Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2021 Mar 17;11:6092. doi: 10.1038/s41598-021-85633-4

Role of biochar, compost and plant growth promoting rhizobacteria in the management of tomato early blight disease

Mujahid Rasool 1, Adnan Akhter 1,✉, Gerhard Soja 2,3, Muhammad Saleem Haider 1
PMCID: PMC7971063  PMID: 33731746

Abstract

The individual role of biochar, compost and PGPR has been widely studied in increasing the productivity of plants by inducing resistance against phyto-pathogens. However, the knowledge on combined effect of biochar and PGPR on plant health and management of foliar pathogens is still at juvenile stage. The effect of green waste biochar (GWB) and wood biochar (WB), together with compost (Comp) and plant growth promoting rhizobacteria (PGPR; Bacillus subtilis) was examined on tomato (Solanum lycopersicum L.) physiology and Alternaria solani development both in vivo and in vitro. Tomato plants were raised in potting mixture modified with only compost (Comp) at application rate of 20% (v/v), and along with WB and GWB at application rate of 3 and 6% (v/v), each separately, in combination with or without B. subtilis. In comparison with WB amended soil substrate, percentage disease index was significantly reduced in GWB amended treatments (Comp + 6%GWB and Comp + 3%GWB; 48.21 and 35.6%, respectively). Whereas, in the presence of B. subtilis disease suppression was also maximum (up to 80%) in the substrate containing GWB. Tomato plant growth and physiological parameters were significantly higher in treatment containing GWB (6%) alone as well as in combination with PGPR. Alternaria solani mycelial growth inhibition was less than 50% in comp, WB and GWB amended growth media, whereas B. subtilis induced maximum inhibition (55.75%). Conclusively, the variable impact of WB, GWB and subsequently their concentrations in the soil substrate was evident on early blight development and plant physiology. To our knowledge, this is the first report implying biochar in synergism with PGPR to hinder the early blight development in tomatoes.

Subject terms: Plant sciences, Pathogens

Introduction

Tomato (Solanum lycopersicum L.) is an extensively cultivated horticultural crop, with global consumption of second to potato1. In 2018, around 182 million tons of tomato has been produced on an area of 4.76 million hectares in more than 150 countries2. Tomato is the richest source of vitamins (A and C) and antioxidant (lycopene pigment) making it an integral component of our balanced diet3. Early blight (EB) on tomato caused by Alternaria solani, is an air-borne soil inhabiting fungus with the reputation of being one of the most destructive disease of tomato solely accounting for yield losses of up to 80%4. Disease symptoms on tomatoes include small dark brown bullseye spots with concentric ring patterns, which become enlarged with the progression of infection and cover the whole leaf5. The pathogen can overwinter in plant debris or soil as conidia or mycelia and becomes a source of inoculum upon availability of suitable temperature (27–32 °C), humidity (50–70%) and host plant6. For the management of EB disease of tomato, many techniques have been in used such as chemical control by using fungicides e.g. propineb, mancozeb, copper oxychlorode, Tebuconazole, propiconazole7,8 and selection of resistant genotypes9–12. In addition, different bio-control techniques are also being employed for the management of EB such as PGPR-mediated protection by stimulating production and activity of antioxidant peroxidase (POX) and polyphenol oxidase (PPO) enzymes in host plants4,13, use of galrlic (Allium sativum) extract12, essential oils extracted from different varieties of Eucalyptus14, nano-particles biosynthesized from fruit peel extract of citrus kinnow15, extract from wild medicinal plants including Calotropis procera (Aitón) W. T. Aiton16 and Putranjiva roxburghii17. Besides different control strategies, chemical control by fungicides has been regarded asa predominant practice for the EB management18. Agro-chemicals, in addition to causing severe damages to human and environment health are also responsible for the development of resistance in A. solani against different fungicides19. Therefore, we need to explore chemicals independent, environment friendly organic solutions for the management of A. solani in tomato.

Amongst the innovative and novel organic materials, biochar a charcoal like product formed by pyrolysis (a process involving heating of organic materials in an oxygen deficient environment) has shown promises against many plant pathogens20. The physico-chemical properties of biochars are dynamic in nature, dependent upon source of raw organic material (e.g., green waste, wood chips, crop residues, poultry manure etc.) as well as processing conditions especially the temperature of pyrolysis21–23. Recent studies have revealed that the application of biochar in combination with compost has synergistic effects on growth and nutrient uptake by plants24,25.

Additionally, biochar has been reported to be effective in suppressing diseases caused by both soil-borne and air-borne plant pathogens such as Fusarium oxysporum f. sp. lycopersici on tomato26, Rhizoctonia solani on cucumber27, while Podosphaera aphanis on strawberry28, Botrytis cinerea, Leveillula taurica on tomato and pepper29,30. However, the effect of biochar as soil amendment on A. solani causing EB of tomato, a pathosystem of huge economic impact, is yet to be determined. In horticulture practices, compost has been used to improve crop yield and quality of soil31. As it’s a rich source of nutrients e.g. P and N, thus reduce the need for application of inorganic fertilizers32. The properties of compost rely on various factors such as composting conditions, originating feedstock such as plant-green-waste33, or animal source such as sheep manure34 and poultry residues35. Further, most of the published studies report that compost amendments has ability to suppress the most common air-borne diseases of tomato plant including EB (A. solani)36–38 and septoria blight (Septoria lycopersici)39–41.

Moreover, it has also been proposed that the combination of biochar and compost induce modifications in physical and chemical properties of soil, leading to better plant growth and production42–45. There was synergistic impact of co-application of biochar and compost for the management of soil-borne diseases and enhancing the activity of beneficial microbial populations of the soil including arbuscular mycorrhizal fungi46, plant growth promoting rhizobacteria (PGPR) and other bio-control agents47. Among diverse microbial communities of soil, bacteria including PGPR outnumber all others. PGPR like Bacillus subtilis, Pseudomonas fluorescens, Burkholderia phytofirmans and Azospirillum spp. not only improves nutrient access to plants but also suppress diseases and other abiotic stresses faced by the plants48–50. PGPR suppress foliar pathogens by inducing systemic resistance via metabolic pathways involving ethylene or jasmonic acid (JA)51,52. Therefore, considering a balanced use of soil organic additives and biological antagonists provide an innovative platform to control the soil-borne as well as aerial pathogens53.

The individual role of biochar, compost and PGPR against foliar disease suppression has been well documented30,37,38,52. While, synergistic potential of biochar and PGPR combination in plant growth promotion has only been studied in few times such as in soybean54, French beans (Phaseolus vulgaris)55, chickpea (Cicer arietinum)56 and wheat57. Further, Hafez et al.58 and Danish et al.59 studied the combined effect of biochar and PGPR on rice (Oryza sativa L.) and maize (Zea mays L.) for the management of abiotic stresses such as salinity and drought, respectively. In this study we focused on economically important pathosystem, comprising of tomato with annual production value of ∼$59 billion and A. solani causing enormous losses both in the field and greenhouse5. Therefore, the present study was designed to achieve the following objectives, (a) to assess the influence of biochars made from different feed stocks i.e. WB and GWB, when applied at different concentrations to the soil substrate on tomato growth and on the development of A. solani, (b) to evaluate combined impact of PGPR (B. subtilis), biochar and compost on physiological growth parameters and suppression of EB of tomato, and, (c) to evaluate the in vitro antifungal potential of biochars, compost and PGPR against A. solani mycelial growth. It is expected that outcome of the study will provide a way forward in plant disease management by organic innovations, while fulfilling the objectives of sustainable agricultural practices.

Results

Molecular analysis for the confirmation of the Alternaria solani

The ITS and β-tubulin 1 gene primers amplified PCR products of 580 bp and 364 bp, respectively (Supplementary Fig. S1). The sequences of the PCR products were deposited to the Genbank and received accession numbers MT899419 and MT899420 for ITS and β-tubulin 1, respectively. BLASTn comparison analysis of the ITS GenBank accession No. MT899419 has shown close homology (99.66%) with the A. solani isolates from china (MG012294.1 and MG012293.1), while β-tubulin 1 GenBank accession No. MT899420 has similarity (99.45%) with A. solani isolate from Korea (JF417707.1).

Estimation of plant growth parameters

The reduction in shoot height was significant among all the A. solani inoculated treatments (Fig. 1A–C). Maximum plant height (45.21 and 44.07 cm) was in treatment ‘Comp + 6%GWB + PGPR’ in the absence and presence of disease stress, respectively (Fig. 1C). Amongst A. solani inoculated plants, significant reduction in shoot heights were ranked as (according to soil amendment; from minimum reduction to maximum) green waste biochar amended treatments were followed by the wood biochar, compost and lastly by the un-amended soil control both with and without the PGPR.

Figure 1.

Figure 1

Effect of Alternaria solani and PGPR on tomato plant height grown in various soil substrate compositions including; (A) soil and compost (Comp) alone with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (B) compost (Comp) with 3 and 6% wood biochar (WB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (C) compost (Comp) with 3 and 6% Green waste biochar (GWB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani). All values represent mean ± SE, recorded 40 days after transplantation. Bars with different letters on the top suggest significant difference as per Tukey’s HSD test (P ≤ 0.05).

The results of three-way ANOVA presented as P values are summarized in Table 1. Soil substrate compositions comprising of compost alone and in combination with 3 and 6% of each wood biochar and green waste biochar, PGPR and A. solani served as main factors. Plant height was significantly (P < 0.001) influenced by the interactive effect of soil substrate composition (SC) with both PGPR and A. solani (AS) [(SC × PGPR and SC × AS, respectively)], as well as by the interaction of PGPR and A. solani (PGPR × AS; (P ≤ 0.05). Therefore, in the presence of PGPR, both wood and green waste biochar had a positive impact on plant height, root and shoot dry weight (Figs. 1, 2, 3). Among all the treatments either with or without biochar, A. solani inoculation caused reduction in dry weights of above and below ground plant parts (Figs. 2, 3). However, maximum root dry weight (2.22 g) was found in tomato plants grown in treatment ‘Comp + 6%GWB + PGPR’, while no significant reduction recorded in dry root biomass under early blight influence (Comp + 6%GWB + PGPR + A. sol; 1.97 g). There was an increase of ~ 23% in root dry biomass of + A. solani tomato plants grown in ‘Comp + 6%WB + PGPR’ and ‘Comp + 6%GWB + PGPR’ substrates unlike their − PGPR counterparts (Fig. 2B,C). In addition to the significant (P < 0.001) effect of individual variables, there was also a significant (P ≤ 0.05) interaction effect between soil composition and A. solani (SC × AS) on dry root weight. While, in case of dry shoot weight of tomato plants a significant (P < 0.001) three way interaction between SC × PGPR × AS was reported (Table 1).

Table 1.

Three-way ANOVA results represented as level of significance of the effect of factors soil substrate composition (SC), Alternaria solani (AS) and plant growth promoting rhizobacteria; Bacillus subtilis (BS) and their interactions on tomato plant growth and physiological parameters.

Plant height Dry root weight Dry shoot weight Nitrogen contents Phosphorus contents Potassium contents Chlorophyll contents
SC *** *** *** *** *** *** ***
PGPR *** *** *** *** *** *** ***
AS *** *** *** *** *** *** ***
SC × PGPR *** *** *** ns *** ns **
SC × AS * * *** ns *** ** ns
PGPR × AS *** ns *** ns ns ns ns
SC × AS × PGPR ns ns *** ns ns ns ns

ns non-significant.

*P ≤ 0.05; **P < 0.01 ***P < 0.001.

Figure 2.

Figure 2

Effect of Alternaria solani and PGPR on dry root weight of tomato raised in various soil substrate compositions including; (A) soil and compost (Comp) alone with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (B) compost (Comp) with 3 and 6% wood biochar (WB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (C) compost (Comp) with 3 and 6% Green waste biochar (GWB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani). All values represent mean ± SE, recorded 40 days after transplantation. Bars with different letters on the top suggest significant difference as per Tukey’s HSD test (P ≤ 0.05).

Figure 3.

Figure 3

Effect of Alternaria solani and PGPR on dry shoot weight of tomato raised in various soil substrate compositions including; (A) soil and compost (Comp) alone with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (B) compost (Comp) with 3 and 6% wood biochar (WB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (C) compost (Comp) with 3 and 6% Green waste biochar (GWB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani). All values represent mean ± SE, recorded 40 days after transplantation. Bars with different letters on the top suggest significant difference as per Tukey’s HSD test (P ≤ 0.05).

Among compost and biochar amended treatments, lowest dry shoot weight (2.73 g) was in the ‘Comp + 3%WB − PGPR’ treatment with A. solani induced disease stress, and highest (5.92 g) in ‘Comp + 6%GWB + PGPR’ treatment without A. solani (Fig. 3B,C). The pathogen (A. solani) induced reduction in the shoot dry weight was significant in all the treatments, however, only found to be non-significant in 3%GWB amended treatment (Comp + 3%GWB + PGPR) in comparison to its un-inoculated compliment. In the presence of disease stress, maximum shoot dry biomass (5.04 g) was measured in plants grown in ‘Comp + 6%GWB + PGPR’ treatment, while the lowest (1.09 g) was in soil control without any organic amendments and PGPR (Fig. 3A,C). The maximum reduction 26.45% and 20.86% in shoot dry weight was recorded in treatment ‘Comp − PGPR’ and ‘Comp + 6%WB + PGPR’, respectively in comparison to their respective A. solani free counterparts (Fig. 3A,B).

Plant physiological parameters

Estimation of chlorophyll contents of tomato plants

In addition to the interactive effect of SC × PGPR (P < 0.01), all main factors including soil composition, PGPR and A. solani significantly (P < 0.001) influenced the chlorophyll contents of tomato plants. The soil composition containing 6%GWB significantly increased the quantity of chlorophyll in tomato plants as described in Table 2. Maximum contents of chlorophyll 44.02 ± 0.24 and 43.07 ± 0.08 were observed in plants raised in ‘Comp + 6%GWB + PGPR’ and ‘Comp + 6%GWB − PGPR’ treatments, respectively in the absence of A. solani. Overall, A. solani inoculation induced reduction in the chlorophyll contents. While, the plants inoculated with A. solani, grown in compost and/or biochar amended treatments irrespective to the concentration and type of the biochar have sustained the level of chlorophyll contents. Under early blight stress highest chlorophyll contents (42.95 ± 0.33) were in ‘Comp + 6%GWB + PGPR’ treatment, while the lowest content level (33.61 ± 0.28) was measured in soil control in the absence of PGPR.

Table 2.

Effect of Alternaria solani and PGPR on chlorophyll contents of tomato plants grown in different soil substrate compositions including compost alone and in combination with 3 and 6% of wood biochar (WB) and green waste biochar (GWB).

Treatments Chlorophyll contents (SPAD value)
Soil − PGPR  − A. sol 34.39 ± 0.21kl
 + A. sol 33.61 ± 0.28l
Soil + PGPR  − A. sol 35.65 ± 0.37jk
 + A. sol 34.17 ± 0.32kl
Comp − PGPR  − A. sol 36.62 ± 0.23ij
 + A. sol 35.90 ± 0.30j
Comp + PGPR  − A. sol 39.26 ± 0.20efg
 + A. sol 38.14 ± 0.30gh
Comp + 3%WB − PGPR  − A. sol 38.10 ± 0.19ghi
 + A. sol 37.10 ± 0.22hij
Comp + 3%WB + PGPR  − A. sol 39.32 ± 0.28efg
 + A. sol 38.56 ± 0.34fgh
Comp + 6%WB − PGPR  − A. sol 40.02 ± 0.32def
 + A. sol 39.00 ± 0.34efg
Comp + 6%WB + PGPR  − A. sol 40.91 ± 0.24 cd
 + A. sol 40.00 ± 0.20def
Comp + 3%GWB − PGPR  − A. sol 41.07 ± 0.21 cd
 + A. sol 40.09 ± 0.14de
Comp + 3%GWB + PGPR  − A. sol 42.11 ± 0.31bc
 + A. sol 41.25 ± 0.40 cd
Comp + 6%GWB − PGPR  − A. sol 43.07 ± 0.08ab
 + A. sol 41.97 ± 0.39bc
Comp + 6%GWB + PGPR  − A. sol 44.02 ± 0.24a
 + A. sol 42.95 ± 0.33ab

Data were mean values ± standard error (n = 5) followed by different letters in the superscript suggest significant difference as per Tukey’s HSDtest (P ≤ 0.05).

SPAD-502—Soil Plant Analyses Development chlorophyll meter of Konica Minolta company was used.

Nitrogen, phosphorous and potassium contents of tomato plants

ANOVA analysis highlighted the significant (P < 0.001) effect of soil composition, PGPR and A. solani (Table 1) on Nitrogen (N) contents of tomato plants. Figure 4A–C demonstrated a higher percentage of nitrogen (N) contents in tomato shoots grown in both wood and green waste biochar with and/or without PGPR. Highest N contents (%) 4.11 and 3.87% were measured in ‘Comp + 6%GWB + PGPR’ treatment both in the absence and presence of A. solani, respectively (Fig. 4C). Tomato plants grown in wood biochar has sustained the level of N contents under disease stress as compared to their respective healthy compliments (Fig. 4B).

Figure 4.

Figure 4

Effect of Alternaria solani and PGPR on percentage of nitrogen in leaf tissues of tomato raised in various soil substrate compositions including; (A) soil and compost (Comp) alone with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (B) compost (Comp) with 3 and 6% wood biochar (WB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (C) compost (Comp) with 3 and 6% Green waste biochar (GWB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani). All values represent mean ± SE, recorded 40 days after transplantation. Bars with different letters on the top suggest significant difference as per Tukey’s HSD test (P ≤ 0.05).

In case of Phosphorous (P) contents (ppm), a significant (P < 0.001) interaction effect of SC × PGPR and SC × AS was observed (Table 1). The maximum significant value of P contents was recorded in plants raised in 6%GWB amended soil in association with PGPR either un-infected or infected with A. solani (0.56 and 0.48 ppm), respectively (Fig. 5C). Whereas, the level of P contents significantly reduced in remaining GWB amended treatments inoculated with A. solani, both with and without PGPR. The same trend has been recorded for P contents of plants grown in wood biochar amended soil (Fig. 5B). However, the minimum (0.09 ppm) was recorded in the A. solani infected plants grown in soil only without compost and biochar amendments (Fig. 5A).

Figure 5.

Figure 5

Effect of Alternaria solani and PGPR on phosphorus contents of leaf tissues in leaf tissues of tomato raised in various soil substrate compositions including; (A) soil and compost (Comp) alone with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (B) compost (Comp) with 3 and 6% wood biochar (WB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (C) compost (Comp) with 3 and 6% Green waste biochar (GWB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani). All values represent mean ± SE, recorded 40 days after transplantation. Bars with different letters on the top suggest significant difference as per Tukey’s HSD test (P ≤ 0.05).

Tomatoes infection with A. solani had a significant impact on lowering the potassium (K) contents (ppm) in all of the treatments (Fig. 6A–C). Data analysis revealed significant (P < 0.01) interactive effect between soil amendments and A. solani on K contents of tomato plants. In comparison with all of the treatments, plants grown in soil amended with green waste biochar depicted higher K contents, with the maximum of 1.94, 1.72 and 1.70 ppm in ‘Comp + 6%GWB + PGPR’, ‘Comp + 3%GWB − PGPR’ and A. solani inoculated plants in ‘Comp + 6%GWB + PGPR’ treatment, respectively (Fig. 6C). The factor PGPR also significantly (P < 0.001) influenced the K contents in tomatoes. However, plants grown in wood biochar (6%) amended treatments were 1.43 and 1.33 ppm, in the presence and absence of PGPR, respectively (Fig. 6B). The lowest value of K contents (0.56 ppm) was recorded in A. solani inoculated plants grown in soil without any compost and biochar amendment.

Figure 6.

Figure 6

Effect of Alternaria solani and PGPR on potassium contents of leaf tissues in leaf tissues of tomato raised in various soil substrate compositions including; (A) soil and compost (Comp) alone with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (B) compost (Comp) with 3 and 6% wood biochar (WB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani), (C) compost (Comp) with 3 and 6% Green waste biochar (GWB) with (+ PGPR) and without PGPR (− PGPR), inoculated (+ A. solani) or un-inoculated (− A. solani). All values represent mean ± SE, recorded 40 days after transplantation. Bars with different letters on the top suggest significant difference as per Tukey’s HSD test (P ≤ 0.05).

Alternaria solani incidence, percent disease index and assessment of disease response of tomato plants

Early blight incidence, percent disease index (PDI) and tomato plant response to disease was assessed thirty 4r days after transplanting on the basis of symptoms development and severity. The incorporation of biochar in plant growth medium has a suppressive effect on A. solani development on tomatoes alone and in combination with PGPR (Table 3). In case of soil amendment carrying 3% GWB, an increase in disease incidence from 40 (Comp + 3%GWB-PGPR) to 60% (Comp + 3%GWB + PGPR) was observed. Whereas, PDI was significantly reduced (10.53%) in the ‘Comp + 3%GWB + PGPR’ treatment in comparison to its non-PGPR counterpart. Minimum disease incidence (20%) and PDI (20 ± 1.26) was observed in tomato plants raised in 6%GWB amended soil substrate in the presence of PGPR (Comp + 6%GWB + PGPR). Similarly, there was a reduction of 12.8 and 19.18% in the PDI, as recorded in treatment ‘Comp + PGPR’ and ‘Comp + 3%WB + PGPR’, respectively, when compared to their—PGPR counterparts.

Table 3.

Effect of different soil substrate compositions and plant growth promoting rhizobacteria (PGPR) on disease incidence, percent disease index and disease responses of tomato plant against Alternaria solani.

Treatments* DI (%) PDI ± SE DR
Soil − PGPR 100 80.8 ± 1.50a HS
Soil + PGPR 80 80.0 ± 2.19a HS
Comp − PGPR 80 68.8 ± 2.33b HS
Comp + PGPR 80 60.0 ± 1.26c S
Comp + 3%WB − PGPR 60 58.4 ± 2.04c S
Comp + 3%WB + PGPR 60 47.2 ± 2.33d S
Comp + 6%WB − PGPR 60 44.8 ± 2.33d S
Comp + 6%WB + PGPR 40 42.4 ± 1.60de S
Comp + 3%GWB − PGPR 40 37.6 ± 2.04e MR
Comp + 3%GWB + PGPR 60 31.2 ± 1.50f MR
Comp + 6%GWB − PGPR 40 23.2 ± 1.50g R
Comp + 6%GWB + PGPR 20 20.0 ± 1.26g R

*All treatments were inoculated with Alternaria solani.

DI disease incidence, PDI ± SE percent disease index ± standard error, DR disease response, R resistant, MR moderately resistant, S susceptible, HS highly susceptible.

Overall, tomato plant response to A. solani varied from highly susceptible (S) to resistant (R) grown in different soil substrate compositions, with the PDI values ranging between 20 and 80.8%. The plants grown in ‘Comp + 6%GWB + PGPR’ have shown ‘R’ response to early blight followed by moderately resistant (MR) response in ‘Comp + 3%GWB + PGPR’, and ‘Comp + 3%GWB − PGPR’, while susceptible (S) response in all of the wood biochar amended treatments was recorded (Table 3). Whereas, tomato plants were highly susceptible (HS) to A. solani, when grown in the absence of any soil amendment as well as in the treatment containing only compost (Comp-PGPR).

In vitro effect of compost, biochar and Bacillus subtilis on Alternaria solani mycelium growth and development

In vitro toxicity of compost and biochar (WB and GWB) amended PDA media and PGPR towards A. solani is shown in Table 4, while the un-amended media served as a control. The lowest (1.77%) inhibition of fungal radial growth was recorded in media modified with compost. Further, no significant difference in A. solani mycelium growth inhibition (10.27 and 15.91%), in WB (3%) and GWB (3%) amended media, respectively. However, with the increase in the concentration of biochar i.e. WB (6%) and GWB (6%) in PDA, the efficiency of fungal radial growth inhibition was also increased. So it was observed that GWB (6%) has induced significantly higher (38.74%) A. solani mycelium growth inhibition, followed by the media amended with WB (6%; 29.21% inhibition) in comparison to the control. The maximum mycelia growth inhibition (55.75%) was recorded in B. subtilis inoculated PDA, surpassing all other treatments used in the assay.

Table 4.

In vitro mycelium radial growth (mm) and inhibition (%) of Alternaria solani in control (un-amended), compost (Comp, 20%), PGPR (Bacillus subtilis), wood biochar (WB, 3%, 6%), green waste biochar (GWB, 3%, 6%) amended PDA.

Treatments Radial growth (mm) Inhibition (%)
Control 82.3 ± 0.80a
Comp 80.8 ± 0.58a 1.77 ± 1.48e
WB (3%) 73.8 ± 1.16b 10.27 ± 2.02d
WB (6%) 58.2 ± 1.28b 29.21 ± 2.15c
GWB (3%) 69.2 ± 5.83c 15.91 ± 2.16d
GWB (6%) 50.4 ± 0.93d 38.74 ± 1.28b
PGPR 36.4 ± 0.51e 55.75 ± 0.81a

Given results are mean values ± standard error followed by different letters in the superscript within a column denotes significant differences according to Tukey’s HSD test (P ≤ 0.05).

Discussion

Phyto-pathogens minimize the yield and deteriorate the quality of agricultural products causing significant economic losses to the agricultural entrepreneurs60. Excessive use of agricultural chemicals incite environmental and health issues as well as leads to the mutations in pathogenic strains rendering them resistant to existing disease management practices61. In this regard, emergence of multiple A. solani isolates62, with enhanced resistance against fungicides such as azoxystrobin, pyraclostrobin63, mancozeb and chlorothalonil64, ignites the need for the development of sustainable disease management strategies duly harmonized with the environment. Therefore, the current study was conducted with the aim of developing a novel, sustainable and economically viable approach to enhance crop productivity by reducing pathogen induced losses without damaging the diversity of life around65.

Biochar application is an ancient method to improve the soil quality, however it is only been last two decades that witnessed the keen interest of researchers towards biochar as carbon sequestration and organic plant protection agent66. The individual effects of compost and B. subtilis against EB of tomato has already been documented36,48. However, the response of tomatoes grown in biochar and PGPR modified soil medium against EB has not been explored earlier. To our knowledge, the results presented here for the first time elucidate the effectiveness of compost, biochar mixture together with PGPR on foliar pathogen (A. solani) development in tomatoes.

The different biochars with diverse compositions don’t follow uniform application rate principal to get desired response either in case of plant health improvement or disease suppression27,67. Similarly, in our study, not only biochar types but also their application rate influenced the EB disease incidence, severity and plant’s vegetative as well as physiological responses. We found the ineffectiveness of WB at both application rates in suppressing the disease. On the contrary GWB significantly reduced the disease at both of the application rates i.e. 3 and 6%, while being more effective at higher concentration. Zwart and Kim68, documented the reduction in Phytophthora spp. induced stem lesions in landscape tress species (Acer rubrum and Quercusrubra) grown in potting media amended with 5% biochar made from raw material of pine (Pinus spp.) origin, whereas Elad et al.20 found the enhanced suppression of Botrytis cinerea at higher application rate of biochar. In contrast with our finding, Harel et al.28 demonstrated the reduction in disease inhibition of foliar pathogens causing powdery mildew and grey mold on strawberry at comparatively lower biochar doses. While, Atucha and Litus69, documented the effectiveness of pinewood biochar at much higher application rates i.e. 10 and 20% (v/v), against replant disease in susceptible peach rootstock. Thus, effective diseases suppression and plant growth promotion rely heavily on biochar type and concentration to be applied in the potting medium.

However, there are also studies suggesting antagonistic effect of biochar on plant protection against diseases such as of maple wood bark biochar application increased the severity of Rhizoctonia solani in multiple plant species including crops of horticultural importance such as tomato, carrot, radish and others70.

The control of plant pathogens with biochar could be the result of direct toxicity to only soil-borne pathogens, however, in case of foliar pathogens the probable mode of action needs further elucidation. Earlier studies conducted on biochar effect on Botrytis cinerea, Colletotrichum acutatum and Podosphaera apahanis development on strawberry revealed the activation of expression of defence-related genes involved in ISR and SAR pathways28. Whereas, Mehari et al.29 reported the ISR/Jasmonic acid pathways involvement in imparting resistance in tomatoes against B. cinerea. So, it was proposed that systemic induced resistance plausibly the main component in suppressing foliar pathogens by biochar amendments20, in addition to increased/healthy plant growth. Multiple studies have repeatedly shown that composts have a suppressive effect on soil-borne diseases such as damping, root rots71,72 by modifying the rhizosphere and/or soil microbial profile as a whole73.

It is also suggested that the incorporation of PGPR with other organic soil amendments significantly contribute towards improved plant health47, and better protection from phyto-pathogens74. In a very rare study, Postma et al.75 reported the effectiveness of co-application of animal bone charcoal and phosphate solubilizing rhizobacteria against soil-borne disease of tomato namely, damping-off (Pythium aphanidermatum) and Fusarium crown and root rot (Fusarium oxysporum f. sp. radicis-lycopersici).

Our results also indicated the enhanced protection of tomatoes against A. solani in the presence of PGPR in biochar amended potting substrate. Addition of the biochar in soil formulate a unique environment consisting of high carbon contents, minute quantities of phenols and other organic acids with the ability to induce hormesis response46. While, the working efficiency of B. subtilis is influenced by biotic like plant genotype, microbial community and etc., as well as abiotic factors such as soil type, organic contents, and temperature76, clearly correlates with the findings of this study. Biochar might serve as a suitable carrier material for PGPR or bio-control agents66,75. Moreover, with an added advantage of enhanced survivability, multiplication and colonization in porous spaces of biochar77, makes it an ideal candidate for the development of bio-control formulation for commercial applications.

Therefore, the effects of PGPR must be anticipated as a result of multiple factors involving soil environment, antibiosis, induction of systemic resistance, and pathosystem under investigation78. However, PGPR mediated ISR is mainly considered responsible for the enhanced level of protection against foliar pathogens52,79. Another study attributed the B. subtilis induced protection from EB to the production of antioxidants and over-expression of systemic induced resistance genes80.

Taken together, biochar and PGPR also perform critical function in priming of host defence by inducing the activation of salicylic acid and jasmonic acid pathways30. Once primed, the plant can cope with the challenging pathogens more aggressively and efficiently81. Both biochar borne chemicals and PGPR inoculation potentiate the systemic resistance and cascade of defence related signaling events82,83.

Plant growth response to biochars depend upon the organic material used for the pyrolysis46. In this study, GWB addition in tomatoes growing medium containing compost had a significant positive impact on plant growth, when applied at 6% (v/v) application rate. Previously, She et al.84 found that there was an increase in tomato vegetative growth parameters at higher doses of wheat straw biochar. Whereas, Rajkovich et al.85 documented that the change in feedstock type produced a variable growth patterns in corn. In general, application of biochar with proper nutrient source such as compost, could have a positive influence on plant health and production86. Earlier, Schulz and Glaser43, found that the application of biochar with compost was more desirous than with the mineral fertilizers in terms of improving plant growth. Further, biochar and compost had a positive impact on soil properties and in increasing the growth of plant as reported by Safaei Khorram et al.87.

Moreover, the differences in plant growth in either WB and/or GWB amended potting media might be due to the differences in their nutrient retention capacity. As, the nutrients from biochars made from leaf-like material are easily accessible to the plants then the biochars obtained from woody feed stock26,88,89. Similarly, Hossain et al.90 reported the increase in tomato growth raised in soil modified with wastewater sludge biochar to enhanced nutrient retention and availability of N and P. While, Vaccari et al.91 described an enhanced availability of N, P and K to the tomato plants grown in biochar treated soils.

Overall, increase in growth could also be due to the additional liming impact of the biochar, thereby increasing the plant’s efficiency of nutrient utilization92. Our results had also revealed that the increased tomato agronomic and physiological growth parameters to the treatments with greater concentration of either WB or GWB because of their increased ability to lower the soil pH.

The additional growth promotion by PGPR, might not only be due to the nutritional or liming effect, other factors such as production of plant growth hormones, biocontrol activity and organic acids plausibly contribute to activated plant growth response. Egamberdieva et al.54 reported an increase in soybean (Glycine max L.) plant growth grown in hydrochar (2%) attributed to enhanced plant growth promoting rhizobacterial activity in the root zone. The production of Indole 3-acetic acid (IAA) by PGPR has a major share in activating plant cellular multiplication which contributes in development of a vigorous roots network. Araujo et al.93 also reported the production of IAA and abscisic acid by B. subtilis strains resulting in root growth promotion. Additionally, PGPR are also known to aid in solubilisation of unavailable form of nutrients by organic acid production94 thus, facilitating the transport of nutrients from rhizosphere to the plant95. As a result, enhanced nutrient uptake from well-established root system corresponds to increased metabolic activity as well as growth and development of above-ground plant parts96,97.

Parallel to the tomatoes growth response, the chlorophyll contents also responded in the same way to biochar amendment (little or no effect of WB, while positive effect of GWB) both in the presence and absence of EB stress. Previous studies also contradict in terms of the effect of biochar on photosynthetic pigments, like Akhtar et al.98 who described decreased chlorophyll contents of tomato plants grown in biochar, while in one of our previous studies, there was no reducing effect of biochar on chlorophyll contents46. In addition to enhancing nutrient solubilisation (P and K), the association of PGPR with biochar clearly enhanced and maintained the level of chlorophyll even in the presence of A. solani. Similarly, Danish and Zafar-ul-Hye99, reported significant increase in chlorophyll contents of wheat in response to the synergistic effect of PGPR and biochar. Biochar induced alterations in communication or signaling mechanisms between plant and microbes might also be responsible for the changes in PGPR response in the presence of different biochars used in variable concentrations in the soil substrate100,101. The mechanisms and processes involved in plant growth improvement with simultaneous protections form diseases are complex and signifies the need of further in depth analysis for complete understanding.

Alternaria solani can survive in the soil in the form of fungal mycelia and conidia on host debris102, whereas chlamydospores even in the absence of host debris103. So, to anticipate the direct impact of compost, biochar and B. subtilis on A. solani spores and mycelium overwintering in the field, PDA plate assay was employed26,48. As expected, compost has lost its antifungal property after autoclaving of the PDA, consequently minimum fungal inhibition was observed. Probably highlighting the role of the compost inhabiting microbes in suppressing the pathogenic microbes104,105. Although, incorporation of biochar has produced varying degree of A. solani mycelial growth inhibition but none of the biochars either WB or GWB were able to suppress inhibition in close proximity to 50%. Previous studies were also in agreement that disease suppression was not often lies in correspondence to the levels of in vitro toxicity of organic amendments26,67. Bacillus subtilis is known to have antagonistic effects against A. solani106. We also found greater inhibition of A. solani mycelial growth induced by B. subtilis, which could be due to the production of extracellular compounds including biosurfactants like iturin and fengycin causing antibiosis to fungal pathogens. On et al.107 also published about the antifungal activity of B. subtilis culture crude extracts against A. solani. The direct antifungal effect of organic amendments and PGPR, yet provide with another possibility of limiting the level of overwintering inoculum of A. solani in soil and plant debris. However, future experimentation will decide the faith of this assumption.

Depending upon the type of feedstock and biochar concentration in the soil substrate, two different types of biochars i.e. WB and GWB had a variable impact on plant health and early blight development in tomatoes. Based on the comparative analysis, GWB was found to be the most effective in suppressing A. solani, alone as well as in combination with B. subtilis. The combined application of biochar, compost mixture with PGPR, stimulated the rhizobacterial activity resulting in plant growth activation and disease inhibition. In the next phase, we are planning on studying genes associated with induced resistance to confirm their role in suppressing early blight in tomatoes. However, the concentration level of biochar to be used as a soil amendment is a subject deserving more research. In addition, future research activities should be focused to decipher the mechanisms behind the biochar induced resistance in tomato plants against A. solani as well as in other patho-systems of economic importance. In order to address the possible risks associated with biochars application on plant health, there is dire need of attention by scientific community in understanding biochemistry of the processes triggered by biochar borne chemicals.

Materials and methods

Isolation and characterization of Alternaria solani

Infected tomato plants exhibiting characteristic symptoms of early blight growing under field condition at University of the Punjab Lahore, Pakistan were identified for the fungal isolation. Standard tissue segment technique was followed108 to obtain A. solani culture on potato dextrose agar (PDA) medium (MERCK).

Subsequently, fungal mycelia from previously incubated PDA plates were shifted to freshly prepared media plates. Pure culture of the A. solani was obtained by re-culturing of isolated fungi via single spore technique109 and maintained as stock culture on Agar slants at 5 °C for future usage. Identification of pathogen was done by cultural and morphobiometric properties (Supplementary Table S1) as per Ellis110, and Simmons111. Linear growth of fungus was deliberated by measuring diameter of colonies in the same axis using transparent plastic scale in millimeter after 7 days of inoculation112. Fungal culture characteristics such as topography of mycelium, color and margin of colony on PDA were recorded113. For calculation of number of spores, a spore suspension was prepared by transferring 5 mm diameter block from media into 5 mL distilled water in a test tube and stirred with stirrer. Subsequently, sporulation was recorded by calculating mean value of spore count of three microscopic fields in one drop of spore suspension under object lens of compound microscope112.

Molecular identification of Alternaria solani

CTAB (Cetyl Trimethyl Ammonium Bromide) method was used to extract genomic DNA of A. solani114. The ITS (Internal Transcribed Spacer) region of A. solani was amplified by using universal ITS primers [ITS1 forward (TCCGTAGGTGAACCTGCGG) and ITS4 reserve (TCCTCCGCTTATTGATATGC)] as described previously115–117. In order to further confirm the identity of A. solani, β-tubulin 1116 was amplified by using FP_tub (TCCCACTCCTTCCGCGCTGT) and RP_tub (TGTACCAATGCAAGAAAGCCTTG) as forward and reverse primers, respectively. The primers were designed using Primer 3.0 (http://bioinfo.ut.ee/primer3/), while the self-annealing of primers was checked using OligoCalc (http://biotools.nubic.northwestern.edu/OligoCalc.html). PCR reaction was performed as described116. PCR products were sequenced at Macrogen Inc. (Seoul, South Korea).

Bacillus subtilis culture

The Bacillus subtilis (Genbank accession No. LC425129.1) isolate of PGPR was provided by the Microbiology lab of Institute of Agricultural Sciences (IAGS), University of the Punjab Lahore, Pakistan. The inoculum was prepared by re-culturing in nutrient broth (MERCK, USA) and incubating on shaker at 120 rpm for 36 h at 28 ± 2 °C. Afterwards, bacterial culture was centrifuged at 5,000 rpm for 10 min at 4 °C. Newly formed pallet was suspended in sterile distilled water and concentration of the bacterial suspension was adjusted at 108 colony-forming unit (CFU)/mL (OD600 = 1.0) according to the Qiao et al.118.

Soil substrate preparation and experiment setup

Depending upon the originating feedstock, two types of biochar, green waste biochar (GWB), produced from garden waste material and wood biochar (WB), produced from beech wood chips at pyrolysis temperature of 500 °C were used in the experiment. Both of these biochar differ substantially in structure and chemistry from each other (e.g. nitrogen contents, pH, cation exchange capacity and others) as described by Akhter et al.46 and Frišták et al.119. The compost was obtained from National Fertilizer Marketing of Govt. of Punjab, Lahore Pakistan with product name of ZameenDost (ZD) under license no. 1140. The most pertinent characteristics of biochars along with the compost are described in Table 5.

Table 5.

Physiochemical parameters of soil, compost, wood biochar, green waste biochar.

pH CEC (mmol 100/mL) Density (kg/L) EC (mS/cm) OM (%) SA (m2/g) AC (%) C (%) H (%) P (%) N (%) K (%) Cd (mg/kg) Cu (mg/kg) Zn (mg/kg)
Soil 8.01 – 0.75 1.02 0.604 – – 1.07 – 2.10 0.07 1.87 – 82.80 42.10
Comp 7.18 – 0.63 1.32 17.20 – – 28.54 – 0.40 1.20 0.55 0.03 73 462
WB 8.78 9.83 0.36 0.54 – 27.24 15.20 80.30 1.60 – 0.40 –  < 2 16 93
GWB 9.03 12.85 0.34 1.67 – 31.54 19.30 79.78 1.59 – 0.35 –  < 2 21 95

CEC cation-exchange capacity, EC electrical conductivity, OM organic matter, SA surface area, AC ash contents, Comp compost, WB wood biochar, GWB green waste biochar.

– Parameters were not analyzed.

Sterilized sandy loam soil containing 5.5% clay (< 2 mm), 42.7% silt (> 2 mm), 51.8% sand (> 63 mm), having bulk density 1.20 g/cm3 (PCRWR), was collected from experimental fields of IAGS (0 to 15 cm depth). It was used as basic material to make different compositions of potting mixture with compost (Comp) (20% v/v) and/or WB (3 and 6% v/v), GWB (3 and 6% v/v) for the plant cultivation.

The experiment set up was comprised of following treatments: (i) soil, (ii) Comp, (iii) Comp + 3%WB, (iv) Comp + 6%WB, (v) Comp + 3%GWB, (vi) Comp + 6%GWB, with (+ PGPR) and/or without PGPR (− PGPR). The treatments were either inoculated with A. solani (+ A. solani) or free from fungal inoculm (− A. solani). The experiments were conducted twice, while each treatment consisted of five replicates with each replicate comprised of a pot (Volume: 2 L, 15.5 cm height × 14 cm width) containing a plant.

Tomato plant propagation

Tomato seeds (Solanum lycopersicum L. cv. Rio grande) were surface sterilized with 3% NaOCl solution by soaking for 10 min and then rinsed thrice with double distilled water to wash off the chemical. Seeds were sown in trays containing double autoclaved potting mixture comprising of peat, perlite (Gro-Sure Westland Horticulture Cambridgeshire UK) and compost (ZD) (1:1:1, v/v/v). The trays were then incubated in a growth chamber at 24 °C with a 15/9 h light/dark photoperiod (light intensity 296 µmol m−2 s−1). The trays were irrigated regularly with tap water. After four weeks, tomato seedling were reached at 1–3 true leaf stage and transferred from trays to pots containing potting mixture as described in previous section. For PGPR inoculated treatments, the roots of tomato seedlings were dipped in PGPR suspension of 108 CFU/mL concentrations for 1 min before transplantation and 10 mL suspension was applied in the soil around the rhizosphere ten days after transplantation120.

For inoculation, the A. solani was cultured on Petri dishes containing PDA (MERCK, USA) and stored for 3 weeks at 25 °C in the dark in DNP-9022 incubator. To make suspension for inoculation, conidia were harvested by flooding the Alternaria culture plates with autoclaved water and gently scraping the colony surface with spatula. Next, the suspension was filtered using four layers of cheesecloth (50 µm). Final concentration of conidial suspension was determined and adjusted at 1 × 106condia/mL with hemocytometer121.

After 14 days of transplantation, conidial suspension of A. solani (106 conidia/mL) was inoculated on plants80. Conidial suspensions were sprayed gently on tomato leaves in the evening by following direct spray inoculation method using manual sprayer (Nozzle size = 0.8 mm)122. The inoculated tomato plants were sprayed with sterilized water for 2 days to maintain the required humidity (approx. 70%) for disease development. The plants were maintained in a greenhouse in randomized manner as per all the recommended practices for cultivation of tomato to raise a good crop123.

Plant growth assessment

The plants were harvested 40 days after transplantation by gently uprooting followed by washing the roots under running tap water to record growth parameters such as plant height, root and shoot dry weight as per Awan et al.11. Plant height was measured from base of stem to top of plant. Further, to calculate the dry weights, both roots and shoots were cut separated and dried in an air circulation oven at 60 °C for 7–10 days unless no change in weight was recorded.

Plant physiological parameters assessment

Chlorophyll contents determination

Two days prior to harvesting, a portable chlorophyll meter SPAD-502 (SPAD-502-Soil–Plant Analyses Development chlorophyll meter, Konica Minolta) was used to measure the chlorophyll contents of leaves (3rd pair from the top)124,125. To minimize the chances of errors, each obtained value represents an average of three readings.

Nitrogen, phosphorus and potassium contents determination

For NPK quantification, tomato leaves from each treatment were obtained and dried in oven for 4 consecutive days at 65 °C and ground into fine powder using pestle and mortar. Total nitrogen in leaf samples was assessed through Kjeldahl digestion method as described by Islam126, using automatic Kjeldahl apparatus (BD40, LACHAT, US). To obtain the mean value of percent nitrogen content, five samples from each treatment were digested. For the purpose, 0.1 g of powdered sample was digested with 4 mL of H2SO4 at 420 °C for 1 h. To attain optimum results, K2SO4 and CuSO4 were added as catalysts at a ratio of 9:197,127.

For the estimation of total P and K, two 0.5 g samples were prepared by wet digestion method as explained by Uddin et al.128 and Hseu129. Further, the concentration of P and K in digested samples were determined by following spectrophotometric vanadium phosphormolybdate method97,130 by using AA spectrophotometer (AA-6200, Shimadzu US) at 420 nm and flame photometric method130,131 by using Industrial Flame Photometer (PFP7, Jenway, UK), respectively. The concentrations in samples were determined by comparing with standard curve132.

Disease assessment

Early blight disease severity was recorded visually 20 days after inoculation on the basis of area of leaves covered by early blight symptoms using zero to five disease rating scale (Table 6) followed by Akhtar et al.117. Further, percent disease index (PDI) was calculated by following formula described by Pandey et al.133 and Yadav et al.134:

PercentDiseaseIndex (PDI)=Sumofallrating×100Totalno.ofobservations×Maximumratinggrade.

Table 6.

Disease rating scale for early blight disease on leaves of tomato plant.

Rating Description of symptoms PDI DR
0 No visible symptoms/free from infection 0 I
1 1–2 spots confined to lower leaves covering 1–10% of leaf surface 0.01–10 HR
2 Few isolated spots covering 11–25% of leaf surface 10.01–25 R
3 Many spots covering 26–40% of leaf surface 25.01–40 MR
4 Many spots covering 41–60% of leaf surface 40.01–60 S
5 Many spots covering more than 60% of leaf surface  > 60.01 HS

PDI percent disease index, DR disease response, I immune, HR highly resistant, R resistant, MR moderately resistant, S susceptible, HS highly susceptible.

Disease incidence of early blight was calculated 20 days after inoculation as percentage of diseased plants in treatment following formula by Awan et al.11,80:

Diseaseincidence (\% )=NumberofdiseasedplantsTotalnumberofplants×100.

In vitro toxicity of compost, biochar and Bacillus subtilis in PDA plate to Alternaria solani

The inhibitory impact of compost, WB and GWB on growth and inhibition of A. solani was studied in vitro on PDA plates. Both types of biochar i.e. WB and GWB, and compost were sieved through 100 μm sieve before adding to PDA67. The growth media was amended with compost (20%, w:v) and different concentrations of WB and GWB (3 and 6% (w:v), each) before autoclaving. Afterwards, growth media was poured into Petri-dishes (90 mm) and kept at room temperature till solidification. Subsequently, six mm diameter agar plugs of actively growing parts of fungal culture (5 days old) were obtained with sterile cork borer and placed at the center of dishes. While antifungal potential of PGPR was determined according to dual culture method by inoculating the PDA plates with B. subtilis close to the edges of petri-dishes48. The inoculated Petri-dishes were incubated at 23 ± 2 °C for 6 days. The fungal radial growth (mm) for each treatment was calculated by averaging colony diameter of five randomly arranged replicates. The percentage inhibition of fungal radial growth in different media including control (C, un-amended) and amended (A) was determined according to Bekker et al.135 using following formula:

Percentage inhibition=C-AC×100.

Statistical analysis

The data analysis was carried out using Statistix 8.1 software (Statistix, USA). Percentage data were transformed before analysis. While the pooled data of the experimental repeats were used for the analysis. The data were subject to three-way analysis of variance (ANOVA) with (i) soil substrate compositions including compost alone and in combination with wood and green waste biochar; (ii) PGPR and (iii) A. solani as main factors. The means were compared by applying Tukey’s HSD test at P ≤ 0.05 level of probability.

Supplementary information

Acknowledgements

Authors are thankful to the Institute of Agricultural Sciences (IAGS), University of the Punjab Lahore, Pakistan for providing consumables as well as laboratory and greenhouse facility for experimentation.

Author contributions

M.S.H., A.A. and M.R. conceptualized and designed the experiments. G.S. provided biochar and technical assistance for greenhouse trials and laboratory assays. M.R. and A.A. performed the experiments and data analysis. M.R., M.S.H. and A.A. interpreted the results and finalized the write-up. All authors verified the submitted version of the manuscript.

Data availability

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-021-85633-4.

References

  • 1.Khan AL, et al. Bacterial endophyte Sphingomonas sp. LK11 produces gibberellins and IAA and promotes tomato plant growth. J. Microbiol. 2014;52:689–695. doi: 10.1007/s12275-014-4002-7. [DOI] [PubMed] [Google Scholar]
  • 2.FAOSTAT, F. Statistics division of food and agriculture organization of the United Nations (2018). http://www.fao.org/faostat/en/#data/QC. Accessed 25 Jan 2020.
  • 3.Niu K, et al. A tomato-rich diet is related to depressive symptoms among an elderly population aged 70 years and over: A population-based, cross-sectional analysis. J. Affect. Disord. 2013;144:165–170. doi: 10.1016/j.jad.2012.04.040. [DOI] [PubMed] [Google Scholar]
  • 4.Babu AN, Jogaiah S, Ito S-I, Nagaraj AK, Tran L-SP. Improvement of growth, fruit weight and early blight disease protection of tomato plants by rhizosphere bacteria is correlated with their beneficial traits and induced biosynthesis of antioxidant peroxidase and polyphenol oxidase. Plant Sci. 2015;231:62–73. doi: 10.1016/j.plantsci.2014.11.006. [DOI] [PubMed] [Google Scholar]
  • 5.Adhikari P, Oh Y, Panthee DR. Current status of early blight resistance in tomato: An update. Int. J. Mol. Sci. 2017;18:1–22. doi: 10.3390/ijms18102019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Rowlandson T, et al. Reconsidering leaf wetness duration determination for plant disease management. Plant Dis. 2015;99:310–319. doi: 10.1094/pdis-05-14-0529-fe. [DOI] [PubMed] [Google Scholar]
  • 7.Sharma R, Patel D, Chaudhari D, Kumar V, Patel M. Effect of some fungicides against early blight of tomato (Lycopersicon esculentum Mill.) caused by Alternaria solani (Ell. & Mart.) Jones and Grout and their impact on yield. Int. J. Curr. Microbiol. App. Sci. 2018;7:1395–1401. doi: 10.20546/ijcmas.2018.707.166. [DOI] [Google Scholar]
  • 8.Sreenivasulu R, Reddy MSP, Tomar D, Sanjay MSS, Reddy BB. Managing of early blight of tomato caused by Alternaria solani through fungicides and bioagents. Int. J. Curr. Microbiol. App. Sci. 2019;8:1442–1452. doi: 10.20546/ijcmas.2019.806.175. [DOI] [Google Scholar]
  • 9.Grigolli JFJ, et al. Characterization of tomato accessions for resistance to early blight. Crop Breed. Appl. Biotechnol. 2011;11:174–180. doi: 10.1590/s1984-70332011000200010. [DOI] [Google Scholar]
  • 10.Kumar S, Srivastava K. Screening of tomato genotypes against early blight (Alternaria solani) under field condition. Bioscan. 2013;8:189–193. [Google Scholar]
  • 11.Awan ZA, Shoaib A, Khan KA. Variations in total phenolics and antioxidant enzymes cause phenotypic variability and differential resistant response in tomato genotypes against early blight disease. Sci. Hortic. 2018;239:216–223. doi: 10.1016/j.scienta.2018.05.044. [DOI] [Google Scholar]
  • 12.Roy CK, et al. Control of early blight of tomato caused by and screening of tomato varieties against the pathogen. Open Microbiol. J. 2019;13:41–50. doi: 10.2174/1874285801913010041. [DOI] [Google Scholar]
  • 13.Pane C, Zaccardelli M. Evaluation of Bacillus strains isolated from solanaceous phylloplane for biocontrol of Alternaria early blight of tomato. Biol. Control. 2015;84:11–18. doi: 10.1016/j.biocontrol.2015.01.005. [DOI] [Google Scholar]
  • 14.Tomazoni EZ, Pauletti GF, da Silva Ribeiro RT, Moura S, Schwambach J. In vitro and in vivo activity of essential oils extracted from Eucalyptus staigeriana, Eucalyptus globulus and Cinnamomum camphora against Alternaria solani Sorauer causing early blight in tomato. Sci. Hortic. 2017;223:72–77. doi: 10.1016/j.scienta.2017.04.033. [DOI] [Google Scholar]
  • 15.Bansal P, Kaur P, Kumar A, Duhan JS. Microwave assisted quick synthesis method of silver nanoparticles using citrus hybrid “Kinnow” and its potential against early blight of tomato. Res. Crop. 2017;18:650–655. doi: 10.5958/2348-7542.2017.00111.5. [DOI] [Google Scholar]
  • 16.Baka ZA, Rashad YM. Alternative control of early blight of tomato using plant extracts from Acacia nilotica, Achillea fragrantissima and Calotropis procera. Phytopathol. Mediterr. 2016;55:121–129. doi: 10.14601/Phytopathol_Mediterr-17161. [DOI] [Google Scholar]
  • 17.Singh H, et al. Antifungal potential of plant extracts against Alternaria solani, causing early blight of tomato. Res. Rev. J. Crop Sci. Technol. 2018;7:22–26. doi: 10.37591/rrjocst.v7i1.898. [DOI] [Google Scholar]
  • 18.Ghazanfar MU, et al. Evaluation of different fungicides against Alternaria solani (Ellis & Martin) Sorauer cause of early blight of tomato under laboratory conditions. Int. J. Zool. Stud. 2016;1:8–12. [Google Scholar]
  • 19.Chavan VA, Yumlembam RA, Sewakram K, Borkar S. Fungicide resistance in Alternaria leaf blight pathogen in tomato crop grown in Satara District. J. Pharmacogn. Phytochem. 2017;6:1736–1739. [Google Scholar]
  • 20.Elad Y, Cytryn E, Harel YM, Lew B, Graber ER. The biochar effect: Plant resistance to biotic stresses. Phytopathol. Mediterr. 2011;50:335–349. doi: 10.14601/Phytopathol_Mediterr-9807. [DOI] [Google Scholar]
  • 21.García AC, et al. Structure-property-function relationship in humic substances to explain the biological activity in plants. Sci. Rep. 2016;6:1–10. doi: 10.1038/srep20798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhang R, et al. Biochar enhances nut quality of Torreya grandis and soil fertility under simulated nitrogen deposition. Forest Ecol. Manage. 2017;391:321–329. doi: 10.1016/j.foreco.2017.02.036. [DOI] [Google Scholar]
  • 23.Lehmann J, Joseph S. Biochar for Environmental Management. London: SciTech Earthscan; 2009. pp. 1–12. [Google Scholar]
  • 24.Wang Y, Villamil MB, Davidson PC, Akdeniz N. A quantitative understanding of the role of co-composted biochar in plant growth using meta-analysis. Sci. Total Environ. 2019;685:741–752. doi: 10.1016/j.scitotenv.2019.06.244. [DOI] [PubMed] [Google Scholar]
  • 25.Akmal M, et al. Integrated use of biochar and compost to improve soil microbial activity, nutrient availability, and plant growth in arid soil. Arab. J. Geosci. 2019;12:232. doi: 10.1007/s12517-019-4414-0. [DOI] [Google Scholar]
  • 26.Akhter A, Hage-Ahmed K, Soja G, Steinkellner S. Potential of Fusarium wilt-inducing chlamydospores, in vitro behaviour in root exudates and physiology of tomato in biochar and compost amended soil. Plant Soil. 2016;406:425–440. doi: 10.1007/s11104-016-2948-4. [DOI] [Google Scholar]
  • 27.Jaiswal AK, Elad Y, Graber ER, Frenkel O. Rhizoctonia solani suppression and plant growth promotion in cucumber as affected by biochar pyrolysis temperature, feedstock and concentration. Soil Biol. Biochem. 2014;69:110–118. doi: 10.1016/j.soilbio.2013.10.051. [DOI] [Google Scholar]
  • 28.Harel YM, et al. Biochar mediates systemic response of strawberry to foliar fungal pathogens. Plant Soil. 2012;357:245–257. doi: 10.1007/s11104-012-1129-3. [DOI] [Google Scholar]
  • 29.Mehari ZH, Elad Y, Rav-David D, Graber ER, Harel YM. Induced systemic resistance in tomato (Solanum lycopersicum) against Botrytis cinerea by biochar amendment involves jasmonic acid signaling. Plant Soil. 2015;395:31–44. doi: 10.1007/s11104-015-2445-1. [DOI] [Google Scholar]
  • 30.Elad Y, et al. Induction of systemic resistance in plants by biochar, a soil-applied carbon sequestering agent. Phytopathology. 2010;100:913–921. doi: 10.1094/phyto-100-9-0913. [DOI] [PubMed] [Google Scholar]
  • 31.Goswami L, et al. Application of drum compost and vermicompost to improve soil health, growth, and yield parameters for tomato and cabbage plants. J. Environ. Manage. 2017;200:243–252. doi: 10.1016/j.jenvman.2017.05.073. [DOI] [PubMed] [Google Scholar]
  • 32.Iqbal MK, Shafiq T, Hussain A, Ahmed K. Effect of enrichment on chemical properties of MSW compost. Bioresour. Technol. 2010;101:5969–5977. doi: 10.1016/j.biortech.2010.02.105. [DOI] [PubMed] [Google Scholar]
  • 33.De Corato U, Patruno L, Avella N, Lacolla G, Cucci G. Composts from green sources show an increased suppressiveness to soilborne plant pathogenic fungi: Relationships between physicochemical properties, disease suppression, and the microbiome. Crop Prot. 2019;124:104870. doi: 10.1016/j.cropro.2019.104870. [DOI] [Google Scholar]
  • 34.Tabrika I, Azim K, Zaafrani M. Composting of tomato plant residues: Improvement of composting process and compost quality by integration of sheep manure. Org. Agric. 2019;10:229–242. doi: 10.1007/s13165-019-00268-0. [DOI] [Google Scholar]
  • 35.Durukan H, Demirbaş A, Tutar U. The effects of solid and liquid vermicompost application on yield and nutrient uptake of tomato plant. Turk. J. Agric. Food Sci. Technol. 2019;7:1069–1074. doi: 10.24925/turjaf.v7i7.1069-1074.2579. [DOI] [Google Scholar]
  • 36.Istifadah N, Firman A, Desiana M. Effectiveness of compost and microbial-enriched compost to suppress powdery mildew and early blight diseases in tomato. J. Anim. Plant Sci. 2020;30:377–383. doi: 10.36899/japs.2020.2.0031. [DOI] [Google Scholar]
  • 37.Kabir S, Islam M, Khan M, Hossain I. Comparative efficacy of compost, poultry litter, IPM Lab biopesticide and BAU-biofungicde in controlling early blight of tomato. Int. Res. J. Appl. Life Sci. 2012;1:03. [Google Scholar]
  • 38.Baysal, F., McSpadden-Gardener, B., Cardina, J., Kleinhenz, M. & Miller, S. Effect of field management practices on disease development, soil chemistry and yield in organic tomatoes. In II International Symposium on Tomato Diseases, Vol. 808, 113–116 (2007).
  • 39.Ntougias S, Papadopoulou KK, Zervakis GI, Kavroulakis N, Ehaliotis C. Suppression of soil-borne pathogens of tomato by composts derived from agro-industrial wastes abundant in Mediterranean regions. Biol. Fertil. Soils. 2008;44:1081–1090. doi: 10.1007/s00374-008-0295-1. [DOI] [Google Scholar]
  • 40.Kavroulakis N, Ehaliotis C, Ntougias S, Zervakis GI, Papadopoulou KK. Local and systemic resistance against fungal pathogens of tomato plants elicited by a compost derived from agricultural residues. Physiol. Mol. Plant Pathol. 2005;66:163–174. doi: 10.1016/j.pmpp.2005.06.003. [DOI] [Google Scholar]
  • 41.Aldahmani J, Abbasi P, Sahin F, Hoitink H, Miller S. Reduction of bacterial leaf spot severity on radish, lettuce, and tomato plants grown in compost-amended potting mixes. Can. J. Plant Pathol. 2005;27:186–193. doi: 10.1080/07060660509507215. [DOI] [Google Scholar]
  • 42.Liu J, et al. Short-term effect of biochar and compost on soil fertility and water status of a Dystric Cambisol in NE Germany under field conditions. J. Plant Nutr. Soil Sci. 2012;175:698–707. doi: 10.1002/jpln.201100172. [DOI] [Google Scholar]
  • 43.Schulz H, Glaser B. Effects of biochar compared to organic and inorganic fertilizers on soil quality and plant growth in a greenhouse experiment. J. Plant Nutr. Soil Sci. 2012;175:410–422. doi: 10.1002/jpln.201100143. [DOI] [Google Scholar]
  • 44.Fischer D, Glaser B. Synergisms between compost and biochar for sustainable soil amelioration. Manage. Organ. Waste. 2012;1:1–34. doi: 10.5772/31200. [DOI] [Google Scholar]
  • 45.Trupiano D, et al. The effects of biochar and its combination with compost on lettuce (Lactuca sativa L.) growth, soil properties, and soil microbial activity and abundance. Int. J. Agron. 2017;2:1–12. doi: 10.1155/2017/3158207. [DOI] [Google Scholar]
  • 46.Akhter A, Hage-Ahmed K, Soja G, Steinkellner S. Compost and biochar alter mycorrhization, tomato root exudation, and development of Fusarium oxysporum f. sp. lycopersici. Front. Plant Sci. 2015;6:529. doi: 10.3389/fpls.2015.00529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ojha SK, Benjamin JC, Singh AK. Effect of compost in combination with PGPR on growth of tomato (Lycopersicon esculentum) plant. Int. J. Agric. Sci. Res. 2018;6:63–72. [Google Scholar]
  • 48.Chowdappa P, Kumar SM, Lakshmi MJ, Upreti K. Growth stimulation and induction of systemic resistance in tomato against early and late blight by Bacillus subtilis OTPB1 or Trichoderma harzianum OTPB3. Biol. Control. 2013;65:109–117. doi: 10.1016/j.biocontrol.2012.11.009. [DOI] [Google Scholar]
  • 49.Nadeem SM, Ahmad M, Zahir ZA, Javaid A, Ashraf M. The role of mycorrhizae and plant growth promoting rhizobacteria (PGPR) in improving crop productivity under stressful environments. Biotechnol. Adv. 2014;32:429–448. doi: 10.1016/j.biotechadv.2013.12.005. [DOI] [PubMed] [Google Scholar]
  • 50.Wang H, et al. A biocontrol strain of Bacillus subtilis WXCDD105 used to control tomato Botrytis cinerea and Cladosporium fulvum Cooke and promote the growth of seedlings. Int. J. Mol. Sci. 2018;19:1371. doi: 10.3390/ijms19051371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Gogoi P, et al. Management of Fungal Pathogens in Pulses: Current Status and Future Challenges. Springer; 2020. pp. 1–13. [Google Scholar]
  • 52.Attia MS, El-Sayyad GS, Abd Elkodous M, El-Batal AI. The effective antagonistic potential of plant growth-promoting rhizobacteria against Alternaria solani causing early blight disease in tomato plant. Sci. Hortic. 2020;266:109289. doi: 10.1016/j.scienta.2020.109289. [DOI] [Google Scholar]
  • 53.Panth M, Hassler SC, Baysal-Gurel F. Methods for management of soilborne diseases in crop production. Agriculture. 2020;10:16. doi: 10.3390/agriculture10010016. [DOI] [Google Scholar]
  • 54.Egamberdieva D, Wirth S, Behrendt U, Abd-Allah EF, Berg G. Biochar treatment resulted in a combined effect on soybean growth promotion and a shift in plant growth promoting rhizobacteria. Front. Microbiol. 2016;7:209. doi: 10.3389/fmicb.2016.00209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Saxena J, Rana G, Pandey M. Impact of addition of biochar along with Bacillus sp. on growth and yield of French beans. Sci. Hortic. 2013;162:351–356. doi: 10.1016/j.scienta.2013.08.002. [DOI] [Google Scholar]
  • 56.Kavita B, Janardan Y. Effects of PGPR blended biochar and different levels of phosphorus on yield and nutrient uptake by chickpea. Ann. Agric. Biol. Res. 2014;19:408–412. [Google Scholar]
  • 57.Ijaz M, et al. Combined application of biochar and PGPR consortia for sustainable production of wheat under semiarid conditions with a reduced dose of synthetic fertilizer. Braz. J. Microbiol. 2019;50:449–458. doi: 10.1007/s42770-019-00043-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Hafez EM, et al. Synergistic effect of biochar and plant growth promoting rhizobacteria on alleviation of water deficit in rice plants under salt-affected soil. Agronomy. 2019;9:847. doi: 10.3390/agronomy9120847. [DOI] [Google Scholar]
  • 59.Danish S, Zafar-ul-Hye M, Mohsin F, Hussain M. ACC-deaminase producing plant growth promoting rhizobacteria and biochar mitigate adverse effects of drought stress on maize growth. PLoS ONE. 2020;15:e0230615. doi: 10.1371/journal.pone.0230615. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 60.Savary S, et al. The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 2019;3:430–439. doi: 10.1038/s41559-018-0793-y. [DOI] [PubMed] [Google Scholar]
  • 61.Schmitz J, Hahn M, Brühl CA. Agrochemicals in field margins—An experimental field study to assess the impacts of pesticides and fertilizers on a natural plant community. Agric. Ecosyst. Environ. 2014;193:60–69. doi: 10.1016/j.agee.2014.04.025. [DOI] [Google Scholar]
  • 62.Upadhyay P, Ganaie SH, Singh N. Diversity assessment among Alternaria solani isolates causing early blight of tomato in India. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2019;89:987–997. doi: 10.1007/s40011-018-1017-6. [DOI] [Google Scholar]
  • 63.Pasche J, Wharam C, Gudmestad N. Shift in sensitivity of Alternaria solani in response to QoI fungicides. Plant Dis. 2004;88:181–187. doi: 10.1094/pdis.2004.88.2.181. [DOI] [PubMed] [Google Scholar]
  • 64.Abu-El Samen F, Goussous SJ, Al-Shudifat A, Makhadmeh I. Reduced sensitivity of tomato early blight pathogen (Alternaria solani) isolates to protectant fungicides, and implication on disease control. Arch. Phytopathol. Pflanzenschutz. 2016;49:120–136. doi: 10.1080/03235408.2016.1160641. [DOI] [Google Scholar]
  • 65.Egel D, Hoagland L, Davis J, Marchino C, Bloomquist M. Efficacy of organic disease control products on common foliar diseases of tomato in field and greenhouse trials. Crop Prot. 2019;122:90–97. doi: 10.1016/j.cropro.2019.04.022. [DOI] [Google Scholar]
  • 66.Lehmann J, et al. Biochar effects on soil biota—A review. Soil Biol. Biochem. 2011;43:1812–1836. doi: 10.1016/j.soilbio.2011.04.022. [DOI] [Google Scholar]
  • 67.Jaiswal AK, Frenkel O, Elad Y, Lew B, Graber ER. Non-monotonic influence of biochar dose on bean seedling growth and susceptibility to Rhizoctonia solani: The “Shifted R max-Effect”. Plant Soil. 2015;395:125–140. doi: 10.1007/s11104-014-2331-2. [DOI] [Google Scholar]
  • 68.Zwart DC, Kim S-H. Biochar amendment increases resistance to stem lesions caused by Phytophthora spp. in tree seedlings. HortScience. 2012;47:1736–1740. doi: 10.21273/hortsci.47.12.1736. [DOI] [Google Scholar]
  • 69.Atucha A, Litus G. Effect of biochar amendments on peach replant disease. HortScience. 2015;50:863–868. doi: 10.21273/hortsci.50.6.863. [DOI] [Google Scholar]
  • 70.Copley TR, Aliferis KA, Jabaji S. Maple bark biochar affects Rhizoctonia solani metabolism and increases damping-off severity. Phytopathology. 2015;105:1334–1346. doi: 10.1094/PHYTO-08-14-0231-R. [DOI] [PubMed] [Google Scholar]
  • 71.Noble R, Coventry E. Suppression of soil-borne plant diseases with composts: A review. Biocontrol Sci. Technol. 2005;15:3–20. doi: 10.1080/09583150400015904. [DOI] [Google Scholar]
  • 72.Sang MK, Kim J-G, Kim KD. Biocontrol activity and induction of systemic resistance in pepper by compost water extracts against Phytophthora capsici. Phytopathology. 2010;100:774–783. doi: 10.1094/phyto-100-8-0774. [DOI] [PubMed] [Google Scholar]
  • 73.Martin, C. C. G. S. Rotary drum compost and compost tea as substrates, amendments, and biocontrol agents for damping-off (Pythium ultimum) management in tomato (Solanum lycopersicum). University of the West Indies, St. Augustine, Trinidad and Tobago (2013).
  • 74.Bahramisharif A, Rose LE. Efficacy of biological agents and compost on growth and resistance of tomatoes to late blight. Planta. 2019;249:799–813. doi: 10.1007/s00425-018-3035-2. [DOI] [PubMed] [Google Scholar]
  • 75.Postma J, Clematis F, Nijhuis EH, Someus E. Efficacy of four phosphate-mobilizing bacteria applied with an animal bone charcoal formulation in controlling Pythium aphanidermatum and Fusarium oxysporum f. sp. radicis lycopersici in tomato. Biol. Control. 2013;67:284–291. doi: 10.1016/j.biocontrol.2013.07.002. [DOI] [Google Scholar]
  • 76.Kilian M, et al. FZB24® Bacillus subtilis–mode of action of a microbial agent enhancing plant vitality. Pflanzenschutz-Nachr. Bayer. 2000;1:1. [Google Scholar]
  • 77.Tao S, Wu Z, He X, Ye B-C, Li C. Characterization of biochar prepared from cotton stalks as efficient inoculum carriers for Bacillus subtilis SL-13. BioRes. 2018;13:1773–1786. doi: 10.15376/biores.13.1.1773-1786. [DOI] [Google Scholar]
  • 78.Schippers B. Biological Control of Plant Diseases. Springer; 1992. pp. 21–34. [Google Scholar]
  • 79.Van Loon L, Bakker P, Pieterse C. Systemic resistance induced by rhizosphere bacteria. Annu. Rev. Phytopathol. 1998;36:453–483. doi: 10.1146/annurev.phyto.36.1.453. [DOI] [PubMed] [Google Scholar]
  • 80.Awan ZA, Shoaib A. Combating early blight infection by employing Bacillus subtilis in combination with plant fertilizers. Curr. Plant Biol. 2019;20:100125. doi: 10.1016/j.cpb.2019.100125. [DOI] [Google Scholar]
  • 81.Conrath U, et al. Priming: Getting ready for battle. Mol. Plant. Microbe Interact. 2006;19:1062–1071. doi: 10.1094/mpmi-19-1062. [DOI] [PubMed] [Google Scholar]
  • 82.Frenkel O, et al. The effect of biochar on plant diseases: What should we learn while designing biochar substrates? J. Environ. Eng. landsc. Manage. 2017;25:105–113. doi: 10.3846/16486897.2017.1307202. [DOI] [Google Scholar]
  • 83.Ton J, Mauch-Mani B. Elucidating pathways controlling induced resistance. Chem. Crop Protect. Prog. Prosp. Sci. Regulat. 2002;01:99–109. doi: 10.1002/3527602038.ch9. [DOI] [Google Scholar]
  • 84.She D, et al. Benefits of soil biochar amendments to tomato growth under saline water irrigation. Sci. Rep. 2018;8:1–10. doi: 10.1038/s41598-018-33040-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Rajkovich S, et al. Corn growth and nitrogen nutrition after additions of biochars with varying properties to a temperate soil. Biol. Fertil. Soils. 2012;48:271–284. doi: 10.1007/s00374-011-0624-7. [DOI] [Google Scholar]
  • 86.Schulz H, Dunst G, Glaser B. Positive effects of composted biochar on plant growth and soil fertility. Agron. Sustain. Dev. 2013;33:817–827. doi: 10.1007/s13593-013-0150-0. [DOI] [Google Scholar]
  • 87.Safaei Khorram M, et al. Impact of biochar and compost amendment on soil quality, growth and yield of a replanted apple orchard in a 4-year field study. J. Sci. Food Agric. 2019;99:1862–1869. doi: 10.1002/jsfa.9380. [DOI] [PubMed] [Google Scholar]
  • 88.Mukherjee A, Zimmerman AR. Organic carbon and nutrient release from a range of laboratory-produced biochars and biochar–soil mixtures. Geoderma. 2013;193:122–130. doi: 10.1016/j.geoderma.2012.10.002. [DOI] [Google Scholar]
  • 89.Brewer CE, Schmidt-Rohr K, Satrio JA, Brown RC. Characterization of biochar from fast pyrolysis and gasification systems. Environ. Prog. Sustain. Energy. 2009;28:386–396. doi: 10.1002/ep.10378. [DOI] [Google Scholar]
  • 90.Hossain MK, Strezov V, Chan KY, Nelson PF. Agronomic properties of wastewater sludge biochar and bioavailability of metals in production of cherry tomato (Lycopersicon esculentum) Chemosphere. 2010;78:1167–1171. doi: 10.1016/j.chemosphere.2010.01.009. [DOI] [PubMed] [Google Scholar]
  • 91.Vaccari F, et al. Biochar stimulates plant growth but not fruit yield of processing tomato in a fertile soil. Agric. Ecosyst. Environ. 2015;207:163–170. doi: 10.1016/j.agee.2015.04.015. [DOI] [Google Scholar]
  • 92.Van Zwieten L, et al. Enhanced biological N 2 fixation and yield of faba bean (Vicia faba L.) in an acid soil following biochar addition: Dissection of causal mechanisms. Plant Soil. 2015;395:7–20. doi: 10.1007/s11104-015-2427-3. [DOI] [Google Scholar]
  • 93.Araujo FF, Henning AA, Hungria M. Phytohormones and antibiotics produced by Bacillus subtilis and their effects on seed pathogenic fungi and on soybean root development. World J. Microb. Biotechnol. 2005;21:1639–1645. doi: 10.1007/s11274-005-3621-x. [DOI] [Google Scholar]
  • 94.Karlidag H, Esitken A, Turan M, Sahin F. Effects of root inoculation of plant growth promoting rhizobacteria (PGPR) on yield, growth and nutrient element contents of leaves of apple. Sci. Hortic. 2007;114:16–20. doi: 10.1016/j.scienta.2007.04.013. [DOI] [Google Scholar]
  • 95.Glick BR. The enhancement of plant growth by free-living bacteria. Can. J. Microbiol. 1995;41:109–117. doi: 10.1139/m95-015. [DOI] [Google Scholar]
  • 96.Berg G, Egamberdieva D, Lugtenberg B, Hagemann M. Symbioses and Stress. Springer; 2010. pp. 445–460. [Google Scholar]
  • 97.Saber FM, Abdelhafez AA, Hassan EA, Ramadan EM. Characterization of fluorescent pseudomonads isolates and their efficiency on the growth promotion of tomato plant. Ann. Agric. Sci. 2015;60:131–140. doi: 10.1016/j.aoas.2015.04.007. [DOI] [Google Scholar]
  • 98.Akhtar SS, Li G, Andersen MN, Liu F. Biochar enhances yield and quality of tomato under reduced irrigation. Agric. Water Manage. 2014;138:37–44. doi: 10.1016/j.agwat.2014.02.016. [DOI] [Google Scholar]
  • 99.Danish S, Zafar-ul-Hye M. Co-application of ACC-deaminase producing PGPR and timber-waste biochar improves pigments formation, growth and yield of wheat under drought stress. Sci. Rep. 2019;9:1–13. doi: 10.1038/s41598-019-42374-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Masiello CA, et al. Biochar and microbial signaling: Production conditions determine effects on microbial communication. Environ. Sci. Technol. 2013;47:11496–11503. doi: 10.1021/es401458s. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Rondon MA, Lehmann J, Ramírez J, Hurtado M. Biological nitrogen fixation by common beans (Phaseolus vulgaris L.) increases with bio-char additions. Biol. Fertil. Soils. 2007;43:699–708. doi: 10.1007/s00374-006-0152-z. [DOI] [Google Scholar]
  • 102.Dorozhkin N, Ivaniuk V. Epiphytotics of dry leaf spot of potatoes and tomatoes. Mikol. i Fitopatol. 1979;13:314–321. [Google Scholar]
  • 103.Basu P. Existence of chlamydospores of Alternaria porri f. sp. solani. Phytopathology. 1971;61:1347–1350. doi: 10.1094/phyto-61-1347. [DOI] [Google Scholar]
  • 104.Kerkeni A, Daami-Remadi M, Tarchoun N, Khedher MB. In vitro assessment of the antifungal activity of several compost extracts obtained from composted animal manure mixtures. Int. Agric. Res. 2007;2:786–794. doi: 10.3923/ijar.2007.786.794. [DOI] [Google Scholar]
  • 105.Koné SB, Dionne A, Tweddell RJ, Antoun H, Avis TJ. Suppressive effect of non-aerated compost teas on foliar fungal pathogens of tomato. Biol. Control. 2010;52:167–173. doi: 10.1016/j.biocontrol.2009.10.018. [DOI] [Google Scholar]
  • 106.Liu C-H, Wu W-S. Chemical and biological control of tomato early blight. Plant Pathol. Bull. 1997;6:132–140. [Google Scholar]
  • 107.On A, et al. Antifungal effects of compost tea microorganisms on tomato pathogens. Biol. Control. 2015;80:63–69. doi: 10.1016/j.biocontrol.2014.09.017. [DOI] [Google Scholar]
  • 108.Rangaswami G. An agar block technique for isolating soil micro organisms with special reference to Pythiaceous fungi. Sci. Cult. 1958;24:85. [Google Scholar]
  • 109.Choi Y-W, Hyde KD, Ho W. Single spore isolation of fungi. Fungal Divers. 1999;03:29–38. [Google Scholar]
  • 110.Ellis MB. Dematiaceous hyphomycetes. Mycologia. 1972;10:464–497. doi: 10.2307/3757955. [DOI] [Google Scholar]
  • 111.Simmons EG. Alternaria: An indentification manual. Am. Soc. Microbiol. 2007;06:51–687. doi: 10.1016/j.mycres.2008.06.012. [DOI] [Google Scholar]
  • 112.Koley S, Mahapatra S. Evaluation of culture media for growth characteristics of Alternaria solani, causing early blight of tomato. J. Plant Pathol. Microbiol. 2015;1:01–05. doi: 10.4172/2157-7471.1000s1-005. [DOI] [Google Scholar]
  • 113.Chohan S, Perveen R, Abid M, Naz MS, Akram N. Morpho-physiological studies management and screening of tomato germplasm against Alternaria solani the causal agent of tomato early blight. Int. J. Agric. Biol. 2015;17:111–118. [Google Scholar]
  • 114.Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987;19:11–15. [Google Scholar]
  • 115.Jasalavich CA, Morales VM, Pelcher LE, Séguin-Swartz G. Comparison of nuclear ribosomal DNA sequences from Alternaria species pathogenic to crucifers. Mycol. Res. 1995;99:604–614. doi: 10.1016/s0953-7562(09)80720-x. [DOI] [Google Scholar]
  • 116.Kumar S, Singh R, Kashyap PL, Srivastava AK. Rapid detection and quantification of Alternaria solani in tomato. Sci. Hortic. 2013;151:184–189. doi: 10.1016/j.scienta.2012.12.026. [DOI] [Google Scholar]
  • 117.Akhtar KP, et al. Evaluation of tomato genotypes for early blight disease resistance caused by Alternaria solani in Pakistan. J. Plant Pathol. 2019;101:1159–1170. doi: 10.1007/s42161-019-00304-8. [DOI] [Google Scholar]
  • 118.Qiao J, et al. Addition of plant-growth-promoting Bacillus subtilis PTS-394 on tomato rhizosphere has no durable impact on composition of root microbiome. BMC Microbiol. 2017;17:131. doi: 10.1186/s12866-017-1039-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 119.Frišták V, et al. Utilization of biochar sorbents for Cd 2+, Zn 2+, and Cu 2+ ions separation from aqueous solutions: Comparative study. Environ. Monit. Assess. 2015;187:4093. doi: 10.1007/s10661-014-4093-y. [DOI] [PubMed] [Google Scholar]
  • 120.Ramamoorthy V, Raguchander T, Samiyappan R. Induction of defense-related proteins in tomato roots treated with Pseudomonas fluorescens Pf1 and Fusarium oxysporum f. sp. lycopersici. Plant soil. 2002;239:55–68. doi: 10.1023/A:1014904815352. [DOI] [Google Scholar]
  • 121.Zheng H, Zhao J, Wang T, Wu X. Characterization of Alternaria species associated with potato foliar diseases in China. Plant Pathol. 2015;64:425–433. doi: 10.1111/ppa.12274. [DOI] [Google Scholar]
  • 122.Chaerani R, Groenwold R, Stam P, Voorrips RE. Assessment of early blight (Alternaria solani) resistance in tomato using a droplet inoculation method. J. Gen. Plant Pathol. 2007;73:96–103. doi: 10.1007/s10327-006-0337-1. [DOI] [Google Scholar]
  • 123.Naika S, de Jeude JVL, de Goffau M, Hilmi M. AD17E Cultivation of Tomato. Agromisa Foundation; 2005. [Google Scholar]
  • 124.Jiang Y, et al. Soil salinity increases the tolerance of excessive sulfur fumigation stress in tomato plants. Environ. Exp. Bot. 2017;133:70–77. doi: 10.1016/j.envexpbot.2016.10.002. [DOI] [Google Scholar]
  • 125.Muñoz-Huerta RF, et al. A review of methods for sensing the nitrogen status in plants: Advantages, disadvantages and recent advances. Sensors. 2013;13:10823–10843. doi: 10.3390/s130810823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 126.Islam M, Hasanuzzaman ATM, Zhang Z-F, Zhang Y, Liu T-X. High Level of nitrogen makes tomato plants releasing less volatiles and attracting more Bemisia tabaci (Hemiptera: Aleyrodidae) Front. Plant Sci. 2017;8:466. doi: 10.3389/fpls.2017.00466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 127.Rattin JE, Andriolo JL, Witter M. Nitrogen concentration in dry matter of the fifth leaf during growth of greenhouse tomato plants. Hortic. Bras. 2002;20:626–629. doi: 10.1590/s0102-05362002000400023. [DOI] [Google Scholar]
  • 128.Uddin AH, et al. Comparative study of three digestion methods for elemental analysis in traditional medicine products using atomic absorption spectrometry. J. Anal. Sci. Technol. 2016;7:1–7. doi: 10.1186/s40543-016-0085-6. [DOI] [Google Scholar]
  • 129.Hseu Z-Y. Evaluating heavy metal contents in nine composts using four digestion methods. Bioresour. Technol. 2004;95:53–59. doi: 10.1016/j.biortech.2004.02.008. [DOI] [PubMed] [Google Scholar]
  • 130.Motsara M, Roy RN. Guide to Laboratory Establishment for Plant Nutrient Analysis. Food and Agriculture Organization of the United Nations; 2008. [Google Scholar]
  • 131.Chapman HD, Pratt PF. Methods of analysis for soils, plants and waters. Soil Sci. 1962;93:68. doi: 10.1097/00010694-196201000-00015. [DOI] [Google Scholar]
  • 132.Niaz A, et al. Determination of imidacloprid residues in rice from various districts of Punjab using high performance liquid chromatography. J. Anim. Plant Sci. 2016;26:170–176. [Google Scholar]
  • 133.Pandey KK, Pandey PK, Kalloo G, Banerjee MK. Resistance to early blight of tomato with respect to various parameters of disease epidemics. J. Gen. Plant Pathol. 2003;69:364–371. doi: 10.1007/s10327-003-0074-7. [DOI] [Google Scholar]
  • 134.Yadav O, Dabbas M, Gaur L. Screening of tomato advanced lines, genotypes against Alternaria solani. Plant Arch. 2014;14:553–555. [Google Scholar]
  • 135.Bekker T, Kaiser C, Merwe RVD, Labuschagne N. In-vitro inhibition of mycelial growth of several phytopathogenic fungi by soluble potassium silicate. S. Afr. J. Plant Soil. 2006;23:169–172. doi: 10.1080/02571862.2006.10634750. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES