Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Streptomyces venezuelae) | sepH | StrepDB | vnz_27360 | http://strepdb.streptomyces.org.uk/ |
| Gene (S. venezuelae) | ftsZ | StrepDB | vnz_08520 | http://strepdb.streptomyces.org.uk/ |
| Gene (Mycobacterium smegmatis mc2 155) | sepHMs | Mycobrowser | msmeg_5685 | https://mycobrowser.epfl.ch/ |
| Gene (M. smegmatis mc2 155) | ftsZMs | Mycobrowser | msmeg_4222 | https://mycobrowser.epfl.ch/ |
| Strain, strain background (S. venezuelae) | WT | NZ_CP018074.1 | NRRL B-65442 | Wild type |
| Genetic reagent (S. venezuelae) | ΔsepH::apr | This paper | SV56 | Chromosomal sepH locus was replaced by apr-oriT cassette amplified with primers mb118/mb119 and then transduced into WT using ΦSV1 |
| Antibody | Anti-SepH (Rabbit polyclonal) | This paper | Cambridge Research Biochemicals | Automated Western blot (1:200) |
| Antibody | Anti-FtsZ (Rabbit polyclonal) | This paper | Cambridge Research Biochemicals | Automated Western blot (1:200) |
| Antibody | Anti-GFP (Rabbit polyclonal) |
Sigma Aldrich | SAB4301138-100UL | Automated Western blot (1:200) |
| Recombinant DNA reagent | pTB146 (plasmid) |
doi:10.1038/emboj.2008.264 | Plasmid for heterologous protein production | |
| Recombinant DNA reagent | pET-21b (plasmid) |
Novagen | 69741 | Plasmid for heterologous protein production |
| Recombinant DNA reagent | SepH (pFRL39, plasmid) |
This paper | sepH in pTB146 | Purification of SepH |
| Recombinant DNA reagent | FtsZ, (pSS287, plasmid) | This paper | ftsZ in pTB146 | Purification of FtsZ |
| Recombinant DNA reagent | FtsZMs(pSS560, plasmid) | This paper | ftsZMs in pTB146 | Purification of FtsZMs |
| Recombinant DNA reagent | SepHMs(pSS561, plasmid) | This paper | sepHMs in pET21b | Purification of SepHMs |
| Sequence-based reagent | mb118 | This paper | Redirect PCR primer | CACGTGACGTCGGCAGGCACCACCCGGGAGGTCCCCATGATTCCGGGGATCCGTCGACC |
| Sequence-based reagent | mb119 | This paper | Redirect PCR primer | AGCCGCGGAACCGGCGGACCGCCACGGCTCCTGCCGTCATGTAGGCTGGAGCTGCTTC |
| Commercial assay or kit | 12–230 KDa Wes separation module | Bio-Techne | SM-W004 | Plate and capillaries for Automated Western blot |
| Commercial assay or kit | WES anti-rabbit detection module | Bio-Techne | DM-001 | Secondary antibody, luminol and reagents for Automated Western blot |
| Commercial assay or kit | Frozen-EZ Yeast Transformation II Kit | Cambridge Bioscience | T2001 | Yeast two-hybrid analysis |
| Commercial assay or kit | Pi ColorLock Kit | Expedeon | 303–0030 | |
| Commercial assay or kit | CellASIC ONIX B04A-03 Microfluidic Bacteria Plate | Millipore | B04A-03-5PK | Time-lapse microscopy |
| Chemical compound, drug | GTP | Jena Bioscience | NU-1012 | GTPase assay, DLS, TEM, Co- sedimentation |
| Chemical compound, drug | GDP | Sigma Aldrich | G7127-10MG | DLS, TEM, Co- sedimentation |
| Chemical compound, drug | GMPCPP (GpCpp) | Jena Bioscience | NU-405S | DLS, TEM, Co- sedimentation |
| Chemical compound, drug | WGA (Wheat Germ Agglutinin), Alexa Fluor 488 Conjugate | Molecular Probes | W11261 | Cell wall staining |
| Chemical compound, drug | 7-AAD (7-Aminoactinomycin D) | Molecular Probes | A1310 | DNA staining |
| Chemical compound, drug | HADA (3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl) carbonyl]amino]-D-alanine hydrochloride) | Other | Cell wall staining; Gift from M. Thanbichler: synthesized after doi:10.1038/nprot.2014.197 | |
| Software, algorithm | Fiji | Open-source software package | Image analysis | |
| Software, algorithm | ZenBlue 2012 | Zeiss | Version 1.120 | Image analysis |
| Software, algorithm | Compass for SW | Bio-Techne | Version 4.0 | WES |
| Software, algorithm | Prism | GraphPad | Version 9.0 | Data analysis |
| Software, algorithm | CLUSTALX | http://www.clustal.org/clustal2/ | Phylogenetic analysis | |
| Software, algorithm | MAFFT | https://mafft.cbrc.jp/alignment/software/ | Phylogenetic analysis | |
| Software, algorithm | MUSCLE | https://www.ebi.ac.uk/Tools/msa/muscle/ | Phylogenetic analysis | |
| Software, algorithm | CD-HIT | http://weizhongli-lab.org/cd-hit/ | Phylogenetic analysis | |
| Software, algorithm | TRIM-AL | http://trimal.cgenomics.org/ | Phylogenetic analysis | |
| Software, algorithm | PHYML | http://www.atgc-montpellier.fr/phyml/ | Phylogenetic analysis | |
| Software, algorithm | iTOL | https://itol.embl.de/ | Phylogenetic analysis | |
| Software, algorithm | WebLogo3 | http://weblogo.threeplusone.com/ | Sequence logo |