Skip to main content
Cureus logoLink to Cureus
. 2021 Feb 16;13(2):e13367. doi: 10.7759/cureus.13367

A Cross-Sectional Study of Detection of Beta Globin (HBB) Haplotypes Among Beta Thalassemia Patients

Ali Alsamiri 1, Fatma Alzahrani 2, Najlaa Filimban 1, Ammar Khojah 1, Raed Felimban 1, Talal Qadah 1,
Editors: Alexander Muacevic, John R Adler
PMCID: PMC7971723  PMID: 33754095

Abstract

Introduction

Beta-thalassemia is among the most common monogenic disorders in the Arabian Peninsula. This study aimed to investigate the β-globin (HBB) haplotypes among β-thalassemia patients in Saudi cohort which have potential implications in understanding the clinical care of patients and population genetic factors associated with β-thalassemia.

Methods

We analyzed 60 β-thalassemia patients. Male/female distribution for β-thalassemia was 58.33%/41.66%. Results of hematological parameters and indices were obtained from the database. HBB haplotyping assay was performed for four specific loci of the HBB gene cluster using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique.

Results

HBB haplotyping assay identified three novel patterns namely haplotype 1, haplotype 2, and haplotype 3 and three common African haplotypes including Benin, Senegal, and Cameron. The frequency of haplotype 1 was the highest among the studied samples (62%, n = 37) with 56.76% (n = 21) observed in males compared to 43.24% (n = 16) in females. This was followed by Senegal, haplotype 2, Benin and haplotype 3 with similar percentage, and Cameron haplotype with 18%, 12%, 3% and 2%, respectively. The relationship between these haplotypes and various hematological parameters was calculated and our study found no significant relationship (p-value >0.05).

Conclusion

Our study indicated the importance of finding out types of β-globin haplotypes as novel types being discovered. Though no statistically significant association was identified among all the haplotypes in terms of hematological parameters, Cameroon or Benin haplotypes had the mildest form because they have the highest means among all parameters. Further studies need to be carried out on a larger population to detect the frequency of each specific mutation in each haplotype among β-thalassemia patients. This would help to re-address the question of the origin(s) of the β-thalassemia.

Keywords: beta thalassemia, beta globin gene, hbb haplotype

Introduction

Thalassemia syndromes are a heterogeneous group of inherited anemias characterized by a defective biosynthesis of the alpha (α) or beta (β) globin subunits of the normal adult hemoglobin HbA (a2β2). This defect can cause the formation of abnormal hemoglobin molecules resulting in low hemoglobin level. This group of inherited disorders is relatively common worldwide and considered as the most common single-gene disorders [1]. It is commonly found in the Mediterranean area, Middle East, Equatorial Africa, and Southern Asia and the clinical severity varies greatly from asymptomatic to severe hemolytic anemia.

β-thalassemia is considered as one of the most common monogenic disorders in Saudi Arabia. This is in fact due to the high percentage of consanguineous marriages [2]. It constitutes one of the major public health issues encountered by the ministry of health due to its high impact on clinical management costs [3]. The prevalence of β-thalassemia in Saudi Arabia is estimated to be 1.36% where 0.07% represents the major type and 1.29% represents the trait (minor) type [4,5]. Various studies on the prevalence of β-thalassemia conducted over 20 years demonstrated that the Eastern province has the highest number of cases [6]. Molecular pattern of β-thalassemia showed a wide spectrum of mutations affecting the HBB and novel mutations are being discovered as the diagnostic tools are becoming more advanced [7]. It is noteworthy to mention that even though β-thalassemia is highly prevalent in the Eastern Province, a wide spectrum of clinical symptoms for this disorder is reported from the Western Province [8]. This variation could be contributed to the differences in the β-globin gene (HBB) haplotypes.

A haplotype can be defined as a set of genes of one chromosome that have been inherited together from a single parent [9]. HBB haplotypes settle on different combinations of polymorphic sites of HBB through the non-random link of the single point called restriction fragment length polymorphism (RFLP) [10]. Several mutations are found within and around HBB, resulting in different types of HBB haplotypes and thus causing population diversity [11]. The diversity in HBB haplotypes reflects the evolutionary and genetic relationship among this disorder in different ethnic backgrounds [12]. The importance of identification of HBB haplotype comes through the determination of DNA sequence variation across geographical populations. Those variations often caused by the transmission of genetic variations through populations from one generation to the next [13].

In Saudi Arabia, few studies have been performed to explore the molecular patterns of β-thalassemia [14-16]. In this study, we aimed to determine the HBB haplotypes among β-thalassemia patients in the Saudi cohort and correlate between these haplotypes and red cell parameters.

Materials and methods

Sample collection and laboratory investigation

A total number of 60 blood samples from previously diagnosed β-thalassemia patients were obtained after consents were signed. The gender distribution included 25 (41.66%) females and 35 (58.33%) males. Hematological investigations were recorded through complete blood count (CBC) and Hb separation. The study was approved by the Ethics and Research Committee at Faculty of Applied Medical Sciences, King Abdulaziz University (Ref. No. FAMS-2019-003).

DNA extraction and preservation

DNA extraction was carried out using the Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer's instruction. The DNA concentration of the samples was assessed using Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and stored at -20°C for subsequent analyses.

β-globin (HBB) haplotyping assay

HBB haplotyping assay was performed for four specific loci of the HBB gene cluster using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) as previously described by Sutton et al. [17]. Briefly, the four loci were amplified by specific primer sets to generate PCR fragments of 655 bp, 771 bp, 766 bp and 388 bp for primer set numbers 1, 2, 3 and 4 respectively as shown in Table 1. These fragments contained sites for the restriction sites of XmnI (5' Gγ), HindIII (Gγ), HindIII (Aγ) and HinfI (5’/β) which were digested by the restriction enzymes. Identification of HBB haplotypes was determined through positive and/or negative reactions to digestion with restriction enzymes at these loci in order to generate specific patterns of a haplotype as demonstrated in previous works [18, 19].

Table 1. Sequence of primer, position and polymorphic site.

Primers Sequence Position Polymorphic site Gene
1 F- AACTGTTGCTTTATAGGATTTT 33880 XmnI 34330 5' Gγ
R- AGGAGCTTATTGATAACTCAGAC 34535
2 F- TGCTGCTAATGCTTCATTACAA 35440 HindIII 35785
R- AAGTGTGGAGTGTGCACATGA 36211
3 F- TGCTGCTAATGCTTCATTACAA 40371 HindIII 40731
R- TAAATGAGGAGCATGCACACAC 41137
4 F- CTACGCTGACCTCATAAATG 60958 HinfI 61199 5/β
R- CTAATCTGCAAGAGTGTCT 61341

Statistical analysis

All statistical analysis in this study was carried out using either one-way ANOVA or Kruskal-Wallis test using SPSS, version 22 (IBM Corp., Armonk, NY, USA). A p-value < 0.05 was considered statistically significant. Regression analysis was used to study the association of HBB haplotypes with changes in the hematological parameters including red blood cell count (RBC), hemoglobin (Hb), hematocrit (Hct), mean cell volume (MCV), mean cell hemoglobin (MCH), mean cell hemoglobin concentration (MCHC), and red cell distribution width (RDW). Post hoc analysis was performed to find statistical significance among or in between the groups.

Results

Recognition patterns of HBB haplotype generated from digestion of amplified regions with the restriction enzymes showed some common African haplotypes including Benin, Senegal, and Cameron while three other novel patterns namely haplotype 1, haplotype 2, and haplotype 3 were identified (Table 2). We found that the frequency of haplotype 1 was the highest with 62% (N = 37) with a mild predominance of males (56.76%, n = 21) compared to females (43.24%, n = 16). This was followed by Senegal haplotype (18%, N = 11), H2 (12%, N = 7), Benin (3%, N = 2), H3 (3%, N = 2) and Cameroon (2%, N = 1) as shown in Figure 1.

Table 2. Pattern of HBB haplotypes according to restriction enzyme.

HBB: β-globin

Haplotype XmnI 5' Gγ HindIII Gγ HindIII Aγ HinfI 5' β
Benin - - - -
Senegal + + - +
Cameroon - + + +
Haplotype 1 - - - +
Haplotype 2 - + - +
Haplotype 3 + + + +

Figure 1. Frequency of HBB haplotypes. The pie chart shows the percentage of observed haplotypes.

Figure 1

HBB: β-globin

The association of red cell parameters among the various haplotypes of the cohort study was investigated and the results indicated that there is no statistically significant relationship between the haplotypes in terms of hematological parameters as all showed no significant scores (p-values above 0.05) (Table 3).

Table 3. Hematological parameters between haplotypes in thalassemic patients.

RBC: Red blood cell count; Hb: Hemoglobin; Hct: Hematocrit; MCV: Mean cell volume; MCH: Mean cell hemoglobin; MCHC: Mean cell hemoglobin concentration; RDW: Red cell distribution width.

Hematological parameters Cameroon (N = 1, 1.66%) Benin (N = 2, 3.33%) H1 (N = 37, 61.66%) H2 (N = 7, 11.66%) H3 (N = 2, 3.33%) Senegal (N = 11, 18.33%) P-value KW
RBC (x 106 /µL) 3.20 2.98 ± 0.21 2.99 ± 0.99 2.88 ± 1.30 2.26 ± 0.41 3.03 ± 0.63 0.644
Hb (g/dl) 10.4 9.60 ± 0.70 7.39 ± 2.51 5.85 ± 1.90 5.35 ± 1.48 7.17 ± 2.30 0.103
Hct (%) 30.2 26.55 ± 2.33 21.81 ± 7.53 19.07 ± 6.26 16.60 ± 4.10 21.93 ± 6.70 0.250
MCV (fL) 80.7 89.15 ± 1.48 72.34 ± 6.56 71.71 ± 16.74 73.20 ± 4.80 71.09 ± 10.32 0.183
MCH (pg) 27.60 32.10 ± 0.14 24.79 ± 4.71 24.24 ± 6.66 23.40 ± 2.26 23.19 ± 3.87 0.206
MCHC (g/dl) 34.30 36.00 ± 0.42 34.23 ± 5.22 33.52 ± 2.23 31.95 ± 1.06 32.56 ± 2.23 0.154
RDW 26.40 24.05 ± 3.75 25.32 ± 10.2 29.54 ± 5.95 34.10 ± 2.69 24.68 ± 8.42 0.706

Further, post hoc analysis was performed to see the statistical significance among and in between the haplotypes for each of the hematological parameters. As the Cameroon haplotype had just one sample, it was removed from the post hoc analysis. Though no statistically significant relationship between all the haplotypes in terms of hematological parameters were found.

Post hoc analysis showed significant difference between Benin and Haplotype 1 (p-value 0.012), Benin and Haplotype 2 (p-value 0.018), and Benin and Senegal (p-value 0.011) Haplotype for the MCV parameter. Similarly, significant difference was seen between BEN and Haplotype 1 (p-value 0.039), BEN and Haplotype 2 (p-value 0.044), and BEN and SEN (p-value 0.018) Haplotype for the MCH parameter (Table is attached in the appendices section).

To find out if the most frequent haplotypes from our cohort (i.e., H1, H2, and Senegal) have some effects on red cell parameters, we analyzed the relationship between them and found no significant association (Figure 2). The reason behind grouping H1, H2 and Senegal haplotypes was to find out if these haplotypes showed any differences in the red cell parameters, as together they formed the major number of samples (N = 55).

Figure 2. Comparison between the most frequent haplotypes (H1, H2, and Senegal) and the hematological parameters.

Figure 2

Further, a multinomial logistic regression analysis was used to analyze the association of HBB haplotypes with changes in the red cell parameters including RBC, Hb, Hct, MCV, MCH, and MCHC (Table 4). As can be seen from the significance (Sig.) column, there was no significant association between the changes in levels of the red cell parameters according to the haplotype. This indicates that red cell parameters are independent of HBB haplotype.

Table 4. Effect of each haplotype on RBC, HB, and HCT levels in thalassemia group using logistic regression model.

a The reference category is: SEN

B – coefficient for the constant (intercept),  S.E. – Standard error around B, Sig. – Significance,  df –Degrees of freedom for the Wald chi-square test, Exp(B) – Exponentiation of the B coefficient, which is an odds ratio.

Haplotypea Variable B Std. Error Sig. Exp(B) 95% Confidence Interval for Exp (B)
Lower Bound Upper Bound
BEN RBC 34.71803 486177.2 0.999943 1.2E+15 0 .b
CAM -53.5923 65190.05 0.999344 5.31E-24 0 .b
H1 6.623199 5.313543 0.21259 752.3479 0.022569552 25079246.18
H2 393.0014 184556.5 0.998301 4.7E+170 0 .b
H3 -184.941 238438.9 0.999381 4.8E-81 0 .b
BEN Hb 55.13301 175784 0.99975 8.79E+23 0 .b
CAM 3.35179 71006.04 0.999962 28.5538 0 .b
H1 3.287009 2.782163 0.237421 26.7627 0.114643263 6247.572354
H2 -115.81 69158.65 0.998664 5.06E-51 0 .b
H3 31.30258 254701.5 0.999902 3.93E+13 0 .b
BEN Hct -22.8203 85898.53 0.999788 1.23E-10 0 .b
CAM 6.54563 33057.49 0.999842 696.195 0 .b
H1 -2.01847 1.383707 0.144637 0.132859 0.008822198 2.000799385
H2 -20.9398 27749.34 0.999398 8.05E-10 0 .b
H3 14.9643 71759.27 0.999834 3154378 0 .b
BEN MCV -16.2453 12167.73 0.998935 8.81E-08 0 .b
CAM -2.81946 15091.12 0.999851 0.059638 0 .b
H1 0.628306 0.695302 0.366184 1.874432 0.479763741 7.323388891
H2 38.89905 36003.64 0.999138 7.83E+16 0 .b
H3 57.65269 44585.15 0.998968 1.09E+25 0 .b
BEN MCH 55.41141 63554.36 0.999304 1.16E+24 0 .b
CAM 3.435909 31252.32 0.999912 31.05962 0 .b
H1 -0.98305 1.863935 0.597912 0.374168 0.009693549 14.4428076
H2 -75.2429 95184.25 0.999369 2.1E-33 0 .b
H3 -169.735 126694.6 0.998931 1.93E-74 0 .b
BEN MCHC -46.6824 32312.69 0.998847 5.32E-21 0 .b
CAM -2.6258 15729.97 0.999867 0.072382 0 .b
H1 0.430873 1.120979 0.700703 1.5386 0.17098069 13.84536686
H2 66.47738 65618.41 0.999192 7.43E+28 0 .b
H3 106.45 103533.7 0.99918 1.7E+46 0 .b

Discussion

Our study was designed to determine the HBB haplotype among β-thalassemia patients and to analyze their effects on red cell parameters. Haplotype analysis has a statistical power because it reduces the association test dimensions. Rather than using genotyping individually, the haplotype analysis identifies common genetic features in a population [10]. Apart from this, several previous studies have shown that HBB haplotype analysis provides crucial information on genetic variations and haplotypes of different populations [20-22]. A study by Zhang et al., on genetic heterogeneity of HBB in various geographic populations of Yunnan in Southwestern China, identified seven different HBB haplotypes among 41 β-thalassemic chromosomes, where haplotype I and haplotype V were more than 65% (28 β-thalassemic chromosomes), while the remaining percentages were distributed to the other haplotypes [13]. Our study identified six haplotypes among 60 β-thalassemic patients from the Saudi cohort. The distribution of HBB haplotypes among β-thalassemic patients in our study showed that haplotype 1 was the highest with 62% (37 samples). This was in accordance with studies by various groups in the Mexican, Turkish and Western Iranian population which identified haplotype 1 to be the most prevalent haplotype among β-thalassemia chromosomes although restriction sites pattern is different [11, 21, 23]. Haplotype analysis of β-thalassemia patients was carried out in Western Iran by analyzing the pattern of seven restriction sites through the HBB gene cluster. It was found that haplotype I was the most prevalent haplotype with 35.7% among β-thalassemia chromosomes followed by haplotype III with 28.6% [11]. A previous haplotype analysis of three common β-thalassemia mutations performed in Syrian patients found out four HBB haplotypes among the studied patients where haplotype I was the most frequent one [23].

TheHBB haplotyping plays a role in the detection of severity level through observing the hematological parameters in hemoglobinopathies. The correlation between Arab-Indian haplotype and Benin haplotype indicated that the mean of RBC count was higher in Arab-Indian haplotype (3.9 million cells/mcL) than in Benin haplotype (3.0 million cells/mcL) indicating the milder form of this haplotype. Moreover, the mean Hb concentration was also higher in Arab-Indian haplotype (10.8 g/dl), than in Benin haplotype (8.4 g/dl). These differences in hematological parameters among the two haplotypes explained the diverse range in severity among HBB haplotypes [8]. In our study, the hematological parameters among the six haplotypes (Benin, Senegal, Cameroon, haplotype 1, haplotype 2, and haplotype 3) were investigated. The mean of RBC count was very close to about 3 million cells/mcL in all haplotypes except in haplotype 3 which was less than 2.5 million cells/mcL. The mean of Hb concentration in all haplotypes was above 7 g/dl, except haplotype 2 and haplotype 3. The mean was lowest in haplotype 3 with 5.35 g/dl. It was higher than 9 g/dl in Benin and Cameroon, which was consistent with Hb concentration for Benin haplotype in El-Hazmi findings [8]. The mean of Hct was almost similar for haplotype 2, haplotype 3 and Senegal at ~20%, whereas the lowest in haplotype 3 with 16.6% and greater than 25% in Benin and Cameron. Four haplotypes, haplotype 1, haplotype 2, haplotype 3, and Senegal showed similar MCV levels of nearly 72 fL, Benin and Cameroon had higher than 80 fL. Similarly, for MCH, haplotype 1, haplotype 2, haplotype 3, and Senegal showed similar levels at 24 pg, whereas Benin showed the highest with 32.1 pg and Cameroon at second highest at 27 pg. Five haplotypes showed a narrow range of MCHC level 32-34 g/dl, but Benin had the highest level at 36 g/dl. Although there was no significant alteration in red cell parameters among all haplotypes, we have observed that RBC parameters of haplotype 3 were the most affected ones since the anemia was more severe than others. Furthermore, HBB haplotypes are known to influence the severity of HBB diseases through hematological parameters [24]. A previous study about the effect of HBB cluster haplotype on hematological and clinical features of HBBmutation that cause sickle cell anemia was performed on 113 black American adults. The study found that Bantu haplotype usually is commonly associated with a severe form of the disease more than Benin and Cameroon haplotype where blood parameters in Benin and Cameroon haplotypes were characterized by mild clinical severity [25]. Though there is no Bantus haplotype in our study, we had a similar result for Benin and Cameroon haplotype where there was no significant difference between the patients. Additionally, all the haplotypes showed no significant difference among themselves in terms of the red cell parameters. However, when a pair wise comparison of significance was performed for each of the hematological parameters, we observed significant difference between Benin and Haplotype 1, Benin and Haplotype 2, and Benin and Senegal Haplotype for only MCV and MCH parameters, indicating that there is significant difference in severity of β-thalassemia for only the Benin, Haplotype 1, Haplotype 2 and Senegal haplotype as indicated from the hematological parameters MCV and MCH.

Conclusions

Our study indicated the importance of finding out types of β-globin haplotypes as novel types being discovered. Though no statistically significant association was identified between all the haplotypes in terms of hematological parameters, but for MCV and MCH we identified in severity of β-thalassemia for only the Benin, Haplotype 1, Haplotype 2 and Senegal in the studied cohort. Our result is a preliminary analysis representing the distribution of β(S) haplotypes in the Western province of Saudi Arabia and future studies need to be carried out on a larger population to detect the frequency of each specific mutation in each haplotype among β-thalassemia patients. This would help to re-address the question of the origin(s) of the β-thalassemia.

Appendices

Table 5. Post hoc analysis.

Post hoc analysis showed significant difference between Benin and haplotype I (p-value 0.012), Benin and haplotype 2 (p-value 0.018), and Benin and Senegal (p-value 0.011) haplotype for the MCV parameter. Similarly, significant difference was seen between BEN and haplotype 1 (p-value 0.039), BEN and haplotype 2 (p-value 0.044), and BEN and SEN (p-value 0.018) haplotype for the MCH parameter.

Multiple Comparisons
LSD
Dependent Variable (I) Haplotype (J) Haplotype Mean Difference (I-J) Std. Error Sig. 95% Confidence Interval
Lower Bound Upper Bound
RBC Benin Haplotype 1 -.01568 .69815 .982 -1.4154 1.3840
Haplotype 2 .09857 .77106 .899 -1.4473 1.6445
Haplotype 3 .72000 .96169 .457 -1.2081 2.6481
Senegal -.05273 .73925 .943 -1.5348 1.4294
Haplotype 1 Benin .01568 .69815 .982 -1.3840 1.4154
Haplotype 2 .11425 .39638 .774 -.6804 .9089
Haplotype 3 .73568 .69815 .297 -.6640 2.1354
Senegal -.03705 .33026 .911 -.6992 .6251
Haplotype 2 Benin -.09857 .77106 .899 -1.6445 1.4473
Haplotype 1 -.11425 .39638 .774 -.9089 .6804
Haplotype 3 .62143 .77106 .424 -.9245 2.1673
Senegal -.15130 .46497 .746 -1.0835 .7809
Haplotype 3 Benin -.72000 .96169 .457 -2.6481 1.2081
Haplotype 1 -.73568 .69815 .297 -2.1354 .6640
Haplotype 2 -.62143 .77106 .424 -2.1673 .9245
Senegal -.77273 .73925 .301 -2.2548 .7094
Senegal Benin .05273 .73925 .943 -1.4294 1.5348
Haplotype 1 .03705 .33026 .911 -.6251 .6992
Haplotype 2 .15130 .46497 .746 -.7809 1.0835
Haplotype 3 .77273 .73925 .301 -.7094 2.2548
Hb Benin Haplotype 1 2.20811 1.72417 .206 -1.2486 5.6649
Haplotype 2 3.74571 1.90424 .054 -.0721 7.5635
Haplotype 3 4.25000 2.37500 .079 -.5116 9.0116
Senegal 2.42727 1.82568 .189 -1.2330 6.0875
Haplotype 1 Benin -2.20811 1.72417 .206 -5.6649 1.2486
Haplotype 2 1.53761 .97890 .122 -.4250 3.5002
Haplotype 3 2.04189 1.72417 .241 -1.4149 5.4986
Senegal .21916 .81562 .789 -1.4161 1.8544
Haplotype 2 Benin -3.74571 1.90424 .054 -7.5635 .0721
Haplotype 1 -1.53761 .97890 .122 -3.5002 .4250
Haplotype 3 .50429 1.90424 .792 -3.3135 4.3221
Senegal -1.31844 1.14830 .256 -3.6206 .9838
Haplotype 3 Benin -4.25000 2.37500 .079 -9.0116 .5116
Haplotype 1 -2.04189 1.72417 .241 -5.4986 1.4149
Haplotype 2 -.50429 1.90424 .792 -4.3221 3.3135
Senegal -1.82273 1.82568 .323 -5.4830 1.8375
Senegal Benin -2.42727 1.82568 .189 -6.0875 1.2330
Haplotype 1 -.21916 .81562 .789 -1.8544 1.4161
Haplotype 2 1.31844 1.14830 .256 -.9838 3.6206
Haplotype 3 1.82273 1.82568 .323 -1.8375 5.4830
Hct Benin Haplotype 1 4.73919 5.17925 .364 -5.6446 15.1230
Haplotype 2 7.47857 5.72016 .197 -3.9897 18.9468
Haplotype 3 9.95000 7.13429 .169 -4.3534 24.2534
Senegal 4.62273 5.48417 .403 -6.3724 15.6178
Haplotype 1 Benin -4.73919 5.17925 .364 -15.1230 5.6446
Haplotype 2 2.73938 2.94054 .356 -3.1560 8.6348
Haplotype 3 5.21081 5.17925 .319 -5.1730 15.5946
Senegal -.11646 2.45005 .962 -5.0285 4.7956
Haplotype 2 Benin -7.47857 5.72016 .197 -18.9468 3.9897
Haplotype 1 -2.73938 2.94054 .356 -8.6348 3.1560
Haplotype 3 2.47143 5.72016 .667 -8.9968 13.9397
Senegal -2.85584 3.44938 .411 -9.7714 4.0598
Haplotype 3 Benin -9.95000 7.13429 .169 -24.2534 4.3534
Haplotype 1 -5.21081 5.17925 .319 -15.5946 5.1730
Haplotype 2 -2.47143 5.72016 .667 -13.9397 8.9968
Senegal -5.32727 5.48417 .336 -16.3224 5.6678
Senegal Benin -4.62273 5.48417 .403 -15.6178 6.3724
Haplotype 1 .11646 2.45005 .962 -4.7956 5.0285
Haplotype 2 2.85584 3.44938 .411 -4.0598 9.7714
Haplotype 3 5.32727 5.48417 .336 -5.6678 16.3224
MCV Benin Haplotype 1 16.80405* 6.49394 .012 3.7845 29.8236
Haplotype 2 17.43571* 7.17215 .018 3.0564 31.8150
Haplotype 3 15.95000 8.94524 .080 -1.9841 33.8841
Senegal 18.05909* 6.87626 .011 4.2730 31.8452
Haplotype 1 Benin -16.80405* 6.49394 .012 -29.8236 -3.7845
Haplotype 2 .63166 3.68696 .865 -6.7602 8.0236
Haplotype 3 -.85405 6.49394 .896 -13.8736 12.1655
Senegal 1.25504 3.07196 .684 -4.9039 7.4139
Haplotype 2 Benin -17.43571* 7.17215 .018 -31.8150 -3.0564
Haplotype 1 -.63166 3.68696 .865 -8.0236 6.7602
Haplotype 3 -1.48571 7.17215 .837 -15.8650 12.8936
Senegal .62338 4.32497 .886 -8.0477 9.2944
Haplotype 3 Benin -15.95000 8.94524 .080 -33.8841 1.9841
Haplotype 1 .85405 6.49394 .896 -12.1655 13.8736
Haplotype 2 1.48571 7.17215 .837 -12.8936 15.8650
Senegal 2.10909 6.87626 .760 -11.6770 15.8952
Senegal Benin -18.05909* 6.87626 .011 -31.8452 -4.2730
Haplotype 1 -1.25504 3.07196 .684 -7.4139 4.9039
Haplotype 2 -.62338 4.32497 .886 -9.2944 8.0477
Haplotype 3 -2.10909 6.87626 .760 -15.8952 11.6770
MCH Benin Haplotype 1 7.30270* 3.44888 .039 .3881 14.2173
Haplotype 2 7.85714* 3.80907 .044 .2204 15.4939
Haplotype 3 8.70000 4.75074 .073 -.8247 18.2247
Senegal 8.90909* 3.65192 .018 1.5874 16.2308
Haplotype 1 Benin -7.30270* 3.44888 .039 -14.2173 -.3881
Haplotype 2 .55444 1.95811 .778 -3.3713 4.4802
Haplotype 3 1.39730 3.44888 .687 -5.5173 8.3119
Senegal 1.60639 1.63149 .329 -1.6646 4.8773
Haplotype 2 Benin -7.85714* 3.80907 .044 -15.4939 -.2204
Haplotype 1 -.55444 1.95811 .778 -4.4802 3.3713
Haplotype 3 .84286 3.80907 .826 -6.7939 8.4796
Senegal 1.05195 2.29695 .649 -3.5532 5.6571
Haplotype 3 Benin -8.70000 4.75074 .073 -18.2247 .8247
Haplotype 1 -1.39730 3.44888 .687 -8.3119 5.5173
Haplotype 2 -.84286 3.80907 .826 -8.4796 6.7939
Senegal .20909 3.65192 .955 -7.1126 7.5308
Senegal Benin -8.90909* 3.65192 .018 -16.2308 -1.5874
Haplotype 1 -1.60639 1.63149 .329 -4.8773 1.6646
Haplotype 2 -1.05195 2.29695 .649 -5.6571 3.5532
Haplotype 3 -.20909 3.65192 .955 -7.5308 7.1126
MCHC Benin Haplotype 1 1.76216 3.22304 .587 -4.6997 8.2240
Haplotype 2 2.47143 3.55965 .490 -4.6652 9.6081
Haplotype 3 4.05000 4.43966 .366 -4.8510 12.9510
Senegal 3.43636 3.41279 .318 -3.4059 10.2786
Haplotype 1 Benin -1.76216 3.22304 .587 -8.2240 4.6997
Haplotype 2 .70927 1.82990 .700 -2.9595 4.3780
Haplotype 3 2.28784 3.22304 .481 -4.1740 8.7497
Senegal 1.67420 1.52466 .277 -1.3826 4.7310
Haplotype 2 Benin -2.47143 3.55965 .490 -9.6081 4.6652
Haplotype 1 -.70927 1.82990 .700 -4.3780 2.9595
Haplotype 3 1.57857 3.55965 .659 -5.5581 8.7152
Senegal .96494 2.14655 .655 -3.3386 5.2685
Haplotype 3 Benin -4.05000 4.43966 .366 -12.9510 4.8510
Haplotype 1 -2.28784 3.22304 .481 -8.7497 4.1740
Haplotype 2 -1.57857 3.55965 .659 -8.7152 5.5581
Senegal -.61364 3.41279 .858 -7.4559 6.2286
Senegal Benin -3.43636 3.41279 .318 -10.2786 3.4059
Haplotype 1 -1.67420 1.52466 .277 -4.7310 1.3826
Haplotype 2 -.96494 2.14655 .655 -5.2685 3.3386
Haplotype 3 .61364 3.41279 .858 -6.2286 7.4559
RDW Benin Haplotype 1 -1.27973 6.81036 .852 -14.9337 12.3742
Haplotype 2 -5.49286 7.52162 .468 -20.5728 9.5871
Haplotype 3 -10.05000 9.38110 .289 -28.8580 8.7580
Senegal -.63182 7.21131 .931 -15.0896 13.8260
Haplotype 1 Benin 1.27973 6.81036 .852 -12.3742 14.9337
Haplotype 2 -4.21313 3.86661 .281 -11.9652 3.5390
Haplotype 3 -8.77027 6.81036 .203 -22.4242 4.8837
Senegal .64791 3.22164 .841 -5.8111 7.1069
Haplotype 2 Benin 5.49286 7.52162 .468 -9.5871 20.5728
Haplotype 1 4.21313 3.86661 .281 -3.5390 11.9652
Haplotype 3 -4.55714 7.52162 .547 -19.6371 10.5228
Senegal 4.86104 4.53571 .289 -4.2325 13.9546
Haplotype 3 Benin 10.05000 9.38110 .289 -8.7580 28.8580
Haplotype 1 8.77027 6.81036 .203 -4.8837 22.4242
Haplotype 2 4.55714 7.52162 .547 -10.5228 19.6371
Senegal 9.41818 7.21131 .197 -5.0396 23.8760
Senegal Benin .63182 7.21131 .931 -13.8260 15.0896
Haplotype 1 -.64791 3.22164 .841 -7.1069 5.8111
Haplotype 2 -4.86104 4.53571 .289 -13.9546 4.2325
Haplotype 3 -9.41818 7.21131 .197 -23.8760 5.0396
*. The mean difference is significant at the 0.05 level.

The content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.

The authors have declared that no competing interests exist.

Human Ethics

Consent was obtained or waived by all participants in this study. Ethics and Research Committee at Faculty of Applied Medical Sciences, King Abdulaziz University issued approval FAMS-2019-003

Animal Ethics

Animal subjects: All authors have confirmed that this study did not involve animal subjects or tissue.

References

  • 1.The definition and epidemiology of non-transfusion-dependent thalassemia. Weatherall DJ. https://www.sciencedirect.com/science/article/abs/pii/S0268960X12700036. Blood Rev. 2012;26:3–6. doi: 10.1016/S0268-960X(12)70003-6. [DOI] [PubMed] [Google Scholar]
  • 2.Thalassemia: a prevalent disease yet unknown term among college students in Saudi Arabia. Olwi DI, Merdad LA, Ramadan EK. J Community Genet. 2018;9:277–282. doi: 10.1007/s12687-017-0351-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Marked regional variations in the prevalence of sickle cell disease and β-thalassemia in Saudi Arabia: findings from the premarital screening and genetic counseling program. Memish ZA, Owaidah TM, Saeedi MY. J Epidemiol Glob Health. 2011;1:61–68. doi: 10.1016/j.jegh.2011.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Distribution of hemoglobinopathy disorders in Saudi Arabia based on data from the premarital screening and genetic counseling program, 2011-2015. Alsaeed ES, Farhat GN, Assiri AM, et al. J Epidemiol Glob Health. 2018;7:0. doi: 10.1016/j.jegh.2017.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Disease knowledge and treatment adherence among adult patients with thalassemia: a cross-sectional correlational study. Alnaami A, Wazqar D. Pielegniarstwo XXI wieku / Nursing in the 21st Century. 2019;18:95–101. [Google Scholar]
  • 6.Identification of seven novel variants in the β-globin gene in transfusion-dependent and normal patients. Aldakeel SA, Ghanem NZ, Al-Amodi AM, et al. Arch Med Sci. 2020;16:453–459. doi: 10.5114/aoms.2019.84825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Biochemical and molecular analysis of the beta-globin gene and LCR region on Saudi β-thalassemia patients. Alafari H, Alenzi FQ. Saudi J Biol Sci. 2020;27:3106–3112. doi: 10.1016/j.sjbs.2020.08.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Beta-globin gene haplotypes in the Saudi sickle cell anaemia patients. El-Hazmi MA. Hum Hered. 1990;40:177–186. doi: 10.1159/000153927. [DOI] [PubMed] [Google Scholar]
  • 9.Cox CB, Moore PD, Ladle R. John Wiley & Sons; 2016. Biogeography: An Ecological and Evolutionary Approach. [Google Scholar]
  • 10.The role of haplotypes in candidate gene studies. Clark AG. Genet Epidemiol. 2004;27:321–333. doi: 10.1002/gepi.20025. [DOI] [PubMed] [Google Scholar]
  • 11.Haplotype analysis of beta thalassemia patients in Western Iran. Rahimi Z, Muniz A, Akramipour R, Tofieghzadeh F, Mozafari H, Vaisi-Raygani A, Parsian A. Blood Cells Mol Dis. 2009;42:140–143. doi: 10.1016/j.bcmd.2008.12.001. [DOI] [PubMed] [Google Scholar]
  • 12.A novel sickle cell mutation of yet another origin in Africa: the Cameroon type. Lapouniéroulie C, Dunda O, Ducrocq R, et al. Hum Genet. 1992;89:333–337. doi: 10.1007/BF00220553. [DOI] [PubMed] [Google Scholar]
  • 13.Genetic heterogeneity of the beta-globin gene in various geographic populations of Yunnan in southwestern China. Zhang J, He J, Zeng XH, et al. PloS ONE. 2015;10:122956. doi: 10.1371/journal.pone.0122956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Molecular defects in beta-thalassaemia in the population of Saudi Arabia. El-Hazmi MA, Al-Swailem AR, Warsy AS. Hum Hered. 1995;45:278–285. doi: 10.1159/000154314. [DOI] [PubMed] [Google Scholar]
  • 15.Identification and clinical presentation of beta thalassaemia mutations in the eastern region of Saudi Arabia. El-Harith EH, Kuhnau W, Schmidtke J, Stuhrmann M, Nasserallah Z, Al-Shahiri A. https://pubmed.ncbi.nlm.nih.gov/10636742/ J Med Genet. 1999;36:935–937. [PMC free article] [PubMed] [Google Scholar]
  • 16.Molecular basis of beta-thalassemia in the western province of Saudi Arabia: identification of rare beta-thalassemia mutations. Abuzenadah AM, Hussein IM, Damanhouri GA, et al. Hemoglobin. 2011;35:346–357. doi: 10.3109/03630269.2011.588508. [DOI] [PubMed] [Google Scholar]
  • 17.Polymerase chain reaction amplification applied to the determination of beta-like globin gene cluster haplotypes. Sutton M, Bouhassira EE, Nagel RL. Am J Hematol. 1989;32:66–69. doi: 10.1002/ajh.2830320113. [DOI] [PubMed] [Google Scholar]
  • 18.Rapid and reliable beta-globin gene cluster haplotyping of sickle cell disease patients by FRET Light Cycler and HRM assays. Joly P, Lacan P, Garcia C, Delasaux A, Francina A. Clin Chim Acta. 2011;412:1257–1261. doi: 10.1016/j.cca.2011.03.025. [DOI] [PubMed] [Google Scholar]
  • 19.A phased SNP-based classification of sickle cell anemia HBB haplotypes. Shaikho EM, Farrell JJ, Alsultan A, et al. BMC Genomics. 2017;18:608. doi: 10.1186/s12864-017-4013-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes. Lindenau JD, Wagner SC, de Castro SM, Hutz MH. Genet Mol Biol. 2016;39:515–523. doi: 10.1590/1678-4685-GMB-2016-0032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Beta globin gene cluster haplotypes of the beta thalassemia mutations observed in Denizli province of Turkey. Bahadir A, Ozturk O, Atalay A, Atalay EO. https://tjh.com.tr/jvi.aspx?pdir=tjh&plng=eng&un=TJH-96168&look4= Turkish J Haematol. 2009;26:129–137. [PubMed] [Google Scholar]
  • 22.Presence of atypical beta globin (HBB) gene cluster haplotypes in sickle cell anemia patients of India. Nongbri SRL, Verma HK, Lakkakula B, Patra PK. Rev Bras Hematol Hemoter. 2017;39:180–182. doi: 10.1016/j.bjhh.2017.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Haplotype analysis of three common beta-thalassemia mutations in Syrian patients. Murad H, Moassas F, Ghoury I, Mukhalalaty Y. Hemoglobin. 2018;42:302–305. doi: 10.1080/03630269.2018.1553789. [DOI] [PubMed] [Google Scholar]
  • 24.Sickle cell anemia: clinical diversity and beta S-globin haplotypes. Loggetto SR. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3728122/ Rev Bras Hematol Hemoter. 2013;35:155–157. doi: 10.5581/1516-8484.20130048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Effect of beta-globin gene cluster haplotype on the hematological and clinical features of sickle cell anemia. Rieder RF, Safaya S, Gillette P, Fryd S, Hsu H, Adams JG III, Steinberg MH. Am J Hematol. 1991;36:184–189. doi: 10.1002/ajh.2830360305. [DOI] [PubMed] [Google Scholar]

Articles from Cureus are provided here courtesy of Cureus Inc.

RESOURCES