Understanding their pathophysiological roles through mouse genetic models. Biochimie. 2010;92(6):651–659. [DOI] [PubMed] [Google Scholar]
  • 33.Ae T, Ohno T, Hattori Y, et al. Role of microsomal prostaglandin E synthase-1 in the facilitation of angiogenesis and the healing of gastric ulcers. American journal of physiology Gastrointestinal and liver physiology. 2010;299(5):G1139–1146. [DOI] [PubMed] [Google Scholar]
  • 34.Freeman SB, Taft LF, Dooley KJ, et al. Population-based study of congenital heart defects in Down syndrome. Am J Med Genet. 1998;80(3):213–217. [PubMed] [Google Scholar]
  • 35.Olley PM, Coceani F, Bodach E. E-type prostaglandins: a new emergency therapy for certain cyanotic congenital heart malformations. Circulation. 1976;53(4):728–731. [DOI] [PubMed] [Google Scholar]
  • 36.Xu DJ, Bu JW, Gu SY, Xia YM, Du JL, Wang YW. Celecoxib impairs heart development via inhibiting cyclooxygenase-2 activity in zebrafish embryos. Anesthesiology. 2011;114(2):391–400. [DOI] [PubMed] [Google Scholar]

RESOURCES