Skip to main content
NCBI home page
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2021 Feb 15;49(5):2848–2858. doi: 10.1093/nar/gkab062

HuB and HuD repress telomerase activity by dissociating HuR from TERC

Xiaolei Cheng 1,2,3, Xiaoping Gu 3,3, Tianjiao Xia 4, Zhengliang Ma 5, Zhongzhou Yang 6, Helen Lechen Feng 7, Yong Zhao 8, Wenbin Ma 9, Zhenyu Ju 10, Myriam Gorospe 11, Xia Yi 12,✉, Hao Tang 13,✉, Wengong Wang 14,15
PMCID: PMC7969021  PMID: 33589924

Abstract

The ubiquitous RNA-binding protein HuR (ELAVL1) promotes telomerase activity by associating with the telomerase noncoding RNA TERC. However, the role of the neural-specific members HuB, HuC, and HuD (ELAVL2–4) in telomerase activity is unknown. Here, we report that HuB and HuD, but not HuC, repress telomerase activity in human neuroblastoma cells. By associating with AU-rich sequences in TERC, HuB and HuD repressed the assembly of the TERT–TERC core complex. Furthermore, HuB and HuD competed with HuR for binding to TERC and antagonized the function of HuR that was previously shown to enhance telomerase activity to promote cell growth. Our findings reveal a novel mechanism controlling telomerase activity in human neuroblastoma cells that involves a competition between HuR and the related, neural-specific proteins HuB and HuD.

INTRODUCTION

Telomeres include single-stranded DNA repeats at the 3′ ends of linear chromosomes and serve to maintain genomic stability (1,2). Telomeres become progressively shorter after each cell division, and when they reach a critically short size, they elicit a DNA damage response that triggers cellular phenotypes such as senescence (3). The maintenance of telomeric DNA length requires telomerase, a holoenzyme comprising the non-coding RNA TERC and the catalytic subunit TERT (4). TERC functions as a template for telomerase to catalyze the addition of single-stranded telomere DNA repeats onto the 3′ ends of linear chromosomes (5,6). Increasing evidence suggests that factors targeting TERC modulate the levels or function of TERC, and thereby telomerase activity (7).

Proteins such as DKC1 (dyskerin), TCAB1, GAR1, NHP2, NOP10, Pontin/Reptin, DAXX, the core protein components of box H/ACA small nucleolar ribonucleoprotein particles (snoRNPs), and telomeric proteins TIN2 and TPP1, are found to regulate telomerase activity through associating with TERC (8–17). HuR, ‘human antigen R’, also known as HuA and ELAVL1 (embryonic lethal abnormal vision-like 1), is the ubiquitous member of the Hu/elav RNA-binding protein family protein. It recognizes AU-rich or U-rich elements of almost all species of RNAs, in turn regulating processes such as cell proliferation, differentiation, senescence, and apoptosis (18,19). Interestingly, HuR is able to regulate telomerase activity by associating with TERC and promoting TERC modification at m5C (20). Neuronal cells express all of the members of the Hu RNA-binding protein family (HuR, HuB, HuC and HuD) even though their RNA-binding abilities are largely similar (21,22). Although the involvement of neural Hu proteins in neuronal differentiation, behavior, development, and maturation has been studied in detail (23–26), it is not known if they regulate telomerase activity and cellular senescence.

In the present study, we describe evidence that HuB and HuD associate with TERC in human neuroblastoma cells. The binding of HuB and HuD to TERC prevents HuR binding to TERC, thereby antagonizing the function of HuR in promoting telomerase activity and in delaying cellular senescence. Our findings reveal a concomitant regulation of telomerase activity by Hu RNA-binding proteins in human neuroblastoma cells.

MATERIALS AND METHODS

Cell culture, transfections, and SA-β-galactosidase activity

Human osteosarcoma U2OS cells and human neuroblastoma cells (SH-SY5Y) were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum, 100 units/ml penicillin and 100 μg/ml streptomycin, at 37°C in 5% CO2. All plasmid transfections were performed using Lipofectamine 3000 (Invitrogen) following the manufacturer's instructions. SA-β-gal activity was assessed by using a senescence β-Galactosidase Staining Kit (GENMED Scientifics Inc., Wilmington, USA).

EdU-incorporation and cell counting

EdU (5-ethynyl-2′-deoxyuridine) incorporation assays were performed by using a kit (RIBOBIO, Guangzhou, China) following the instructions from the manufacturer. Briefly, cells were digested and transferred to 96-well plates at a density of 4 × 103–1 × 105 cells per well, then incubated with 50 mM EdU for 3 h and washed twice with PBS. After paraformaldehyde fixation, cells were neutralized with 2 mg/mL glycine solution, permeabilized with osmotic agent (0.5% PBS of Triton X-100), and stained with 1 × Apollo® dye solution at room temperature for 30 min. After washing twice with osmotic agent, cells were stained again 1 × Hoechst 33342 reaction solution for 30 min. Cells then were washed with PBS and imaged by fluorescence microscopy.

For cell counting, a cell counting kit-8 (CCK8 kit, Abmole Bioscience Inc., Houston, USA) was used for cell counting following the manufacturer's instructions. Cells were digested and transferred to 96-well plates at a density of 1000–4000/well. Each sample had two duplicates. Cells were incubated with CCK8 agent for 2 h and the signal (OD) was detected at 450 nm by spectrophotometry.

Silencing of HuR, HuB, and HuD

To silence HuR, HuB, or HuD, siRNAs targeting HuR (AAGAGGCAAUUACCAGUUUCA), HuB (GCUAAUAACCCAAGCCAAA) or HuD (GAAUAUGACCCAAGAAGAA) were used; siRNA (UUGUUCGAACGUGUCACGUUU) was used as a control. Transfections were performed by using Oligofectamine (Invitrogen) following the manufacturer's instructions. Unless otherwise indicated, cells were collected for analysis 48 h after transfection.

To stably silence HuR, HuB, or HuD, SH-SY5Y cells were infected with lentiviruses bearing vector expressing shHuR, shHuD or shHuB. Forty-eight hours later, cells were cultured in medium containing puromycin (1.5 μg/ml) and cultured for an additional 7 days. Cells then were cultured in medium containing puromycin (1.0 μg/ml) until cells were collected for experiments.

Immunofluorescence analysis

Cells were fixed with 4% paraformaldehyde for 30 min at room temperature and then permeabilized in 0.1% Triton X-100. To detect HuB, HuD, and Coilin, cells were blocked with 5% BSA for 30 min and incubated with antibodies recognizing HuB (1:200),HuD (1:100),HuC(1:100),HuR(1:200) or Coilin (1:200) overnight at 4°C. After washing with PBS, cells were incubated with FITC-conjugated or TRIFC-conjugated secondary antibodies (1:200) at room temperature for 1 h. Cells were then stained with DAPI and mounted. Fluorescence was visualized using a Leica microscope.

Western blot analysis and reverse transcription (RT) followed by real-time quantitative (q)PCR analysis

Western blot analysis was performed following standard procedures. Monoclonal antibodies recognizing GAPDH, α-tubulin (TUBA), or HuR were from Santa Cruz and a monoclonal anti-flag antibody was from Sigma. Polyclonal antibodies recognizing HuB and HuC were from Proteintech. Monoclonal anti-HuD antribody was from ABcam. For reverse transcription (RT) followed by real-time quantitative (q)PCR (RT-qPCR) analysis to detect human TERC and human TERT mRNA, we used the following primer pairs: TCTAACCCTAACTGAGAAGGGCGTAG and GTTTGCTCTAGAATGAACGGTGGAAG for TERC, and TCCACTCCCCACATAGGAATAGTC and TCCTTCTCAGGGTCTCCACCT for TERT (forward and reverse, respectively). GAPDH mRNA was measured to normalize RT-qPCR results and was amplified using primer pairs CTGGGCTACACTGAGCACC and AAGTGGTCGTTGAGGGCAATG.

RNA pulldown, UV-crosslinking RNP IP and UV-crosslinking rEMSA

For RNA pulldown assays, PCR-amplified DNA was used as template to transcribe biotinylated RNA by using T7 RNA polymerase in the presence of biotin-UTP. One microgram of purified biotinylated transcripts was incubated with 100 μg of cytoplasmic extracts for 30 min at room temperature. Complexes were isolated with paramagnetic streptavidin-conjugated Dynabeads (Dynal, Oslo), and the pulldown material was assessed by western blot analysis.

For UV-crosslinking RNP IP assays, lysates from cells exposing to UVC (400 mJ/cm2) were used for immunoprecipitation by using anti-HuR, anti-HuB, anti-HuD, or anti-flag antibody. The IP materials were washed twice with a stringent buffer (100 mM Tris–HCl, pH 7.4, 500 mM LiCl, 0.1% Triton X-100, 1 mM DTT, protease Inhibitor Cocktail) and twice with the IP buffer. The RNA in RNP IP was assessed by RT-qPCR analysis.

For UV-crosslinking RNA electrophoretic mobility shift assay (UV-crosslinking rEMSA), the RNA-protein interaction mixtures (0.02 ml) contained 50 mM Tris (pH 7.0), 150 mM NaCl, 0.25 mg/ml tRNA, 0.025 mg/ml bovine serum albumin, 500 nM of purified his-HuB or his-HuD and 500 nM of in vitro-transcribed TERC. Reactions were incubated at 25 °C for 30 min, and digested with RNase T1 (100 U/reaction) for 15 min at 37°C. After crosslinking of complexes with UV light (1800 J/m2), reactions were used for western blot analysis.

Constructs

For construction of the pcDNA3.1 vector (QIAGEN) expressing HuB, the coding region of HuB was amplified by using primer pairs GCGGATCCGCGATGGAAACACAACTGTCT and GCGAATTCGCTTAGGCTTTGTGCGTTTTGT and inserted between the BamH I and EcoR I sites of the vector. For construction of the pcDNA3.1 vector expressing HuD, the coding region of HuD was amplified by using primer pairs CGAAGCTTGCGATGGTTATGATAATTAGCAC and GCGGATCCCGTCAGGACTTGTGGGCTTTG and inserted between the Hind III and BamH I sites of the vector. To construct vectors expressing his-HuB or his-HuD in E. coli, the coding regions of HuB and HuD were amplified using primer pairs CAGGATCCATGGAAACACAACTGTCTAA and CGCTCGAGTTAGGCTTTGTGCGTTTTG and primer pairs GCGGATCCATGGTTATGATAATTAGCACCATGG and ATCTCGAGTCAGGACTTGTGGGCTTTG, respectively, and inserted between BamH I and XhoI sites of pet28a-His vector (QIAGEN). To construct vector expressing shHuB, oligo pairs GATCCGGCTAATAACCCAAGCCAAATTCAAGAGATTTGGCTTGGGTTATTAGCTTTTTTC and AATTGAAAAAAGCTAATAACCCAAGCCAAATCTCTTGAATTTGGCTTGGGTTATTAG CCG were annealed and inserted between BamH I and EcoR I sites of PHBLV-zsGreen-U6 plasmid. To construct the vector expressing shHuD, oligomer pairs GATCCGGAATATGACCCAAGAAGAATTCAAGAGATTCTTCTTGGGTCATATTCTTTTTTC and AATTGAAAAAAGAATATGACCCAAGAAGAATCTCTTGAATTCTTCTTGGGTCATATT CCG were annealed and inserted between BamH I and EcoR I sites of PHBLV-zsGreen-U6 plasmid. To construct the vector expressing shHuR, oligo pairs GATCCGAAGAGGCAATTACCAGTTTCATTCAAGAGATGAAACTGGTAATTGCCTCTTCTTTTTTC and AATTGAAAAGAAGAAGAGGCAATTACCAGTTTCATCTCTTGAATGAAA CTGGTAATTGCCTCTTCG were annealed and inserted between BamH I and EcoR I sites of plasmid PHBLV-zsGreen-U6. The pcDNA 3.0 (+) vectors (Invitrogen) expressing TERC, flag-tagged TERT (human TERT), HuR, as well as the p3 × Flag-CMV 10 vector expressing full-length human flag-TERT) were described previously (20,27).

Preparation of transcripts

cDNA was used as a template to amplify the different fragments of TERC. All 5′ primers contained the T7 promoter sequence CCAAGCTTCTAATACGACTCACTATAGGGAGA-3′ (T7). To amplify templates for synthesizing RNAs TERC, TERC-A, and TERC-B, we used following primer pairs; (T7) GGGTTGCGGAGGGTGGGCCT and GCATGTGTGAGCCGAGTCCTGG for TERC, (T7) GGGTTGCGGAGGGTGGGCCT and AGGCCGAGGCTTTTCCGCC for TERC-A, and (T7) GCCGCCTTCCACCGTTCATT and GCATGTGTGAGCCGAGTCCTGG for TERC-B. The p27 5′UTR and CR fragments were described previously (28). The templates for variants of TERC (U40A, U100A and U40A+U100A) were amplified from the pcDNA 3.0 (+) vector expressing these variants, as described previously (20). PCR-amplified DNA was used as the template to transcribe biotinylated RNA by using T7 RNA polymerase in the presence of biotin-UTP.

Telomere repeat amplification protocol (TRAP) and telomere length measurement

For TRAP assays, cells were collected and used for the analysis of telomerase activity by using polyacrylamide gels (12%), and visualized by staining with SYBR Safe (Invitrogen), as described previously (29). Telomere length was determined by using a kit from Roche (Cat. No. 12 209 136 001) following the manufacturer's instructions. Genomic DNA was digested with Hinf I and Rsa I, and resolved on 0.8% agarose gels. After denaturation, gels were hybridized with a Digoxin-labeled, telomere-specific hybridization probe (TAGGG), and then exposed to X-ray film. The mean terminal restriction fragment (TRF) length was calculated according to the formula: mean TRF = ∑(ODi)/∑(ODi/Li) (where ODi and Li are the signal intensity and the molecular weight at the position i, respectively).

Statistical analysis

Two-tailed Student's t test was used to analyze the significance of the data. Significance was indicated only when P value <0.05.

RESULTS

HuB and HuD associate with TERC

In a previous study, we found that the HuR, the ubiquitous member of Hu/elav RNA-binding protein family, regulates telomerase activity by associating with TERC (20). To test if the neuronal Hu/elav proteins (HuB, HuC and HuD) might play similar role as HuR, RNA pulldown assays were performed by using human neuroblastoma SH-SY5Y cell lysate and in vitro-transcribed biotinylated TERC. As shown in Figure 1A by western blot analysis, HuB, HuD, and HuR, but not HuC, were present in the pulldown materials, suggesting that HuB and HuD may associate with TERC. This interaction was validated by UV-crosslinking complexes that contained purified his-tagged HuB, purified his-tagged HuD or purified his-tagged HuR and TERC in vitro; as shown by western blot analysis (Figure 1B), HuB, HuD, and HuR, but not HuC, bound to TERC migrated as larger complexes. By RNP IP assays (Figure 1C), TERC was found enriched in the ribonucleoprotein immunoprecipitation (RIP) materials recovered by using an anti-HuB antibody, an anti-HuD antibody, or an anti-HuR antibody, but not after RIP with an anti-HuC antibody. In addition, HuB, HuD and HuR, but not HuC, were found to co-localize with coilin in Cajal bodies, where TERC undergoes maturation (Figure 1D).

Figure 1.

Figure 1.

Open in a new tab

HuB and HuD associate with TERC. (A) RNA pulldown assays were performed by using SH-SY5Y cell lysates and in vitro-transcribed TERC. The presence of HuB,HuD,HuC or HuR in the pulldown materials was assessed by western blot analysis. (B) UV crosslinking rEMSA assays were performed by using purified his-HuB,his-HuD,his-HuC and his-HuR as well as in vitro-transcribed TERC. The covalently bound HuB or HuD (complex, ‘Com.’) was detected by western blot analysis. (C) The association of HuB, HuC and HuD with TERC was assessed by using RNP IP assays. The presence of HuB, HuC and HuD in the IP materials was assessed by RT-qPCR analysis. IP using an anti-IgG antibody and an anti-HuR antibody served as positive and negative controls, respectively. Data are the means ± SD from three independent experiments. (D) Immunofluorescence assays were performed to test the co-localization of Coilin with HuB,HuD,HuC orHuR. DAPI was used to visualize nuclei. Data are representatives from three independent experiments.

HuR associates with TERC at the 5′end (positions 1–139) (20). To further determine if HuB and HuD associated with TERC at the same region, we tested if HuB and HuD bound the full-length TERC, TERC fragment A (positions 1–139) and/or TERC fragment B (positions 140–451) (Figure 2A, schematic) by biotin–RNA pulldown assays. As shown in Figure 2B, HuB and HuD associate with the full-length TERC and fragment A, but not with fragment B. Fragment A contains two AU-rich elements (ARE1 and ARE2, locating at positions 38–43 and positions 98–103, respectively) that are recognized by HuR (20). To test if HuB and HuD were capable of recognizing these AREs, in vitro-transcribed TERC and the variants bearing mutations at ARE1 (U40A), ARE2 (U100A) or both (U40A + U100A) (Figure 2C, schematic) were used for pulldown assays. Mutating U40, but not U100, greatly reduced the association of both HuB and HuD with TERC (P < 0.01), while mutating both (U40A + U100A) exhibited similar effect as the mutation of the ARE1 in reducing this association (P < 0.01) (Figure 2D and E). Therefore, HuB and HuD associate with TERC at the ARE1.

Figure 2.

Figure 2.

Open in a new tab

HuB and HuD associate with TERC in the same motif. (A) Schematic representation depicts the fragments of TERC used for RNA pulldown assays. (B) RNA pulldown assays were performed using SH-SY5Y cell lysates and in vitro-transcribed TERC fragments depicted in (A). The CR (coding region) and 3′UTR fragments of p27 mRNA served as negative (N) and positive (P) controls, respectively. A 5-μg aliquot input (Inp.) and binding to GAPDH were also assessed. (C) Schematic representation depicts full length TERC (WT) and its variants used for pulldown assays. (D) The association of HuB and HuD with TERC variants bearing mutations U40A, U100A, or U40A + U100A (U40/100A) (Figure 2C, Schematic) was determined by using RNA pulldown assays. (E) Quantification of the bands detected by western blot analysis in (D); data are the means ± SD of the signals from three independent experiments and significance is analyzed by two-tailed Student's t test (**P < 0.01).

HuB and HuD antagonize the association of HuR with TERC

Next, we asked if HuB and HuD influenced the association of HuR with TERC by silencing HuB or HuD in SH-SY5Y cells. As shown, knockdown of HuB or HuD markedly increased the association of HuR with TERC, while knockdown of HuR greatly increased the association of HuB or HuD with TERC (P < 0.05 or P < 0.01) (Figure 3A-B and Supplementary Figure S1A and B). On the other hand, overexpression of HuB or HuD repressed the association of HuR with TERC, while overexpression of HuR repressed the binding of HuB or HuD to TERC (P < 0.05 or P < 0.01) (Figure 3C, D and Supplementary Figure S1C and D). HuR was previously shown to have no effect on the expression levels of TERT and TERC (20). Similarly, knockdown of HuB or HuD did not influence the levels of TERT mRNA and protein nor the levels of TERC (Supplementary Figure S2). Furthermore, knockdown of HuB or HuD did not alter the levels of HuR; knockdown of HuR had no effect on the levels of HuB and HuD (Supplementary Figure S3A and B). Moreover, knockdown of HuB did not alter HuD protein levels, and HuD knockdown did not alter HuB protein levels (Supplementary Figure S4). Together, these results indicate that HuB and HuD antagonize the association of HuR with TERC, and vice versa.

Figure 3.

Figure 3.

Open in a new tab

HuB and HuD compete with HuR to associate with TERC. (A, B) SH-SY5Y cells were transfected with a siRNA targeting HuB or HuD (A), or HuR (B) for 48 h. RNA pulldown assays were performed to evaluate the association of HuR, HuB or HuD with TERC. (C, D) SH-SY5Y cells were co-transfected with a vector expressing HuB together with a vector expressing HuD (C) or transfected with a vector expressing HuR (D). Forty-eight hours later, RNA pulldown assays were performed by using in vitro-transcribed TERC. The levels of HuR, HuB, HuD and TUBA were monitored by western blot analysis (Input, Inp.). Data in all panels are representative of three independent experiments.

HuB and HuD repress telomerase activity by inhibiting telomerase assembly

To evaluate the effect of HuB and HuD in regulating telomerase activity, cell lysates from SH-SY5Y cells with silenced HuB, HuD, or both HuB and HuD were used for TRAP assays. As shown in Figure 4A, knockdown of HuB or HuD increased telomerase activity significantly (by ∼1.65-fold and ∼1.67-fold, respectively; P < 0.01); knockdown of both HuB and HuD was much more effective than knockdown of HuB or HuD alone in increasing telomerase activity (by ∼3.24-fold; P < 0.01). On the other hand, overexpression of HuB or HuD reduced telomerase activity by ∼54.7% and ∼69.3%, respectively (P < 0.01); overexpression of both HuB and HuD was much more effective than overexpression of HuB or HuD alone in reducing telomerase activity (∼84.2%, P < 0.01) (Figure 4B). These results suggest that HuB and HuD cooperatively repress telomerase activity.

Figure 4.

Figure 4.

Open in a new tab

HuB and HuD repress telomerase activity. (A) Top, SH-SY5Y cells were transfected with a siRNA targeting HuB or HuD, or co-transfected with both siRNAs (siHuB/D). Forty-eight hours later, the levels of HuB, HuD, and TUBA were monitored by western blot analysis. Middle, cells described in top panels were used for TRAP assays. Bottom, the density of the signals in the middle panels was scanned and plotted as the means ± SD from three independent experiments; significance is analyzed by two-tailed Student's t test (**P < 0.01). (B) Top, vectors expressing HuB (pHuB) or HuD (pHuD), or co-transfected with both vectors (pHuB/D). Forty-eight hours later, the levels of HuB, HuD and TUBA were monitored by western blot analysis. Middle, cells described in top panels were used for TRAP assays. Bottom, the density of the signals in the middle panels is scanned and plotted as the means ± SD from three independent experiments; significance is analyzed by two-tailed Student's t test (**P < 0.01).

To further assess the role of HuB and HuD in repressing telomerase activity, SH-SY5Y cells with stably silenced HuB, HuD, or both HuB and HuD were used for measuring telomere length. As shown in Figure 5A and B, although knockdown of HuB or HuD alone increased telomerase activity (Figure 4), neither transient (3 days) nor stable (60 days) knockdown of HuB or HuD exhibited significant effect in altering telomere length. However, stable simultaneous knockdown of HuB and HuD (60 days), but not transient simultaneous knockdown of HuB and HuD (3 days), significantly extended telomere length, confirming the cooperative regulation of telomere activity by HuB and HuD (P < 0.01) (Figure 5C).

Figure 5.

Figure 5.

Open in a new tab

HuB and HuD repress telomerase activity. (A–C) Top, SH-SY5Y cells were transfected with a vector expressing shHuB (A), shHuD (B) or co-transfected with a vector expressing shHuB together with a vector expressing shHuD (C). After times indicated (3, 3 days; 60, 60 days), DNA was isolated and subjected to Southern blot analysis to assess the length of the telomeres. Bottom, the density of the signals shown in the upper panels of (A–C) is presented as the means ± SD from three independent experiments; significance is analyzed by two-tailed Student's t test (**P < 0.01).

The association of HuR with TERC promotes the assembly of the telomerase complex, in turn enhancing telomerase activity (20). Specifically, we asked if HuB and HuD influenced the assembly of TERT-TERC complex through associating with TERC. As shown in Figure 6A and B by RNP IP assays, knockdown of HuB or HuD in SH-SY5Y cells increased the association of flag-TERT with TERC (P < 0.01), while overexpression of HuB or HuD, exhibited opposite effect (P < 0.01). Human osteosarcoma U2OS cells, which do not express endogenous human TERT or TERC (30), were used for evaluating the effect of ectopic expression of HuB and HuD in TERT-TERC assembly. This cell line was transfected with a vector expressing flag-tagged-TERT (human TERT) together with a vector expressing human TERC. The effect of the ectopically expressed HuB and HuD on telomerase assembly was then evaluated. By RNA pulldown assays using in vitro transcribed TERC, ectopic co-expression of HuB and HuD in U2OS cells reduced the presence of flag-TERT in the pulldown materials (P < 0.01) (Figure 6C). Further study showed that co-expression of HuB and HuD decreased the telomerase activity in U2OS cells expressing ectopic flag-TERT and TERC (Figure 6D) (P < 0.01). Therefore, HuB and HuD are able to repress telomerase activity by inhibiting the assembly of TERT–TERC complex.

Figure 6.

Figure 6.

Open in a new tab

HuB and HuD repress the assembly of TERT-TERC complex. (A, B) SH-SY5Y cells were transfected with a vector expressing flag-tagged human TERT (flag-TERT). Twenty-four hours later, cells were further transfected with a siRNA targeting HuB or HuD (A), or transfected with a vector expressing HuB (pHuB) or HuD (pHuD) (B) and cultured for additional 48 h. RNP IP assays were performed by using an anti-flag antibody to test the levels of TERC in the IP materials. Data are the means ± SD from three independent experiments; significance was analyzed by two-tailed Student's t test (**P < 0.01). (C) U2OS cells were co-transfected with vectors expressing flag-TERT and TERC. Twenty-four hours later, cells were further co-transfected with vectors expressing HuB and HuD. After an additional 48 h, RNA pulldown assays were performed by using biotinylated TERC to test the presence of flag-TERT (flag) and HuB/D (using both HuB and HuD antibodies). The levels of flag-TERT, HuB/D and TUBA were monitored (Input, Inp.) by western blot analysis. Data are the means ± SD from three independent experiments; significance is analyzed by two-tailed Student's t test (**P < 0.01). (D) Left, U2OS cells processed as described in (C) were used for TRAP assays. Right, the density of the signals of TRAP analysis from the left panels is presented as the means ± SD from three independent experiments; significance is analyzed by two-tailed Student's t test (**P < 0.01).

HuB and HuD antagonize the effect of HuR in regulating telomerase activity

Based on the findings that HuB and HuD antagonized the association of HuR with TERC and both HuB and HuD repressed telomerase activity (Figures 3–5), we proposed that HuB and HuD might antagonize the effect of HuR in regulating telomerase activity. To test this possibility, HuR alone (shHuR), HuB and HuD (shHuB/D) or HuR, HuB and HuD (shHuB/D/R) were silenced stably in SH-SY5Y cells. TRAP assays and Southern blot analysis were used to determine telomerase activity and telomere length, respectively. In agreement with previous findings (20), knockdown of HuR reduced telomerase activity and shortened telomere length (Figure 7A–C, lanes 2). As anticipated, the combined knockdown of HuB and HuD increased telomerase activity and extended telomere length (Figure 7A–C, lanes 3). Importantly, however, simultaneous knockdown of HuR, HuB and HuD did not significantly alter telomerase activity or telomere length (Figure 7A–C, lanes 4). In sum, HuB and HuD antagonized the effect of HuR as promoter of telomerase activity, and vice versa.

Figure 7.

Figure 7.

Open in a new tab

HuB and HuD compete with HuR to regulate telomerase activity. (A) Top, SH-SY5Y cells were transfected with a vector expressing shHuR, co-transfected with vectors expressing shHuB and shHuD (shHuB/D), or co-transfected with vectors expressing shHuB, shHuD and shHuR (shHuB/D/R). Sixty days later, western blot analysis was used to monitor the levels of HuR, HuB, HuD and TUBA. Data are representative from three independent experiments. (B) Top, cells described in (A) were used for TRAP assays. Bottom, the density of the signals shown in the upper panels of (A) was presented as the means ± SD from three independent experiments; significance is analyzed by two-tailed Student's t test (**P < 0.01). (C) Top, cells processed as described in (A) were subjected to Southern blot analysis to assess telomere length. The density of the signals shown in the top panels of (C) is presented as the means ± SD from five independent experiments (bottom); significance is analyzed by two-tailed Student's t test (**P < 0.01).

HuB/D-telomerase regulatory process impacts on cellular senescence

Telomerase and telomere are critically important for cell growth and senescence (1–3). To further address if HuB and HuD influenced cell senescence by preventing telomerase activity, SH-SY5Y cells described in Figure 7 were further subjected to EdU incorporation assay (Figure 8A and B), cell counting assay (by using CCK8 kit) (Figure 8C) and SA-β-gal staining assays (Figure 8D and E). As anticipated, knockdown of HuR in SH-SY5Y cells decreased EdU incorporation and inhibited cell growth, thereby accelerating cell senescence. Conversely, knockdown of HuB and HuD together increased EdU incorporation, induced cell growth and delayed cellular senescence. In addition, knockdown of HuB, HuD and HuR together failed to influence the DNA replication, cell growth and cellular senescence, as observed from the results of EdU incorporation, CCK8 and SA-β-gal staining assays. Together, the competition between HuR and HuB/D modulates telomerase activity and cellular senescence.

Figure 8.

Figure 8.

Open in a new tab

HuB and HuD compete with HuR in regulating cellular senescence. (A, B) SH-SY5Y cells were stably transfected with a vector expressing shHuR, co-transfected with vectors expressing shHuB and shHuD (shHuB/D), or co-transfected with vectors expressing shHuB, shHuD and shHuR (shHuB/D/R). Cells then were subjected to EdU incorporation assays. Representative images (A) and the means ± SD from three independent experiments (B) are shown. (C) Cells processed as described in (A) were cultured for the times indicated and used for cell counting assays to evaluate the cell growth. Data are the means ± SD from three independent experiments. (D, E) Cells described in (A) were cultured for 72 h and subjected to SA-β-gal staining. Representative images (D) and the means ± SD from three independent experiments (E) are shown. Significance in (B), (C) and (E) is analyzed by two-tailed Student's t test (*P < 0.05; **P < 0.01).

DISCUSSION

The ubiquitous RNA-binding protein HuR associates with TERC and promotes telomerase activity (20). The present study supports the notion that the neural-specific ELAVL family proteins HuB and HuD are also able to associate with TERC (Figure 1), in turn reducing the ability of HuR to associate with TERC and reducing telomerase activity (Figures 3–5). However, our results suggest that the association of HuB and HuD with TERC represses telomerase activity (Figures 6 and 7); this is opposite to what we found earlier for HuR, which promoted the telomerase activity (20). Importantly, the regulation of telomerase activity by HuB and HuD impacted upon cell proliferation and senescence (Figure 8). These findings support the view that Hu/elav RNA-binding proteins in the nerve system and other tissues expressing HuD or HuB (e.g. testis, ovary, small lung cancer, pancreatic islets, etc.) (22,31,32) may represent a way to fine-tune or balance telomerase activity, by eliciting both positive and negative regulation. Given that telomere homeostasis is also important for cell differentiation, apoptosis, DNA damage response and mitochondrial metabolism (33–35), the concurrent regulation of telomerase by the Hu/elav proteins may also influence these processes.

Although the joint silencing of HuB and HuD effectively extended telomere length, individual knockdown of HuB or HuD alone did not significantly alter telomere length (Figure 5), even though HuB and HuD each associated with TERC and repressed telomere activity (Figures 1, 4 and 5). Therefore, it is plausible that the two proteins, HuB and HuD, work together in regulating telomerase activity. Whether they form a dimer or only one RNA-binding protein physically associates with TERC is not known at present. In addition, while HuR, HuB and HuD appear quite abundant in human neuroblastoma cells, their relative abundance in neurons in the body remains to be further studied. HuR is found to maintain telomerase activity through promoting TERC C106 methylation (m5C methylation) (20). Interestingly, knockdown of HuB and HuD increased the levels of C106 methylation of TERC (P < 0.01, Supplementary Figure S5), while simultaneous knockdown of HuR diminished the effect of HuB and HuD knockdown in increasing the levels of C106 methylation. Therefore, HuB and HuD may also regulate telomerase activity through inhibiting TERC methylation.

The mechanisms underlying the roles of HuR, HuD and HuB in cellular senescence in these cells likely depends on their influence on other mRNAs, as mRNAs encoding other factors associated with proliferation and senescence (p27, p16, p21, c-fos, cyclin A, cyclin B and numerous cytokines) (18,19) are similarly recognized by all three proteins. In fact, the members of the Hu/elav proteins share affinities for many of the same RNAs and are sometimes viewed as having redundant actions on gene expression. However, as in the neuronal paradigm illustrated here, they may also have opposite effects on target RNAs and hence in cellular processes (like telomerase activity and telomere length) and thus contribute in this manner to homeostatic regulation of neuronal tissues.

DATA AVAILABILITY

The authors declare that all data supporting the findings of this study are available within the article and its Supplementary Information files. The raw data for dot graphs and uncropped versions of any gels or blots or micrographs presented in the figures and supplementary figures are included in the Data Source File. The vectors used in this study will be available from the corresponding author upon reasonable request.

Supplementary Material

gkab062_Supplemental_Files
Click here for additional data file. (6.3MB, zip)

ACKNOWLEDGEMENTS

The authors wish to thank Dr Cong Y for providing the p3 × Flag-CMV 10 vector expressing flag-TERT (human TERT) and Dr Ma W’s groups for technological helps.

Author contributions: X. Y., H. T., J. Z., Z, M., Y. Z., M.G. and W. W. designed the study. X. C., X. G., T. X., H. T., H.L.F. and X. Y. performed the experiments. M.G., X. G., X. Y., H. T. and W. W. wrote the paper.

Contributor Information

Xiaolei Cheng, Department of Biochemistry and Molecular Biology, Beijing Key Laboratory of Protein Posttranslational Modifications and Cell Function, School of Basic Medical Sciences, Peking University Health Science Center, 38 Xueyuan Road, Beijing 100191, China; National Health Commission Key Laboratory of Cardiovascular Regenerative Medicine, Heart Center of Henan Provincial People's Hospital, Central China Fuwai Hospital of Zhengzhou University, Central China Fuwai Hospital & Central China Branch of National Center for Cardiovascular Diseases, Zhengzhou, Henan 450003, China.

Xiaoping Gu, Department of Anesthesiology, Affiliated Drum Tower Hospital of Medical Department, Nanjing University, Nanjing 210000, China.

Tianjiao Xia, Department of Anesthesiology, Affiliated Drum Tower Hospital of Medical Department, Nanjing University, Nanjing 210000, China.

Zhengliang Ma, Department of Anesthesiology, Affiliated Drum Tower Hospital of Medical Department, Nanjing University, Nanjing 210000, China.

Zhongzhou Yang, State Key Laboratory of Pharmaceutical Biotechnology and MOE Key Laboratory of Model Animal for Disease Study, Model Animal Research Center, Nanjing Biomedical Research Institute, Nanjing University, Nanjing 210061, China.

Helen Lechen Feng, Department of Biology, Boston University, 5 Cummington Mall, Boston, MA 02215, USA.

Yong Zhao, Key Laboratory of Gene Engineering of the Ministry of Education, State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou 510006, China.

Wenbin Ma, Key Laboratory of Gene Engineering of the Ministry of Education, State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou 510006, China.

Zhenyu Ju, Key Laboratory of Regenerative Medicine of Ministry of Education, Institute of Aging and Regenerative Medicine, Jinan University, Guangzhou 510632, China.

Myriam Gorospe, Laboratory of Genetics and Genomics, National Institute on Aging, National Institutes of Health, 251 Bayview Blvd., Baltimore, MD 21224, USA.

Xia Yi, Department of Biochemistry and Molecular Biology, Beijing Key Laboratory of Protein Posttranslational Modifications and Cell Function, School of Basic Medical Sciences, Peking University Health Science Center, 38 Xueyuan Road, Beijing 100191, China.

Hao Tang, National Health Commission Key Laboratory of Cardiovascular Regenerative Medicine, Heart Center of Henan Provincial People's Hospital, Central China Fuwai Hospital of Zhengzhou University, Central China Fuwai Hospital & Central China Branch of National Center for Cardiovascular Diseases, Zhengzhou, Henan 450003, China.

Wengong Wang, Department of Biochemistry and Molecular Biology, Beijing Key Laboratory of Protein Posttranslational Modifications and Cell Function, School of Basic Medical Sciences, Peking University Health Science Center, 38 Xueyuan Road, Beijing 100191, China; Center for Healthy Aging, Changzhi Medical College, Changzhi 046000, China.

SUPPLEMENTARY DATA

Supplementary Data are available at NAR Online.

FUNDING

National Key Research and Development Program of China [2017YFA0504302]; National Natural Science Foundation of China [81730033, 81930035, 91749208, 81901412, 82071577, 81572843]; Medical Science and Technology Project of Henan Province [SBGJ202003015]; M.G. was supported by the NIA IRP, NIH. Funding for open access charge: National Natural Science Foundation of China [81901412, 82071577].

Conflict of interest statement. None declared.

REFERENCES

  • 1. Shay J.W., Wright W.E.. Telomeres and telomerase: three decades of progress. Nat. Rev. Genet. 2019; 20:299–309. [DOI] [PubMed] [Google Scholar]
  • 2. Blackburn E.H., Epel E.S., Lin J.. Human telomere biology: a contributory and interactive factor in aging, disease risks, and protection. Science. 2015; 350:1193–1198. [DOI] [PubMed] [Google Scholar]
  • 3. Shawi M., Autexier C.. Telomerase, senescence and ageing. Mech. Ageing Dev. 2008; 129:3–10. [DOI] [PubMed] [Google Scholar]
  • 4. Garcia C.K., Wright W.E., Shay J.W.. Human diseases of telomerase dysfunction: insights into tissue aging. Nucleic Acids Res. 2007; 35:7406–7416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Greider C.W. Telomere length regulation. Annu. Rev. Biochem. 1996; 65:337–365. [DOI] [PubMed] [Google Scholar]
  • 6. Nandakumar J., Cech T.R.. Finding the end: recruitment of telomerase to telomeres. Nat. Rev. Mol. Cell Biol. 2013; 14:69–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Roake C.M., Artandi S.E.. Regulation of human telomerase in homeostasis and disease. Nat. Rev. Mol. Cell Biol. 2020; 21:384–397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Lustig A. The identification of telomerase subunits: catalysing telomere research. Trends. Cell Biol. 1997; 7:299–302. [DOI] [PubMed] [Google Scholar]
  • 9. Mitchell J.R., Wood E., Collins K.. A telomerase component is defective in the human disease dyskeratosis congenita. Nature. 1999; 402:551–555. [DOI] [PubMed] [Google Scholar]
  • 10. Wang C., Meier U.T.. Architecture and assembly of mammalian H/ACA small nucleolar and telomerase ribonucleoproteins. EMBO J. 2004; 23:1857–1867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Liu D., Safari A., O’Connor M.S., Chan D.W., Laegeler A., Qin J., Songyang Z.. PTOP interacts with POT1 and regulates its localization to telomeres. Nat. Cell Biol. 2004; 6:673–680. [DOI] [PubMed] [Google Scholar]
  • 12. O’Connor M.S., Safari A., Xin H., Liu D., Songyang Z.. A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc. Natl.Acad. Sci. U.S.A. 2006; 103:11874–11879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Xin H., Liu D., Wan M., Safari A., Kim H., Sun W., O’Connor M.S., Songyang Z.. TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature. 2007; 445:559–562. [DOI] [PubMed] [Google Scholar]
  • 14. Fu D., Collins K.. Purification of human telomerase complexes identifies factors involved in telomerase biogenesis and telomere length regulation. Mol. Cell. 2007; 28:773–785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Pogacic E., Dragon C., Filipowicz W.. Human H/ACA small nucleolar RNPs and telomerase share evolutionarily conserved proteins NHP2 and NOP10. Mol. Cell. Biol. 2000; 20:9028–9040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Tang M., Li Y., Zhang Y., Chen Y., Huang W., Wang D., Zaug A.J., Liu D., Zhao Y., Cech T.R.et al.. Disease mutant analysis identifies a novel function of DAXX in telomerase regulation and telomere maintenance. J. Cell. Sci. 2014; 128:331–341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Zhang Y., Wu Y., Mao P., Li F., Han X., Zhang Y., Jiang S., Chen Y., Huang J., Liu D.et al.. Cold-inducible RNA-binding protein CIRP/hnRNP A18 regulates telomerase activity in a temperature-dependent manner. Nucleic Acids Res. 2016; 44:761–775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Grammatikakis I., Abdelmohsen K., Gorospe M.. Posttranslational control of HuR function. Wiley Interdiscip. Rev. RNA. 2017; 8:1372–1382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Wang W. Regulatory RNA-binding proteins in senescence. Ageing Res. Rev. 2012; 11:485–490. [DOI] [PubMed] [Google Scholar]
  • 20. Tang H., Wang H., Cheng X., Fan X., Yang F., Zhang M., Chen Y., Tian Y., Liu C., Shao D.et al.. HuR regulates telomerase activity through TERC methylation. Nat. Commun. 2018; 9:2213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Mirisis A.A., Carew T.J.. The ELAV family of RNA-binding proteins in synaptic plasticity and long-term memory. Neurobiol. Learn. Mem. 2019; 161:143–148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Szabo A., Dalmau J., Manley G., Rosenfeld M., Wong E., Henson J., Posner J.B., Furneaux H.M.. HuD, a paraneoplastic encephalomyelitis antigen, contains RNA-binding domains and is homologous to Elav and Sex-lethal. Cell. 1991; 67:325–333. [DOI] [PubMed] [Google Scholar]
  • 23. Quattrone A., Pascale A., Nogues X., Zhao W., Gusev P., Pacini A., Alkon D.L.. Posttranscriptional regulation of gene expression in learning by the neuronal ELAV-like mRNA-stabilizing proteins. Proc. Natl. Acad. Sci. USA. 2001; 98:11668–11673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Akamatsu W., Okano H.J., Osumi N., Inoue T., Nakamura S., Sakakibara S., Miura M., Matsuo N., Darnell R.B., Okano H.. Mammalian ELAV-like neuronal RNA-binding proteins HuB and HuC promote neuronal development in both the central and the peripheral nervous systems. Proc. Natl. Acad. Sci. U.S.A. 1999; 96:9885–9890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. DeBoer E.M., Azevedo R., Vega T.A., Brodkin J., Akamatsu W., Okano H., Wagner G.C., Rasin M.R.. Prenatal deletion of the RNA-binding protein HuD disrupts postnatal cortical circuit maturation and behavior. J Neurosci. 2014; 34:3674–3686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Sanna M.D., Quattrone A., Galeotti N.. Antidepressant-like actions by silencing of neuronal ELAV-like RNA-binding proteins HuB and HuC in a model of depression in male mice. Neuropharmacology. 2018; 135:444–454. [DOI] [PubMed] [Google Scholar]
  • 27. Chang N., Yi J., Guo G., Liu X., Shang Y., Tong T., Cui Q., Zhan M., Gorospe M., Wang W.. HuR uses AUF1 as a cofactor to promote p16INK4 mRNA decay. Mol. Cell. Biol. 2010; 30:3875–3886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Tang H., Fan X., Xing J., Liu Z., Jiang B., Dou Y., Gorospe M., Wang W.. NSun2 delays replicative senescence by repressing p27 (KIP1) translation and elevating CDK1 translation. Aging (Albany NY). 2015; 7:1143–1158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Kim N.W., Piatyszek M.A., Prowse K.R., Harley C.B., West M.D., Ho P.L., Coviello G.M., Wright W.E., Weinrich S.L., Shay J.W.. Specific association of human telomerase activity with immortal cells and cancer. Science. 1994; 266:2011–2015. [DOI] [PubMed] [Google Scholar]
  • 30. Liu H., Liu Q., Ge Y., Zhao Q., Zheng X., Zhao Y.. hTERT promotes cell adhesion and migration independent of telomerase activity. Sci. Rep. 2016; 6:22886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Good P.J. A conserved family of elav-like genes in vertebrates. Proc. Natl. Acad. Sci. U.S.A. 1995; 92:4557–4561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Lee E.K., Kim W., Tominaga K., Martindale J.L., Yang X., Subaran S.S., Carlson O.D., Mercken E.M., Kulkarni R.N., Akamatsu W.et al.. RNA-binding protein HuD controls insulin translation. Mol. Cell. 2012; 45:826–835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Jackson M.R., Bavelaar B.M., Waghorn P.A., Gill M.R., El-Sagheer A.H., Brown T., Tarsounas M., Vallis K.A.. Radiolabeled oligonucleotides targeting the RNA subunit of telomerase inhibit telomerase and induce DNA damage in telomerase-positive cancer cells. Cancer Res. 2019; 79:4627–4637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Moody C.A., Laimins L.A.. Human papillomavirus oncoproteins: pathways to transformation. Nat. Rev. Cancer. 2010; 10:550–560. [DOI] [PubMed] [Google Scholar]
  • 35. Sahin E., Colla S., Liesa M., Moslehi J., Müller F.L., Guo M., Cooper M., Kotton D., Fabian A.J., Walkey C.et al.. Telomere dysfunction induces metabolic and mitochondrial compromise. Nature. 2011; 470:359–365. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

gkab062_Supplemental_Files
Click here for additional data file. (6.3MB, zip)

Data Availability Statement

The authors declare that all data supporting the findings of this study are available within the article and its Supplementary Information files. The raw data for dot graphs and uncropped versions of any gels or blots or micrographs presented in the figures and supplementary figures are included in the Data Source File. The vectors used in this study will be available from the corresponding author upon reasonable request.

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES