Skip to main content
Immunology logoLink to Immunology
. 2021 Jan 24;162(4):418–433. doi: 10.1111/imm.13294

The role of neuraminidase in TLR4‐MAPK signalling and the release of cytokines by lupus serum‐stimulated mesangial cells

Kamala Sundararaj 1, Jessalyn Rodgers 1, Peggi Angel 2, Bethany Wolf 3, Tamara K Nowling 1,✉
PMCID: PMC7968401  PMID: 33314123

Summary

Previously, we demonstrated neuraminidase (NEU) activity or NEU1 expression, specifically, is increased in the kidneys of lupus mice and urine of human patients with nephritis. Additionally, NEU activity mediates IL‐6 secretion from lupus‐prone MRL/lpr primary mouse mesangial cells (MCs) in response to an IgG mimic. IL‐6 mediates glomerular inflammation and promotes tissue damage in patients and mouse strains with lupus nephritis. This study further elucidates the mechanisms by which NEU activity and NEU1 specifically mediates the release of IL‐6 and other cytokines from lupus‐prone MCs. We demonstrate significantly increased release of multiple cytokines and NEU activity in MRL/lpr MCs in response to serum from MRL/lpr mice (lupus serum). Inhibiting NEU activity significantly reduced secretion of three of those cytokines: IL‐6, GM‐CSF and MIP1α. Message levels of Il‐6 and Gm‐csf were also increased in response to lupus serum and reduced when NEU activity was inhibited. Neutralizing antibodies to cell‐surface receptors and MAPK inhibitors in lupus serum‐ or LPS‐stimulated MCs indicate TLR4 and p38 or ERK MAP kinase signalling play key roles in the NEU‐mediated secretion of IL‐6. Significantly reduced IL‐6 release was observed in C57BL/6 (B6) Neu1+/+ primary MCs compared with wild‐type (Neu1+/+) B6 MCs in response to lupus serum. Additional results show inhibiting NEU activity significantly increases sialic acid‐containing N‐glycan levels. Together, our novel observations support a role for NEU activity, and specifically NEU1, in mediating release of IL‐6 from lupus‐prone MCs in response to lupus serum through a TLR4‐p38/ERK MAPK signalling pathway that likely includes desialylation of glycoproteins.

Keywords: interleukin‐6, lupus, mesangial cell, mitogen‐activated protein kinase, neuraminidase, Toll‐like receptor 4


Primary lupus prone MRL/lpr mesangial cells release significant amounts of cytokines IL‐6 and GM‐CSF in response to lupus serum in part through TLR4. Blocking neuraminidase activity inhibits this cytokine release and MAPK ERK and p38 signaling. These results suggest NEU activity plays a role in cytokine release through a TLR4‐MAPK pathway.

graphic file with name IMM-162-418-g004.jpg


Abbreviations

B6

C57BL/6

GSL

glycosphingolipid

LN

lupus nephritis

LPS

lipopolysaccharide

LS

lupus serum

MCs

Mesangial cells

NEU

neuraminidase

NEU1‐NEU4

neuraminidase 1‐4

OP

oseltamivir phosphate

SAs

sialic acids

SLE

systemic lupus erythematosus

INTRODUCTION

Systemic lupus erythematosus (SLE) is an inflammatory, chronic autoimmune disorder involving multiple organs. Defects in the clearance of apoptotic cells lead to intracellular autoantigen release, autoantibody production, and immune complex deposition and inflammation in target organs. Glomerulonephritis is the leading cause of morbidity and mortality in lupus patients; however, the mediators of lupus nephritis (LN) remain incompletely known. Glycosphingolipid (GSL) metabolism is altered in lupus patients and lupus‐prone mice with nephritis compared with their non‐nephritis counterparts and healthy controls, 1 sharing similarities with other chronic kidney diseases shown to be mediated by GSL metabolism. 2 , 3 , 4 , 5 However, the precise mechanisms by which GSL metabolism impacts chronic kidney diseases, including lupus nephritis, have not been elucidated. Proinflammatory cytokines are elevated in the kidney of mice and patients with lupus. IL‐6 in particular plays a key role in the onset of nephritis in lupus mice. 6 , 7 , 8 , 9 , 10 , 11 Altered GSL metabolism in MRL/lpr kidneys included increased activity of neuraminidase, 1 which we demonstrated mediates IL‐6 release from primary MRL/lpr mesangial cells (MCs) stimulated with an IgG mimic or serum from MRL/lpr mice in vitro. 12

Four mammalian neuraminidases (NEUs) (or sialidases) remove sialic acids from glycolipids and glycoproteins. NEU1 is typically located in the lysosome and translocated to the plasma membrane of many cell types upon activation. 13 , 14 , 15 , 16 NEU2 and NEU3 are located in the cytosol and plasma membrane, respectively, 17 , 18 while NEU4 is found in the mitochondria and lysosome. 19 , 20 NEUs also differ somewhat in substrate specificities and tissue distribution. NEU1 is ubiquitously expressed and is the major NEU expressed in the kidney. 17 , 19 , 21 , 22 , 23 , 24 The only other NEU detectable in the kidney is NEU3 with message levels of Neu1 expressed approximately 40‐fold higher than Neu3, 19 and NEU1 and NEU3 proteins are readily detected in the glomeruli of renal tissue sections of MRL/lpr lupus mice. 12 While NEU1 was largely observed to desialylate glycoproteins, NEU3 showed a preference for glycolipids (gangliosides) 25 , 26 , 27 , 28 , 29 and their activity at the plasma membrane impacts receptor activation and signalling in a variety of cell types. 29 , 30 , 31 , 32 , 33 , 34 , 35

To extend our previous studies and further elucidate the mechanisms by which NEU activity mediates MC function, we investigated the potential signalling pathways involved in NEU‐mediated cytokine release in response to lupus serum. The activation of lupus‐prone MCs by soluble mediators present in lupus serum is not well established. Using lupus serum as a disease‐relevant stimulator, we determined NEU activity mediates the release of GM‐CSF and MIP1α in addition to IL‐6 by MRL/lpr lupus‐prone primary MCs. NEU activity likely mediates IL‐6 release directly, while effects on GM‐CSF and MIP1α release are likely indirectly mediated by NEU activity. NEU‐mediated release of IL‐6 occurs in part through TLR4‐MAPK p38 or ERK signalling pathways in response to lupus serum. We also provide evidence supporting NEU‐mediated cytokine release by MCs may involve removal of sialic acid residues from specific N‐glycans.

MATERIALS AND METHODS

Reagents

Antibodies used include anti‐FcγR3 (anti‐CD16, rat anti‐mouse, #MAB19601) and anti‐TNFR1/TNFRSF1A (hamster anti‐mouse, #MAB430100) from R&D Systems; anti‐FcγR2/3 (anti‐CD16/CD32, rat anti‐mouse, #101301), anti‐FcγR4 (anti‐CD16.2, hamster anti‐mouse, #149502), anti‐TLR2 (rat or mouse anti‐mouse, #148601 or #121801) and anti‐TLR4/MD2 (rat anti‐mouse, #117607) from BioLegend; anti‐TNFR2 (hamster anti‐mouse, #BE0247) from BioXCell; anti‐Annexin A2 (Abcam); isotype controls hamster IgG (#400901) and mouse IgG (#400101) and rat IgG (#400501) from BioLegend; and phospho‐p38 MAPK (Thr180/Tyr182, rabbit anti‐mouse/human, #9211), p38 MAPK (rabbit anti‐mouse/human, #9212), phospho‐p44/42 ERK1/2 MAPK (Thr202/Tyr204, rabbit anti‐mouse/human, #9101) and p44/42 ERK1/2 MAPK (rabbit anti‐mouse/human, #9102) from Cell Signaling, Inc. Inhibitors used include the following: oseltamivir phosphate (Santa Cruz Biotechnology); ERK MAPK inhibitor U0126, JNK MAPK inhibitor SP600125 and PI3K inhibitor wortmannin (Calbiochem); and p38 MAPK inhibitor SB203580 (AdipoGen). Ultra‐pure lipopolysaccharide (LPS) (Invivogen) was used for MC stimulation.

Mice and lupus serum collection

All animal studies and methods of euthanasia were approved by the local Institutional Animal Care and Use Committee (IACUC) and complied with ARRIVE guidelines. Breeding pairs of MRL/lpr mice were purchased (Stock #000485, Jackson Laboratory, Bar Harbor, ME) and bred in‐house. Breeding pairs for C57BL/6 Neu1 ± mice 36 were generously provided by Dr Alessandra d’Azzo from St. Jude's Children's Research Hospital and bred in‐house. Mice were maintained on a 12‐h light–dark cycle in groups of 3–5 per cage in a pathogen‐free environment with access to food and water ad libitum. Blood was collected from 3 to 4 MRL/lpr or C57BL/6 female or male mice at 16–18 weeks of age and pooled by sex. Serum was collected after centrifugation of coagulated blood and is referred to as lupus serum (LS) and B6 serum (B6) in the text and figures. Each pooled serum collection was tested for endotoxin using Pierce Chromogenic Endotoxin Quantification Kit (Thermo Scientific), and only serum collections with undetectable levels of endotoxin were used for experiments. Both female and male serum stimulated significant cytokine production.

Generation and culturing of primary mesangial cell lines

Two independent mouse primary mesangial cell lines (MCs), established using glomeruli pooled from 3 to 4 six‐week‐old female MRL/lpr mice and described and characterized previously, 12 were used for experiments. Kidney glomeruli were isolated from 6‐week‐old female C57BL/6 Neu1+/+ and C57BL/6 Neu1 ± mice for generation and characterization of two independent primary cell lines (B6 MCs) as described previously. 12 As Neu1‐/‐ mice develop a kidney phenotype, 36 we isolated MCs from Neu1 ± mice to avoid potential confounding factors in using Neu1‐/‐ MCs. Neu1 genotype of each B6 MC line was confirmed via PCR as described previously. 36 Cultures were routinely tested for mycoplasma (Applied StemCell, Inc), and only mycoplasma‐negative cultures were used in experiments. Cells were grown in a 5% CO2 atmosphere at 37°C in MEM/d‐valine medium with 20% fetal bovine serum, 1% penicillin/streptomycin and ITS supplement (5 μg/ml insulin, 5 μg/ml transferrin, 5 ng/ml sodium selenite) (GenDEPOT, Houston, TX; Sigma‐Aldrich) and used at passages 6–9. Cells were serum‐starved overnight prior to stimulation with lupus serum, B6 serum or LPS at the concentrations indicated and for the time indicated in the figures or figure legends. Results from each cell line showed similar trends with data presented from one line. Extent of cytokine release varied from experiment to experiment in response to lupus serum depending on the pooled serum collection used. All statistically significant changes reported using lupus serum were calculated after combining replicate experiments and adjusting for serum ‘batch’ differences as described in Statistical analyses section below, and the graphs presented are from a representative experiment.

Cells were pretreated with 500 μM oseltamivir phosphate (OP), an inhibitor of NEU activity, for 16 h, 40 μg/ml antibodies for 2 h or 10 μM MAPK/PI3K inhibitors for 2 h, or relevant vehicle/IgG for the same time prior to stimulation. Our previously published data demonstrated a dose‐dependent inhibition of IL‐6 release by MRL/lpr MCs using 125–500 μM OP. 12 A dose of 125 μM inhibited IL‐6 by >50% in response to stimulation with lupus serum and 500 μM provided >90% inhibition and was similar to what was observed in other cell types. 32 , 37 Thus, we chose to use a concentration that maximally inhibited IL‐6. Importantly, this concentration of OP was not toxic to the cells as assessed by trypan blue exclusion and cell counting, and measuring total protein content, which varied less than 1% across treatments in all experiments. This was confirmed using a cell viability MTT assay following the manufacturer's instructions (BioAssay Systems) (Figure S1).

Neuraminidase activity assay

Primary MRL/lpr MCs (20 000 cells per well) were grown in a CoStar 3603 black 96‐well clear‐bottom plate, serum‐starved, pretreated with 500 μM OP and stimulated with 10% lupus serum or 5 ng/ml LPS for 3 h. Primary B6 Neu1+/+ and B6 Neu1 ± MCs (20 000 cells per well) were grown in a CoStar 3603 black 96‐well clear‐bottom plate, and serum‐starved prior to stimulation with 20% lupus serum for 3 h. After incubation, media were collected, and cells were washed with 37°C warm sterile‐filtered Tris‐buffered saline (TBS), pH 7.4. Cells were incubated with 15 μM substrate 2′ (4‐methylumbelliferyl)‐α‐D‐N‐acetylneuraminic acid (4MU‐NANA) at 37°C in TBS (Sigma‐Aldrich). Fluorescence intensity (excitation: 365 nm, emission: 460 nm) in the absence of substrate (baseline) and after a 15’ incubation with substrate was measured using a SpectraMax i3c fluorometer with SoftMax Pro 6 software (Molecular Devices). NEU activity is presented as relative fluorescence units (RFU) per 2 × 104 cells. Total protein content was consistent between untreated and treated cells. Significant differences were determined by one‐way ANOVA with Tukey's multiple comparisons test. Adjusted p‐values are presented.

FlexMap 3D and ELISA analyses

To determine cytokines and chemokines in addition to IL‐6 potentially mediated by NEU activity, primary MRL/lpr MCs were incubated with increasing concentrations of lupus serum (5%, 10% and 20%), 20% C57BL/6 serum or 10% lupus serum following pretreatment with increasing concentrations of OP (125, 250 and 500 μM) (as described above). Cells were pretreated with OP 16 h prior to addition of lupus serum for 6 h. MC supernatants were analysed by multiplex bead array analysis using a FlexMap3D platform (Luminex) and Cytokine Mouse Magnetic 20‐Plex Panel Kit (Invitrogen/Thermo Fisher Scientific). The FlexMap3D results were confirmed by individual commercially available enzyme‐linked immunoassay (ELISA) detection kits to measure IL‐6 (BioLegend), GM‐CSF (R&D systems, Minneapolis, MN) and MIP1α (R&D systems) in primary MC supernatants according to the manufacturer's instructions. Protein concentration of cells was measured using a Micro BCA Protein Assay Kit (Thermo Scientific) and used to normalize cytokine levels with final concentrations adjusted to an equivalent of 25 μg of protein for comparison across experiments.

Real‐time PCR

Total RNA was extracted from primary MCs using the RNeasy kit (Qiagen) according to the manufacturer's instructions, and cDNA was reverse‐transcribed with 0.5–1 μg RNA using the iScript cDNA synthesis kit as described in the kit (Bio‐Rad). The gene expression of Il‐6, Gm‐csf and Mip1α and housekeeping gene β‐actin was evaluated by quantitative RT‐PCR using the LightCycler 480 SYBR Green 1 Master Kit and LightCycler 480 II (Roche) and oligos: mIl‐6 Forward 5′‐TAGTCCTTCCTACCCCAATTTCC‐3′ and Reverse 5′‐TTGGTCCTTAGCCACTCCTTC‐3′; mGm‐csf Forward 5′‐GGCCTTGGAAGCATGTAGAGG‐3′ and Reverse 5′‐GGAGAACTCGTTAGAGACGACTT‐3′; mMip1α Forward 5′‐ACTGCCTGCTGCTTCTCCTACA‐3′ and Reverse 5′‐AGGAAAATGACACCTGGCTGG‐3′; mNeu1 Forward 5′‐ACGATGTAGACACAGGGATAGTG‐3′ and Reverse 5′‐GTCGTCCTTACTCCAAACCAAC‐3′; and mβ‐actin Forward 5′‐AGATTACTGCTCTGGCTCCTAG‐3′ and Reverse 5′‐CCTGCTTGCTGATCCACATC‐3′. The PCR mixture was heated initially at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 10 s and combined annealing/extension at 60°C for 30 s. All reactions were performed in triplicate and normalized to β‐actin. Gene expression data analysis was performed by using the comparative threshold cycle (CT) method as performed previously 12 .

Immunoblotting

Mesangial cell extracts were prepared by incubating cells with RIPA buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1% Triton‐X‐100, 0.5% Na‐deoxycholate, 0.1% SDS, 25 mM DTT, 10 mM EDTA, 1 mM PMSF). After centrifugation at 4°C for 10 min at 20 000 xg, the supernatant was collected and protein concentration was determined using a Micro BCA Assay (Pierce/Thermo Scientific). Samples (20–40 μg per well) were electrophoresed in a 4%–20% Criterion TGX Gel (Bio‐Rad), and transferred to a polyvinylidene difluoride membrane. Total and phosphorylated MAPKs were immunoblotted with antibodies to total and phosphorylated forms of p38 and ERK MAPK and detected with an anti‐rabbit biotin antibody (Thermo Scientific) followed by an Alexa Fluor 647–streptavidin‐conjugated antibody (Life Technologies). Blots were scanned using Odyssey Infrared Imaging System and software (LI‐COR), and band density was quantified using NIH ImageJ. The results are presented as the ratios of phosphorylated to total p38 or ERK MAPK. An additional band was observed for total ERK in the stimulated cells, which appears to be a modification of the lowest molecular weight band resulting in a slower migrating band. Three independent experiments were performed with independent pooled collections of lupus serum. Increased phosphorylation of ERK and p38 was consistently observed in response to all lupus serum collections with the extent of phosphorylation varying depending on the serum used. Blots presented are representative of all three experiments.

N‐glycan analyses

Sialylated glycoprotein N‐glycans were measured in intact cells that were grown on glass slides and cultured with lupus serum in the absence (six replicate wells) or presence of OP (three replicate wells). Cells were incubated with OP for 16 h and media replaced with 10% lupus serum for 3 h. Following stimulation, cells were prepared for N‐glycan profiling as described previously. 38 Briefly, the array was washed in cold PBS and fixed in neutral buffered formalin followed by delipidation with three replicates of Carnoy's Solution (10% glacial acetic acid, 30% chloroform and 60% 200‐proof ethanol) for three minutes. Deglycosylation was performed by spraying each array with PNGase F Prime (N‐Zyme Scientifics) using an M3 TM‐Sprayer (HTX Technologies) with 10 passes at 25 μl/min, 1200 mm/s, 45°C and 3‐mm spacing between passes with 10 psi nitrogen gas and incubated for 2 h at 37°C and ≥80% relative humidity. MALDI matrix α‐cyano‐4‐hydroxycinnamic acid (CHCA, Sigma; 50% acetonitrile/0.1% trifluoroacetic acid) was sprayed onto the cells with an M3 TM‐Sprayer (HTX Technologies) using 10 passes at 70 μl/min, 1300 mm/s, 79°C, 2.5‐mm spacing between passes and 10 psi nitrogen gas. Two passes of ammonium phosphate monobasic (5 mM) were applied using same parameters as for matrix. N‐glycans were profiled using a Fourier Transform Ion Cyclotron Resonance Mass Spectrometer (FTICR; 7 Tesla solariX™, Bruker Scientific, LLC) equipped with a MALDI source. Transients of 512 kilowords were acquired in broadband‐positive ion mode over m/z 500–5000 with a calculated on‐tissue mass resolution at full width half maximum of 81 000 at m/z 1400. Each pixel consisted of 1200 laser shots rastered over a 500 μm diameter area. A lockmass on primary N‐glycan peak m/z 1663.5814 (composition Hex5HexNAc4 + 1Na) was used to maintain mass accuracy during acquisition. N‐glycoform assignment to regulated N‐glycans was made by high mass accuracy match (±2 ppm) to the singly charged M + Na peak using GlycoWorkbench. 39 Data presented are for quantified peak intensities of sialylated N‐glycans after subtracting background levels obtained from wells cultured with media only (no cells).

Statistical analyses

Association between treatment and duration of exposure to lupus serum or LPS in the absence or presence of OP with outcomes (eg protein, mRNA levels, GSLs) was evaluated using a linear mixed‐model approach. Models with one treatment variable included a fixed effect for treatment, and models that included treatment and time included fixed effects for treatment, time and the treatment X time interactions. All experiments were performed at least twice with similar results as indicated in the figure legends. Data were combined for the statistical analyses. As stimulatory activity of the lupus serum varied from batch to batch, the graphs presented in Figures 1, 2, 3, 4 and Figure 7A are from a single representative experiment but include p‐values calculated across experiments. For example, IL‐6 secretion (as in Figure 1C) increased by ~1200–5100 pg/ml in response to a 3‐h incubation with 10% lupus serum compared to control (~20–100 pg/ml) depending on serum batch. Thus, all models included a random batch effect to account for correlation between experimental results from the same batch. Model assumptions were checked graphically, and transformations were considered as needed. Pairwise differences between groups were evaluated using linear contrasts, and a Bonferroni correction was applied to adjust for multiple comparisons. All analyses were conducted in SAS v. 9.4 (SAS Institute). Significant differences in nineteen sialylated N‐glycans between lupus serum‐stimulated cells pretreated with vehicle (water) or OP were evaluated using a two‐sample t‐test. Both adjusted and unadjusted p‐values were considered with adjusted p‐values provided on the graph. Four additional N‐glycans had background subtracted values less than zero and were excluded from the analysis. Global p‐values are provided for analysing lupus serum or LPS dose response of cytokine production (Figures 1A,B and 5A‐C). Error bars represent standard deviation for the representative experiments presented in figures. Adjusted p‐values are presented on all graphs.

FIGURE 1.

FIGURE 1

Lupus serum stimulates expression and secretion of IL‐6 and GM‐CSF, and secretion of MIP1α from lupus‐prone primary MCs. GM‐CSF (A) and MIP1α (B) were measured by individual ELISAs in the media of primary MRL/lpr MCs cultured for 6 h in the absence (control) or presence of increasing concentrations of lupus serum. IL‐6 (C), GM‐CSF (D) and MIP1α (E) were measured by individual ELISAs in the media of primary MRL/lpr MCs cultured for the indicated time in the absence (Control) or presence of 10% lupus serum. Il‐6 (F), Gm‐csf (G) and Neu1 (H) mRNA expressions were measured by real‐time RT‐PCR in primary MRL/lpr MCs cultured for 0.5–6 h in the absence (control) or presence of 10% lupus serum. Experiments were performed three times in A and B and two times in C‐H with independent serum collections. Global p‐values in A‐B and individual p‐values between control and lupus serum at each time point for C‐H were calculated across replicate experiments as described in Statistical analyses section and provided on graphs of data from representative experiments

FIGURE 2.

FIGURE 2

Inhibiting NEU activity significantly reduces lupus serum‐stimulated secretion of IL‐6, GM‐CSF and MIP1α, and expression of Il‐6. Primary MRL/lpr MCs were cultured in the absence or presence of 10% lupus serum (LS) and 500 μM NEU inhibitor oseltamivir phosphate (OP). IL‐6 (A), GM‐CSF (B) and MIP1α (C) were measured by individual ELISAs in the media 6 h after addition of LS. D) Il‐6, Gm‐csf and Neu1 mRNA expression were measured by real‐time RT‐PCR 6 h after addition of LS. Control, treated with vehicle (water) only (no OP or LS). E) NEU activity by addition of substrate to live cells was measured after stimulation with LS for 3 h. Experiments were performed three times in A, B, D and E and twice in C with independent serum collections. p‐values were calculated across replicate experiments as described in Statistical analyses section and provided on graphs of data from representative experiments

FIGURE 3.

FIGURE 3

Genetically reducing Neu1 significantly reduces basal and lupus serum‐stimulated NEU activity and lupus serum‐stimulated secretion of IL‐6. A) Primary C57BL/6 Neu1+/+ and Neu1 ± MCs were cultured in the absence (control) or presence of 20% lupus serum (LS) for 3 h. NEU activity was measured after addition of NEU substrate to live cells. B) Primary C57BL/6 Neu1+/+ Neu1 ± MCs were cultured in the absence (control) or presence of 20% or 40% lupus serum (LS) or 40% C57BL/6 (B6) serum. IL‐6 was measured by ELISA in the media 24 h after addition of serum. Experiments were performed four times in A and twice in B with at least two independent serum collections. p‐values were calculated across replicate experiments as described in Statistical analyses section and provided on graphs of data from representative experiments

FIGURE 4.

FIGURE 4

Blocking TLR4 significantly decreased lupus serum‐stimulated IL‐6 secretion. Primary MRL/lpr MCs were cultured with 10% lupus serum for 6 h following pretreatment without or with the indicated antibodies (Ab). IL‐6 (A), GM‐CSF (B), and MIP1α (C) were measured in the media by ELISA. Secretion in the presence of LS and No Ab was set to 1 for each cytokine and relative fold change in the presence of Ab presented. Experiments were performed three times in A‐B and twice in C with at least two different serum collections and fold change averaged across experiments. Absolute levels of all three cytokines across replicate experiments were similar to levels observed in Figures 1 and 2 in response to lupus serum. Individual p‐values are provided on the graphs and calculated as described in Statistical analyses section. Isotype controls include mouse (Ms), hamster (Hm) and rat (Rt) IgGs (grey bars)

FIGURE 7.

FIGURE 7

NEU activity mediates IL‐6 and GM‐CSF secretion through ERK or p38 MAPK signalling. A‐B) MRL/lpr primary MCs were incubated without inhibitor (control) or with 10 μM ERK (U0126), p38 (SB203580), JNK (SP600125) or PI3K (Wortmannin) inhibitors for 2 h prior to addition of 10% lupus serum (A) or 5 ng/ml LPS (B) for 3 h. Data for one experiment representative of three independent experiments are presented. Levels of all three cytokines across replicate experiments were similar to levels observed in Figures 1 and 2 in response to lupus serum and in Figure 5 in response to LPS. p‐values were calculated across replicate experiments as described in Statistical analyses section. #, significant increase at p < 0.001 vs control. All other p‐values are provided on the graphs. Graphs are data from representative experiments. C‐D) Cells were pretreated with vehicle (water) or 500 μM NEU inhibitor oseltamivir phosphate (OP) for 16 h and then stimulated with 10% lupus serum (C) or 5 ng/ml LPS (D) for 15–45 min. Whole‐cell extracts were prepared and subjected to Western immunoblot using antibodies to phosphorylated ERK or p38 (Phospho), or total ERK or p38 (Total). Ratio of band intensities for phosphorylated to total ERK and p38 is provided below each blot. Results are representative of three independent experiments with consistent decreases observed after stimulation for 45 min with lupus serum (C) and 30 min with LPS (D) in the presence of OP vs absence of OP

FIGURE 5.

FIGURE 5

LPS stimulates expression and secretion of IL‐6 and GM‐CSF, and secretion of MIP1α from lupus‐prone primary MCs. Primary MRL/lpr MCs were cultured for 6 h in the absence (control) or presence of increasing amounts of LPS. IL‐6 (A), GM‐CSF (B) and MIP1α (C) were measured by individual ELISAs in the media. Primary MRL/lpr MCs were cultured for the indicated time in the absence (Control) or presence of 5 ng/ml LPS. IL‐6 (D), GM‐CSF (E) and MIP1α (F) were measured by individual ELISAs in the media. Il‐6 (G), Gm‐csf (H) and Neu1 (I) mRNA expressions were measured by real‐time RT‐PCR. Experiments were performed three times in A‐C and twice in D‐H. Global p‐values (A‐C) or individual p‐values (D‐I) are provided on the graphs. p‐values were calculated across replicate experiments as described in Statistical analyses section with representative experiments presented

RESULTS

Lupus serum stimulates cytokine secretion and mRNA expression in lupus‐prone MCs

We previously demonstrated a dose‐dependent significant release of IL‐6 in response to lupus serum. 12 To better define the effects of lupus serum in stimulating lupus‐prone MCs, Multiplex FlexMap3D bead array analysis was used to measure a panel of twenty cytokines. MRL/lpr MCs were cultured for 6 h in the presence of 5%, 10% or 20% lupus serum or 20% serum taken from age‐matched healthy non‐autoimmune‐prone C57BL/6 (B6) mice, or 10% lupus serum after pre‐treating with 125, 250 or 500 μM oseltamivir phosphate (OP), an inhibitor of NEU activity. Secretion of seven cytokines (IL‐6, IL‐12, IL‐17, MIP1α, GM‐CSF, IFN‐γ and IP‐10) showed a dose‐dependent increase of at least four‐fold after addition of lupus serum and a dose‐dependent decrease in the presence of OP. Individual ELISAs confirmed significant dose‐dependent secretion of GM‐CSF (Figure 1A, p = 0.013) and MIP1α (Figure 1B, p < 0.001) in response to lupus serum (in addition to IL‐6). 12 We then analysed the temporal release of these cytokines in response to 10% lupus serum stimulation. Media were collected from lupus MCs stimulated with lupus serum for 0.5, 1, 3 and 6 h. Significantly increased secretion of all three cytokines was observed by 3 h following addition of lupus serum (Figure 1C‐E). Message levels of Il‐6 (Figure 1F) and Gm‐csf (Figure 1G) were also significantly increased following lupus serum stimulation with significant increases in Gm‐csf mRNA levels being observed within 1 h of lupus serum stimulation (Figure 1G). Mip1α mRNA levels were undetectable in unstimulated cells and remained at the threshold of detection (≥32 cycles) after stimulation making quantification unreliable. Thus, we were unable to conclude with any degree of certainty if Mip1α expression was increased following lupus serum stimulation. Neu1 message levels in response to lupus serum significantly increased at 1 h, but had significantly decreased at 3 h (Figure 1H). Neu1 message remained slightly, but not significantly, lower at 6 h. Neu3 mRNA was undetectable at all time points. These results demonstrate that expression of Il‐6, Gm‐csf and Neu1 is elevated prior to or around the same time as cytokine release in response to lupus serum.

NEU activity mediates cytokine secretion from lupus serum‐stimulated primary lupus‐prone MCs

Our previous results demonstrated IL‐6 secretion by MRL/lpr MCs in response to both HA‐IgG and lupus serum was dose‐dependently inhibited by OP. 12 These results strongly suggested IL‐6 release by MCs is mediated by NEU activity. To determine whether secretion of GM‐CSF and MIP1α is also mediated by NEU activity in response to lupus serum, MCs were pretreated with 500 μM OP, which prevented >90% of IL‐6 release, 12 or vehicle (water), and stimulated with lupus serum for 6 h. This experiment confirmed all three cytokines were significantly decreased when MCs were pretreated with OP prior to lupus serum stimulation (Figure 2A‐C). OP treatment of MRL/lpr MCs blocked the increase in Il‐6 mRNA levels, actually further increased Gm‐csf mRNA levels in response to lupus serum, and had no effect on Neu1 mRNA levels (Figure 2D). A live‐cell activity assay demonstrated that NEU activity significantly increased in response to lupus serum (Figure 2E) despite a significant decrease in Neu1 expression (Figure 1H) 3 h after lupus serum stimulation, suggesting a potential negative feedback loop. We also confirmed that the lupus serum‐stimulated NEU activity was significantly inhibited by OP. Together, these results suggest NEU activity mediates secretion of at least three cytokines by lupus‐prone MCs and specifically mediates IL‐6 secretion by promoting its expression at the message level in response to lupus serum.

To confirm the effects of OP on cytokine release are due to blocking NEU activity specifically and not due to an off‐target effect, we cultured primary MCs from C57BL/6 mice that are wild type for Neu1 (B6 Neu1+/+) or heterozygote for Neu1 (B6 Neu1±) and stimulated with serum from MRL/lpr mice (lupus serum) or age‐matched C57BL/6 mice. The Neu1 ± B6 MCs had significantly reduced NEU activity compared with the B6 Neu1+/+ MCs (Figure 3A) and significantly reduced IL‐6 secretion (Figure 3B) at baseline and following stimulation with lupus serum. Serum from age‐matched C57BL/6 mice (B6 serum) did not stimulate IL‐6 secretion (Figure 3B) as previously demonstrated with MRL/lpr MCs. 12 These results are in agreement with our previous results that showed reducing Neu1 expression with siRNA in heat‐aggregated IgG‐stimulated MRL/lpr MCs significantly decreased IL‐6 secretion. 12 Together, these results support those observed in Figure 2 with OP, indicating NEU activity (and specifically NEU1) plays a role in mediating cytokine release from MCs.

Lupus serum stimulates IL‐6 secretion from MRL/lpr MCs through TLR4/MD2

The secretion of proinflammatory cytokines including IL‐6, GM‐CSF and MIP1α can be directly stimulated through signalling pathways in MCs following ligand binding to cell‐surface proteins such as Fcγ receptors (FcγRs), Toll‐like receptors (TLRs), Annexin II (AnxA2), and TNF receptors (TNFRs). 40 , 41 , 42 , 43 , 44 Therefore, the role of these proteins in lupus serum‐stimulated primary MCs was investigated. MCs were incubated with neutralizing antibodies for cell‐surface TLRs and FcγRs to block their interaction with putative ligands prior to addition of lupus serum. TLR4/MD2‐neutralizing antibody significantly inhibited lupus serum‐stimulated IL‐6 secretion (Figure 4A, p < 0.001). Secretion of GM‐CSF was slightly, but not significantly, reduced (Figure 4B), and MIP1α was not significantly impacted (Figure 4C) by anti‐TLR4/MD2 antibodies. Antibodies to FcγRs (Figure 4), and TLR4 alone, AnxA2 and TNFRs (data not shown) failed to reduce IL‐6, GM‐CSF, or MIP1α secretion. The lack of effect by multiple other antibodies suggests strongly a specific effect of anti‐TLR4/MD2 antibodies and that lupus serum stimulates IL‐6 secretion from lupus‐prone MCs in part through TLR4 and MD2.

NEU activity mediates IL‐6 and GM‐CSF secretion through TLR4 activation in MRL/lpr MCs

To confirm NEU activity mediates cytokine release specifically through a TLR4 pathway in MRL/lpr MCs, we isolated this pathway by stimulating the cells with the TLR4 ligand LPS. As expected, LPS stimulated significant secretion of IL‐6 (Figure 5A, p = 0.002), GM‐CSF (Figure 5B, p = 0.013), and MIP1α (Figure 5C, p = 0.002). Increasing the concentration of LPS did not further increase the levels observed at 5 ng/ml indicating release was maximal at this concentration. Thus, 5 ng/ml LPS was used to stimulate cells for all subsequent experiments. Secretion and mRNA expression of these cytokines by LPS followed a similar temporal trend as that observed following lupus serum stimulation. Significant increases in all three cytokines were observed in the media within 3 h of LPS addition (Figure 5D‐F). Message levels of Il‐6 (Figure 5G), Gm‐csf (Figure 5H) and Neu1 (Figure 5I) increased within 1 h of stimulation. Although Neu1 message levels did not remain elevated, levels were not significantly decreased at 3 hr as observed with lupus serum in Figure 1H. As with lupus serum stimulation, Mip1α mRNA levels were essentially undetectable after LPS stimulation. Importantly, inhibiting NEU activity with the inhibitor OP significantly reduced LPS‐stimulated secretion of IL‐6, GM‐CSF and MIP1α (Figure 6A‐C), and mRNA expression of Il‐6 and Gm‐csf (Figure 6D). Whereas Gm‐csf mRNA levels were increased by OP treatment in lupus serum‐stimulated MCs, they were decreased by OP in LPS‐stimulated MCs. A live‐cell NEU activity assay demonstrated significant NEU activity in response to LPS stimulation, which was significantly blocked by OP (Figure 6E). Addition of TLR4/MD2‐neutralizing antibodies significantly blocked LPS‐stimulated IL‐6 and GM‐CSF secretion, but had no effect on MIP1α secretion (Figure 6F). Together, these novel observations suggest strongly that NEU‐mediated secretion of IL‐6 and GM‐CSF from lupus‐prone MCs occurs in part through TLR4 signalling in lupus‐prone MCs and that NEU may directly mediate TLR4 signalling of IL‐6 secretion.

FIGURE 6.

FIGURE 6

Inhibiting NEU activity or TLR4 significantly reduces LPS‐stimulated secretion of IL‐6, GM‐CSF and MIP1α, and expression of Il‐6 and Gm‐csf. Primary MRL/lpr MCs were cultured in the absence or presence of 500 μM NEU inhibitor oseltamivir phosphate (OP) and then stimulated with 5 ng/ml LPS for 6 h. IL‐6 (A), GM‐CSF (B) and MIP1α (C) were measured by individual ELISAs in the media. Il‐6 and Gm‐csf (D) mRNA expressions were measured by real‐time RT‐PCR in the cells. E) Primary MCs were pretreated without or with 500 μM OP followed by stimulation with 5 ng/ml LPS for 3 h, and NEU activity was measured after addition of substrate to live cells. Control, treated with vehicle (water) only (no OP or LPS). F) Primary MCs were pretreated without (No Ab) or with TLR4/MD2 antibodies and stimulated with 5 ng/ml LPS for 6 h. IL‐6, GM‐CSF and MIP1α were measured in the media by ELISA. Rt IgG, rat isotype control. Secretion in the presence of LPS with No Ab was set to 1 for each cytokine and relative fold change in the presence of TLR4/MD2 Ab calculated. Experiments in A, B, and E were performed three times, and all other experiments were performed twice. p‐values were calculated across replicate experiments as described in Statistical analyses section and provided on graphs of data from representative experiments

NEU activity mediates TLR4‐MAPK signalling in secretion of IL‐6 and GM‐CSF from MRL/lpr MCs

As the TLR4 receptor can signal through MAPK and PI3K pathways, we wanted to determine whether MAPK (ERK, JNK, p38) or PI3K pathways play a role in NEU activity‐mediated release of IL‐6 in MCs. Inhibitors for each pathway were incubated with the cells prior to stimulation and included ERK, p38 and JNK inhibitors U0126, SB203580 and SP600125, respectively, and PI3K inhibitor wortmannin. Only ERK and p38 inhibitors significantly reduced IL‐6 secretion from both lupus serum‐stimulated (Figure 7A, p < 0.001 for both inhibitors) and LPS‐stimulated (Figure 7B, p < 0.001 for both inhibitors) MCs. Inhibiting ERK also significantly reduced GM‐CSF secretion from lupus serum‐stimulated (Figure 7A, p < 0.001) and LPS‐stimulated (Figure 7B, p < 0.001) MCs. None of the inhibitors reduced MIP1α secretion from MCs when stimulated with either lupus serum or LPS. Interestingly, JNK and PI3K inhibition significantly increased GM‐CSF (p < 0.001 for both), and PI3K inhibition significantly increased MIP1α secretion (p < 0.001) in LPS‐stimulated cells (Figure 7B).

To confirm a role for ERK or p38 MAPK signalling in NEU activity‐mediated TLR4 signalling, MRL/lpr primary MCs were incubated without or with OP and stimulated with lupus serum or LPS. Activation of both ERK and p38 was increased as indicated by the increase in their phosphorylated forms in response to lupus serum and reduced by the NEU activity inhibitor OP (Figure 7C). Similarly, phosphorylation of ERK and p38 was observed following LPS stimulation, and reduced by inhibiting NEU activity with OP (Figure 7D). Although the extent of phosphorylation of ERK and p38 in response to lupus serum varied depending on the lupus serum collection that was used, phosphorylation was consistently observed across experiments for both ERK and p38, as was reduction by OP in both lupus serum‐stimulated and LPS‐stimulated MCs. Across experiments, semi‐quantitative measurement of band intensities showed a 2.4‐ to 7‐fold or 2‐ to 3.3‐fold increase in the ratio of phosphorylated p38 to total p38 (P‐p38/T‐p38) in response to lupus serum or LPS, respectively, compared with vehicle. Similarly, a 2‐ to 4.3‐fold or 2‐ to 2.3‐fold increase in P‐ERK/T‐ERK was observed in response to lupus serum or LPS, respectively. In all experiments, pretreatment with OP prior to stimulation reduced P‐38/T‐p38 or P‐ERK/T‐ERK by 40%–60% compared with stimulated cells. Together, these results suggest NEU activity mediates IL‐6 and GM‐CSF cytokine release through a TLR4‐ERK/p38 MAPK pathway in lupus‐prone MCs.

Inhibiting NEU activity significantly increases sialic acid‐containing glycoproteins in lupus serum‐stimulated MCs

Sialic acid‐containing glycolipids and glycoproteins serve as substrates of NEUs, and removal of sialic acids (desialylation) plays an important role in TLR4 activation and signalling in other cell types. 45 , 46 , 47 We recently showed that in MRL/lpr MCs, the overall level of sialic acid‐containing glycosphingolipid GM3s is significantly increased in the presence of OP, 48 suggesting OP indeed blocks NEU activity against glycolipids. Here, we profiled N‐linked glycoproteins (N‐glycans) to determine whether blocking NEU activity with OP increases sialic acid‐containing N‐linked glycoproteins (N‐glycans), such as TLR4 and MD2, in lupus serum‐stimulated MCs. The intensities of 19 sialylated N‐glycans clearly detectable after background subtraction were measured in intact MRL/lpr MCs that were pretreated with OP or vehicle and then stimulated with 10% lupus serum for 3 h. In the cells pretreated with OP, the intensity of ~14 of the 19 detected sialylated N‐glycans increased in intensity, with five N‐glycans being significantly increased, when NEU activity was reduced (Figure 8). Structures of glycans for which glycans are known are shown on the graph. These results demonstrate OP blocked the activity of NEU in removing sialic acids from a subset of N‐glycans. Together, our results suggest NEU activity may mediate cytokine release in part by desialylating glycoproteins, such as TLR4, which we demonstrated is involved in IL‐6 release, in lupus serum‐stimulated MRL/lpr MCs.

FIGURE 8.

FIGURE 8

Blocking NEU activity significantly increased sialic acid‐containing N‐linked glycoproteins in lupus serum‐stimulated MCs. MRL/lpr primary MCs were pretreated with vehicle (water) or with 500 μM NEU activity inhibitor oseltamivir phosphate (OP) and stimulated with 10% lupus serum (LS) for 3 h. N‐glycans were analysed by MALDI‐FTICR. Intensities of 19 sialylated N‐glycans clearly identified after background subtraction are presented. Structures for sialylated N‐glycans for which the structures are known, including m/z 2122 and m/z 2853 that were significantly increased by OP, are shown on the graph. Data presented are the average of replicate wells + SD. Adjusted p‐values on the graph were calculated as described in Materials and Methods

DISCUSSION

One of the earliest events in the pathogenesis of lupus nephritis is the deposition of immune complexes to promote cytokine production by mesangial cells (MCs) and podocytes. IL‐6 and other cytokines released by resident renal cells promote the infiltration of immune cells, further stimulation of cytokine production by and proliferation of MCs, and subsequent tissue damage. Blocking or reducing IL‐6 in lupus‐prone mice attenuated disease 7 , 10 , 11 ; however, anti‐IL‐6 treatment of lupus patients with class III or IV nephritis in a small clinical trial was not efficacious. 49 Delineating the precise mechanisms by which IL‐6 levels are increased in LN is needed. A recent study demonstrated IL‐6 is specifically produced by glomerular MCs in nephritic mice of the NZM2328 lupus strain, 50 and we previously demonstrated MCs from MRL/lpr lupus‐prone mice release IL‐6 and MCP‐1 following stimulation with an immune complex mimic (heat‐aggregated IgG) or lupus serum. 12 Previously published data and our results here suggest strongly that NEU activity, and specifically NEU1, plays a role in promoting cytokine release from MCs. 12 , 48 This includes increased NEU activity and cytokine secretion in response to a variety of stimuli (HA‐IgG, lupus serum, LPS) that is significantly reduced by treating cells with the NEU inhibitor OP. In our live‐cell assay, OP was observed to inhibit NEU activity by < 20%, which may specifically reflect NEU1 activity as OP was reported to have specificity for NEU1. 32 , 37 , 51 Clearly, reducing NEU activity by <20% in MRL/lpr MCs and by ~ 35% in B6 Neu1 ± MCs had significant effects on cytokine release emphasizing the importance of altering NEU activity levels in the function of MCs. Additional evidence that NEU1 is the NEU primarily responsible for the observed effects includes inhibition of IL‐6 release by Neu1 siRNA in MRL/lpr MCs, 12 the increase in Neu1 mRNA levels within 1 h of lupus serum or LPS stimulation (Figures 1H and 5I), and the significantly reduced IL‐6 release by B6 MCs heterozygote for Neu1 in response to lupus serum (Figure 3B). Here, we also provide data supporting that NEU activity promotes IL‐6 secretion through a TLR4‐MAPK p38 or ERK signalling pathway in response to a circulating lupus factor(s). This is likely a direct mediation by NEU activity as both IL‐6 protein and Il‐6 mRNA levels are significantly reduced when NEU activity is blocked.

The proinflammatory activity of lupus serum is largely thought to require the presence of circulating immune complexes, and their deposition in the kidney likely plays a major role in stimulation of renal resident cells. Autoantibodies and immune complexes with the ability to activate FcγRs and TLRs promote increased production of inflammatory mediators. Our previous studies showed colocalization of NEU1 and NEU3 with IgG in cultured primary MCs stimulated with exogenously added heat‐aggregated IgG and in the glomeruli of kidney sections from nephritic MRL/lpr mice. 12 Results from our current study indicate FcγRs, which bind IgG, are not required for NEU activity‐mediated release of IL‐6 in response to lupus serum. These results agree with previous studies demonstrating that MRL/lpr mice lacking the Fcγ chain still develop renal disease, 52 and FcγRs were dispensable for activation of MRL/lpr 40 and human 53 MCs by pathogenic anti‐DNA antibodies. Instead, we demonstrated lupus serum‐stimulated IL‐6 secretion from MRL/lpr MCs was significantly decreased when TLR4 was blocked and that LPS‐stimulated TLR4 signalling of IL‐6 secretion was significantly decreased when NEU activity was blocked. Although TLR4 is not readily detected in MCs from healthy non‐autoimmune mice, it is present in MCs from MRL/lpr lupus mice, 41 and TLR4 deficiency in another lupus‐prone mouse strain decreased renal disease. 54 Together, these results support a role for TLR4 in NEU activity‐mediated IL‐6 expression and secretion in response to lupus serum.

NEU activity also mediated GM‐CSF and MIP1α secretion from lupus‐prone MCs. Blocking TLR4 in lupus serum‐stimulated cells resulted in a slight reduction in GM‐CSF secretion, and blocking TLR4 in LPS‐stimulated cells resulted in a significant reduction in GM‐CSF. Furthermore, blocking NEU activity significantly reduced Gm‐csf message levels in LPS‐stimulated, but not lupus serum‐stimulated, cells. These data suggest TLR4 plays a role, but other receptors may also be involved in NEU activity‐mediated GM‐CSF secretion in response to lupus serum. MIP1α was not decreased when TLR4 signalling was blocked, indicating NEU activity may mediate MIP1α secretion indirectly or through a mechanism other than TLR4 signalling.

NEU activity can mediate cell signalling by removing sialic acids (desialylating) from glycolipids or glycoproteins. MRL/lpr MCs treated with OP results in a highly significant accumulation of sialylated ganglioside GM3 48 and an increase in a subset of sialylated N‐glycans (Figure 8). These results indicate OP blocks the activity of NEU in removing sialic acids from a subset of glycolipids and glycoproteins. OP did not prevent desialylation of N‐glycans levels globally. This is not surprising given that OP was shown to preferentially inhibit NEU1 activity in other cell types. 32 , 37 , 51 Mammalian NEUs exhibit preferences for specific glycolipids and/or glycoproteins with NEU1 shown to be more active towards glycoproteins. 55 Based on these collective results, we postulate that NEU1 desialylates glycoproteins, likely TLR4 or MD2, to promote TLR4‐MAPK‐IL‐6 signalling.

Sialic acids (SAs) mask receptors from ligands to prevent signalling. 56 TLR4 and MD2, both of which are required for optimal TLR4 signalling, contain multiple N‐glycans required for function that can be sialylated. TLR4 diffuses into lipid rafts upon LPS stimulation to propagate signalling of gene expression. 57 In other cell types, removal of SAs by the action of NEUs enhanced binding and subsequent signalling through TLR4. 31 , 47 , 58 , 59 This TLR4 activation was shown to trigger NEU1 translocation to the cell surface to desialylate TLR4 and MD2 and enhance TLR4 dimerization and signalling. 46 , 47 , 60 In vivo, increasing sialylation by treating mice with exogenous SAs reduced TLR4 activation and neutralized LPS toxicity‐induced renal injury. 61 We observed that antibodies to both TLR4 and MD2, but not to TLR4 alone, block MC response to lupus serum. Unfortunately, the N‐glycan structures of TLR4 are unknown. Thus, we were unable to determine whether any of the N‐glycans identified in Figure 8 belong to TLR4. Alternatively, or additionally, the function of NEU activity in mediating IL‐6 production by MCs may be through the desialylation of glycolipids involved in signalling pathways. Sialic acid‐containing gangliosides present in cell membranes, such as GM3, impact cell functions by organizing lipid rafts to modulate receptor‐mediated signal transduction. 62 Increasing GM3, the simplest sialic acid‐containing ganglioside from which all other gangliosides are generated, prevents MC activation and proliferation. 63 As proliferation is inhibited when GM3 is increased in MCs, 63 the observed significant decrease in IL‐6 secretion when NEU activity was blocked with OP may be a result of increased GM3 levels. 48 Extensive additional studies are required to determine the expression and activity of individual sialyltransferases and NEUs in stimulated MCs and further define the mechanisms contributing to the production of IL‐6 and other proinflammatory cytokines.

One limitation in our study is the specificity of OP, which was developed as an inhibitor of viral NEU activity. Unfortunately, specific inhibitors of mammalian NEUs are not currently commercially available. There are conflicting reports in the literature as to whether OP is effective in blocking the activity of mammalian NEUs. Studies that reported oseltamivir failed to block mammalian NEU activity largely used the carboxylate form (OC), not the phosphate form (OP), on homogenates from cells overexpressing mammalian NEUs or on purified NEU preparations, 64 , 65 which may account for some of the conflicting observations. Studies that demonstrated oseltamivir blocks mammalian NEU activity used live cells treated with 200–500 μM OP concentrations and analysed endogenous NEU activity. 32 , 33 , 34 , 37 , 66 , 67 These conditions are similar to what we used in this study and in our previous study, 12 which was not toxic to the cells. We also showed reducing NEU activity by reducing Neu1 expression in C57BL/6 MCs (Neu1+/−) resulted in a significant reduction in IL‐6 secretion, further supporting NEU activity, and NEU1 specifically, mediates IL‐6 secretion. However, the possibility that some observed effects of OP are due to off‐target effects cannot be completely ruled out. Although OP only reduced NEU activity in our live‐cell assay by ~20%, it was sufficient to have a significant effect on cytokine release. In addition, activation of signalling pathways and the role of NEU activity are likely to change in response to the factors present in lupus serum. Circulating pathogenic disease factors may fluctuate depending on disease stage/state of the mice from which the lupus serum was obtained, which can vary from mouse to mouse. The differences in the presence/absence or concentration of these factors likely influence the pathways activated and the role of NEU activity. Indeed, differences were observed in the extent of cytokine release in response to lupus serum across serum collections from 16‐ to 18‐week‐old MRL/lpr mice. While using LPS allowed us to isolate TLR4 signalling to demonstrate a role for NEU activity in this pathway, future studies will be required to identify the specific circulating factors involved temporally.

In summary, we demonstrated stimulation of lupus‐prone primary MCs with lupus serum or LPS results in the secretion of IL‐6, GM‐CSF and MIP1α and is mediated in part by NEU activity, most likely NEU1 activity. We further showed NEU activity‐mediated IL‐6 production likely occurs through p38/ERK MAPK upregulation of Il‐6 expression following TLR4 activation, and may involve desialylation of glycans in response to circulating lupus factor(s). These novel observations will provide a better understanding of proinflammatory mechanisms and lay the foundation to identify additional putative therapeutic targets in lupus nephritis.

CONFLICT OF INTEREST

The authors declare that they have no conflicts of interest with the contents of this article.

Supporting information

Figure S1

ACKNOWLEDGEMENTS

Tamara Nowling conceived and designed the study, and assisted with experimental design and preparation/editing of the manuscript. Kamala Sundararaj designed and performed experiments and prepared the manuscript. Jessalyn Rodgers performed experiments and prepared/edited the manuscript. Peggi Angel performed and analysed the N‐glycan analyses. Bethany Wolf performed the statistical analyses. The authors thank Ivan Molano for assistance in performing the FlexMap 3D assay and Dr Alessandra d'Azzo for the C57BL/6 Neu1+/‐ mice. This work was supported by the Office of the Assistant Secretary of Defense for Health Affairs through the Peer‐Reviewed Medical Research Program Lupus Topic Area Award W81XWH‐16‐1‐0640 (funding awarded to T. K. Nowling). Opinions, interpretations, conclusions and recommendations are those of the authors and are not necessarily endorsed by the Department of Defense. We also acknowledge NIH Clinical Center Grant U01 CA242096 and NIH Exploratory Center Grant P20 GM103542 awarded to the South Carolina Center of Biomedical Research Excellence (COBRE) in Oxidants, Redox Balance, and Stress Signaling supporting P. Angel. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Kamala Sundararaj and Jessalyn Rodgers contributed equally to the described studies.

DATA AVAILABILITY STATEMENT

Data or materials generated by this study are available upon request.

REFERENCES

  • 1. Nowling TK, Mather AR, Thiyagarajan T, Hernández‐Corbacho MJ, Powers TW, Jones EE, et al. Renal glycosphingolipid metabolism is dysfunctional in lupus nephritis. J Am Soc Nephrol. 2015;26:1402–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Natoli TA, Smith LA, Rogers KA, Wang B, Komarnitsky S, Budman Y, et al. Inhibition of glucosylceramide accumulation results in effective blockade of polycystic kidney disease in mouse models. Nat Med. 2010;16:788–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Natoli TA, Husson H, Rogers KA, Smith LA, Wang B, Budman Y, et al. Loss of GM3 synthase gene, but not sphingosine kinase 1, is protective against murine nephronophthisis‐related polycystic kidney disease. Hum Mol Genet. 2012;21:3397–407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Subathra M, Korrapati M, Howell LA, Arthur JM, Shayman JA, Schnellmann RG, et al. Kidney glycosphingolipids are elevated early in diabetic nephropathy and mediate hypertrophy of mesangial cells. Am J Physiol Renal Physiol. 2015;309:F204–F215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Nitta T, Kanoh H, Inamori KI, Suzuki A, Takahashi T, Inokuchi JI. Globo‐series glycosphingolipids enhance Toll‐like receptor 4‐mediated inflammation and play a pathophysiological role in diabetic nephropathy. Glycobiology. 2019;29:260–8. [DOI] [PubMed] [Google Scholar]
  • 6. Takemura T, Yoshioka K, Murakami K, Akano N, Okada M, Aya N, et al. Cellular localization of inflammatory cytokines in human glomerulonephritis. Virchows Arch. 1994;424:459–64. [DOI] [PubMed] [Google Scholar]
  • 7. Kiberd BA. Interleukin‐6 receptor blockage ameliorates murine lupus nephritis. J Am Soc Nephrol. 1993;4:58–61. [DOI] [PubMed] [Google Scholar]
  • 8. Herrera‐Esparza R, Barbosa‐Cisneros O, Villalobos‐Hurtado R, Avalos‐Diaz E. Renal expression of IL‐6 and TNFalpha genes in lupus nephritis. Lupus. 1998;7:154–8. [DOI] [PubMed] [Google Scholar]
  • 9. Malide D, Russo P, Bendayan M. Presence of tumor necrosis factor alpha and interleukin‐6 in renal mesangial cells of lupus nephritis patients. Hum Pathol. 1995;26:558–64. [DOI] [PubMed] [Google Scholar]
  • 10. Liang B, Gardner DB, Griswold DE, Bugelski PJ, Song XY. Anti‐interleukin‐6 monoclonal antibody inhibits autoimmune responses in a murine model of systemic lupus erythematosus. Immunology. 2006;119:296–305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Cash H, Relle M, Menke J, Brochhausen C, Jones SA, Topley N, et al. Interleukin 6 (IL‐6) deficiency delays lupus nephritis in MRL‐Faslpr mice: the IL‐6 pathway as a new therapeutic target in treatment of autoimmune kidney disease in systemic lupus erythematosus. J Rheumatol. 2010;37:60–70. [DOI] [PubMed] [Google Scholar]
  • 12. Sundararaj K, Rodgers JI, Marimuthu S, Siskind LJ, Bruner E, Nowling TK. Neuraminidase activity mediates IL‐6 production by activated lupus‐prone mesangial cells. Am J Physiol Renal Physiol. 2018;314:F630–F642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Liang F, Seyrantepe V, Landry K, Ahmad R, Ahmad A, Stamatos NM, et al. Monocyte differentiation up‐regulates the expression of the lysosomal sialidase, Neu1, and triggers its targeting to the plasma membrane via major histocompatibility complex class II‐positive compartments. J Biol Chem. 2006;281:27526–38. [DOI] [PubMed] [Google Scholar]
  • 14. Hinek A, Pshezhetsky AV, von Itzstein M, Starcher B. Lysosomal sialidase (neuraminidase‐1) is targeted to the cell surface in a multiprotein complex that facilitates elastic fiber assembly. J Biol Chem. 2006;281:3698–710. [DOI] [PubMed] [Google Scholar]
  • 15. Chen XP, Enioutina EY, Daynes RA. The control of IL‐4 gene expression in activated murine T lymphocytes: a novel role for neu‐1 sialidase. J Immunol. 1997;158:3070–80. [PubMed] [Google Scholar]
  • 16. Nan X, Carubelli I, Stamatos NM. Sialidase expression in activated human T lymphocytes influences production of IFN‐gamma. J Leukoc Biol. 2007;81:284–96. [DOI] [PubMed] [Google Scholar]
  • 17. Monti E, Bassi MT, Papini N, Riboni M, Manzoni M, Venerando B, et al. Identification and expression of NEU3, a novel human sialidase associated to the plasma membrane. Biochem J. 2000;349:343–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Zanchetti G, Colombi P, Manzoni M, Anastasia L, Caimi L, Borsani G, et al. Sialidase NEU3 is a peripheral membrane protein localized on the cell surface and in endosomal structures. Biochem J. 2007;408:211–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Yamaguchi K, Hata K, Koseki K, Shiozaki K, Akita H, Wada T, et al. Evidence for mitochondrial localization of a novel human sialidase (NEU4). Biochem J. 2005;390:85–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Seyrantepe V, Canuel M, Carpentier S, Landry K, Durand S, Liang F, et al. Mice deficient in Neu4 sialidase exhibit abnormal ganglioside catabolism and lysosomal storage. Hum Mol Genet. 2008;17:1556–68. [DOI] [PubMed] [Google Scholar]
  • 21. Bonten E, van der Spoel A, Fornerod M, Grosveld G, d'Azzo A. Characterization of human lysosomal neuraminidase defines the molecular basis of the metabolic storage disorder sialidosis. Genes Dev. 1996;10:3156–69. [DOI] [PubMed] [Google Scholar]
  • 22. Comelli EM, Amado M, Lustig SR, Paulson JC. Identification and expression of Neu4, a novel murine sialidase. Gene. 2003;321:155–61. [DOI] [PubMed] [Google Scholar]
  • 23. Koseki K, Wada T, Hosono M, Hata K, Yamaguchi K, Nitta K, et al. Human cytosolic sialidase NEU2‐low general tissue expression but involvement in PC‐3 prostate cancer cell survival. Biochem Biophys Res Commun. 2012;428:142–9. [DOI] [PubMed] [Google Scholar]
  • 24. Kotani K, Kuroiwa A, Saito T, Matsuda Y, Koda T, Kijimoto‐Ochiai S. Cloning, chromosomal mapping, and characteristic 5'‐UTR sequence of murine cytosolic sialidase. Biochem Biophys Res Commun. 2001;286:250–8. [DOI] [PubMed] [Google Scholar]
  • 25. Smutova V, Albohy A, Pan X, Korchagina E, Miyagi T, Bovin N, et al. Structural basis for substrate specificity of mammalian neuraminidases. PLoS One. 2014;9:e106320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Miyagi T, Wada T, Iwamatsu A, Hata K, Yoshikawa Y, Tokuyama S, et al. Molecular cloning and characterization of a plasma membrane‐associated sialidase specific for gangliosides. J Biol Chem. 1999;274:5004–11. [DOI] [PubMed] [Google Scholar]
  • 27. Papini N, Anastasia L, Tringali C, Croci G, Bresciani R, Yamaguchi K, et al. The plasma membrane‐associated sialidase MmNEU3 modifies the ganglioside pattern of adjacent cells supporting its involvement in cell‐to‐cell interactions. J Biol Chem. 2004;279:16989–95. [DOI] [PubMed] [Google Scholar]
  • 28. Seyrantepe V, Demir SA, Timur ZK, Von Gerichten J, Marsching C, Erdemli E, et al. Murine Sialidase Neu3 facilitates GM2 degradation and bypass in mouse model of Tay‐Sachs disease. Exp Neurol. 2018;299:26–41. [DOI] [PubMed] [Google Scholar]
  • 29. Bonardi D, Ravasio V, Borsani G, d'Azzo A, Bresciani R, Monti E, et al. In silico identification of new putative pathogenic variants in the NEU1 sialidase gene affecting enzyme function and subcellular localization. PLoS One. 2014;9:e104229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Ueno S, Saito S, Wada T, Yamaguchi K, Satoh M, Arai Y, et al. Plasma membrane‐associated sialidase is up‐regulated in renal cell carcinoma and promotes interleukin‐6‐induced apoptosis suppression and cell motility. J Biol Chem. 2006;281:7756–64. [DOI] [PubMed] [Google Scholar]
  • 31. Stamatos NM, Curreli S, Zella D, Cross AS. Desialylation of glycoconjugates on the surface of monocytes activates the extracellular signal‐related kinases ERK 1/2 and results in enhanced production of specific cytokines. J Leukoc Biol. 2004;75:307–13. [DOI] [PubMed] [Google Scholar]
  • 32. Amith SR, Jayanth P, Franchuk S, Siddiqui S, Seyrantepe V, Gee K, et al. Dependence of pathogen molecule‐induced toll‐like receptor activation and cell function on Neu1 sialidase. Glycoconj J. 2009;26:1197–212. [DOI] [PubMed] [Google Scholar]
  • 33. Amith SR, Jayanth P, Finlay T, Franchuk S, Gilmour A, Abdulkhalek S, et al. Detection of Neu1 sialidase activity in regulating Toll‐like receptor activation. J Vis Exp. 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Abdulkhalek S, Amith SR, Franchuk SL, Jayanth P, Guo M, Finlay T, et al. Neu1 sialidase and matrix metalloproteinase‐9 cross‐talk is essential for Toll‐like receptor activation and cellular signaling. J Biol Chem. 2011;286:36532–49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Natori Y, Nasui M, Edo K, Sato S, Sakurai T, Kizaki T, et al. NEU1 sialidase controls gene expression and secretion of IL‐6 and MCP‐1 through NF‐kappaB pathway in 3T3‐L1 adipocytes. J Biochem. 2017;162:137–43. [DOI] [PubMed] [Google Scholar]
  • 36. de Geest N, Bonten E, Mann L, de Sousa‐Hitzler J, Hahn C, d'Azzo A. Systemic and neurologic abnormalities distinguish the lysosomal disorders sialidosis and galactosialidosis in mice. Hum Mol Genet. 2002;11:1455–64. [DOI] [PubMed] [Google Scholar]
  • 37. Abdulkhalek S, Szewczuk MR. Neu1 sialidase and matrix metalloproteinase‐9 cross‐talk regulates nucleic acid‐induced endosomal TOLL‐like receptor‐7 and ‐9 activation, cellular signaling and pro‐inflammatory responses. Cell Signal. 2013;25:2093–105. [DOI] [PubMed] [Google Scholar]
  • 38. Angel PM, Saunders J, Clift CL, White‐Gilbertson S, Voelkel‐Johnson C, Yeh E, et al. A rapid array‐based approach to N‐glycan profiling of cultured cells. J Proteome Res. 2019;18:3630–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Ceroni A, Maass K, Geyer H, Geyer R, Dell A, Haslam SM. GlycoWorkbench: a tool for the computer‐assisted annotation of mass spectra of glycans. J Proteome Res. 2008;7:1650–9. [DOI] [PubMed] [Google Scholar]
  • 40. Qing X, Zavadil J, Crosby MB, Hogarth MP, Hahn BH, Mohan C, et al. Nephritogenic anti‐DNA antibodies regulate gene expression in MRL/lpr mouse glomerular mesangial cells. Arthritis Rheum. 2006;54:2198–210. [DOI] [PubMed] [Google Scholar]
  • 41. Qing X, Pitashny M, Thomas DB, Barrat FJ, Hogarth MP, Putterman C. Pathogenic anti‐DNA antibodies modulate gene expression in mesangial cells: involvement of HMGB1 in anti‐DNA antibody‐induced renal injury. Immunol Lett. 2008;121:61–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Bournazos S, Wang TT, Dahan R, Maamary J, Ravetch JV. Signaling by antibodies: recent progress. Annu Rev Immunol. 2017;35:285–311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Yung S, Cheung KF, Zhang Q, Chan TM. Anti‐dsDNA antibodies bind to mesangial annexin II in lupus nephritis. J Am Soc Nephrol. 2010;21:1912–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Yung S, Chan TM. Autoantibodies and resident renal cells in the pathogenesis of lupus nephritis: getting to know the unknown. Clin Dev Immunol. 2012;2012:139365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Ohnishi T, Muroi M, Tanamoto K. N‐linked glycosylations at Asn(26) and Asn(114) of human MD‐2 are required for toll‐like receptor 4‐mediated activation of NF‐kappaB by lipopolysaccharide. J Immunol. 2001;167:3354–9. [DOI] [PubMed] [Google Scholar]
  • 46. da Silva CJ, Ulevitch RJ. MD‐2 and TLR4 N‐linked glycosylations are important for a functional lipopolysaccharide receptor. J Biol Chem. 2002;277:1845–54. [DOI] [PubMed] [Google Scholar]
  • 47. Feng C, Stamatos NM, Dragan AI, Medvedev A, Whitford M, Zhang L, et al. Sialyl residues modulate LPS‐mediated signaling through the Toll‐like receptor 4 complex. PLoS One. 2012;7:e32359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Nowling TK, Rodgers J, Thiyagarajan T, Wolf B, Bruner E, Sundararaj K, et al. Targeting glycosphingolipid metabolism as a potential therapeutic approach for treating disease in female MRL/lpr lupus mice. PLoS One. 2020;15:e0230499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Rovin BH, van Vollenhoven RF, Aranow C, Wagner C, Gordon R, Zhuang Y, et al. A Multicenter, randomized, double‐blind, placebo‐controlled study to evaluate the efficacy and safety of treatment with sirukumab (CNTO 136) in patients with active lupus nephritis. Arthritis Rheumatol. 2016;68:2174–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Sung SJ, Fu SM. Interactions among glomerulus infiltrating macrophages and intrinsic cells via cytokines in chronic lupus glomerulonephritis. J Autoimmun. 2020;106:102331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Jayanth P, Amith SR, Gee K, Szewczuk MR. Neu1 sialidase and matrix metalloproteinase‐9 cross‐talk is essential for neurotrophin activation of Trk receptors and cellular signaling. Cell Signal. 2010;22:1193–205. [DOI] [PubMed] [Google Scholar]
  • 52. Matsumoto K, Watanabe N, Akikusa B, Kurasawa K, Matsumura R, Saito Y, et al. Fc receptor‐independent development of autoimmune glomerulonephritis in lupus‐prone MRL/lpr mice. Arthritis Rheum. 2003;48:486–94. [DOI] [PubMed] [Google Scholar]
  • 53. Tangtanatakul P, Thammasate B, Jacquet A, Reantragoon R, Pisitkun T, Avihingsanon Y, et al. Transcriptomic profiling in human mesangial cells using patient‐derived lupus autoantibodies identified miR‐10a as a potential regulator of IL8. Sci Rep. 2017;7:14517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Lartigue A, Colliou N, Calbo S, Francois A, Jacquot S, Arnoult C, et al. Critical role of TLR2 and TLR4 in autoantibody production and glomerulonephritis in lpr mutation‐induced mouse lupus. J Immunol. 2009;183:6207–16. [DOI] [PubMed] [Google Scholar]
  • 55. Miyagi T, Wada T, Yamaguchi K, Hata K, Shiozaki K. Plasma membrane‐associated sialidase as a crucial regulator of transmembrane signalling. J Biochem. 2008;144:279–85. [DOI] [PubMed] [Google Scholar]
  • 56. Bhide GP, Colley KJ. Sialylation of N‐glycans: mechanism, cellular compartmentalization and function. Histochem Cell Biol. 2017;147:149–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Triantafilou M, Morath S, Mackie A, Hartung T, Triantafilou K. Lateral diffusion of Toll‐like receptors reveals that they are transiently confined within lipid rafts on the plasma membrane. J Cell Sci. 2004;117:4007–14. [DOI] [PubMed] [Google Scholar]
  • 58. Stamatos NM, Carubelli I, van de Vlekkert D, Bonten EJ, Papini N, Feng C, et al. LPS‐induced cytokine production in human dendritic cells is regulated by sialidase activity. J Leukoc Biol. 2010;88:1227–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Ishida A, Akita K, Mori Y, Tanida S, Toda M, Inoue M, et al. Negative regulation of Toll‐like receptor‐4 signaling through the binding of glycosylphosphatidylinositol‐anchored glycoprotein, CD14, with the sialic acid‐binding lectin, CD33. J Biol Chem. 2014;289:25341–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Chen G‐Y, Brown NK, Wu W, Khedri Z, Yu H, Chen XI, et al. Broad and direct interaction between TLR and Siglec families of pattern recognition receptors and its regulation by Neu1. Elife. 2014;3:e04066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Hsu SP, Chen CC, Chien CT. Pretreatment of sialic acid efficiently prevents lipopolysaccharide‐induced acute renal failure and suppresses TLR4/gp91‐mediated apoptotic signaling. Kidney Blood Press Res. 2016;41:267–77. [DOI] [PubMed] [Google Scholar]
  • 62. Lopez PH, Schnaar RL. Gangliosides in cell recognition and membrane protein regulation. Curr Opin Struct Biol. 2009;19:549–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Kwak DH, Lee S, Kim SJ, Ahn SH, Song JH, Choo YK, et al. Ganglioside GM3 inhibits the high glucose‐ and TGF‐beta1‐induced proliferation of rat glomerular mesangial cells. Life Sci. 2005;77:2540–51. [DOI] [PubMed] [Google Scholar]
  • 64. Hata K, Koseki K, Yamaguchi K, Moriya S, Suzuki Y, Yingsakmongkon S, et al. Limited inhibitory effects of oseltamivir and zanamivir on human sialidases. Antimicrob Agents Chemother. 2008;52:3484–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Richards MR, Guo T, Hunter CD, Cairo CW. Molecular dynamics simulations of viral neuraminidase inhibitors with the human neuraminidase enzymes: insights into isoenzyme selectivity. Bioorg Med Chem. 2018;26:5349–58. [DOI] [PubMed] [Google Scholar]
  • 66. Abdulkhalek S, Guo M, Amith SR, Jayanth P, Szewczuk MR. G‐protein coupled receptor agonists mediate Neu1 sialidase and matrix metalloproteinase‐9 cross‐talk to induce transactivation of TOLL‐like receptors and cellular signaling. Cell Signal. 2012;24:2035–42. [DOI] [PubMed] [Google Scholar]
  • 67. Alghamdi F, Guo M, Abdulkhalek S, Crawford N, Amith SR, Szewczuk MR. A novel insulin receptor‐signaling platform and its link to insulin resistance and type 2 diabetes. Cell Signal. 2014;26:1355–68. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Data Availability Statement

Data or materials generated by this study are available upon request.


Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES