Skip to main content
Antimicrobial Resistance and Infection Control logoLink to Antimicrobial Resistance and Infection Control
. 2021 Mar 18;10:57. doi: 10.1186/s13756-021-00923-w

Prevalence of pathogenic Klebsiella pneumoniae based on PCR capsular typing harbouring carbapenemases encoding genes in Uganda tertiary hospitals

Kenneth Ssekatawa 1,2,3, Denis K Byarugaba 1, Jesca L Nakavuma 1, Charles D Kato 1, Francis Ejobi 1, Robert Tweyongyere 1, Wampande M Eddie 1,✉
PMCID: PMC7977577  PMID: 33736698

Abstract

Background

Klebsiella pneumoniae is an opportunistic pathogen that has been implicated as one of commonest cause of hospital and community acquired infections. The K. pneumoniae infections have considerably contributed to morbidity and mortality in patients with protracted ailments. The capacity of K. pneumoniae to cause diseases depends on the presence of an array virulence factors. Coexistence and expression of virulence factors and genetic determinants of antibiotic resistance complicates treatment outcomes. Thus, emergence of pathogenic MDR K. pneumoniae poses a great threat to the healthcare system. However, the carriage of antibiotic resistance among pathogenic K. pneumoniae is yet to be investigated in Uganda. We sought to investigate the carbapenem resistance profiles and pathogenic potential based on capsular serotypes of K. pneumoniae clinical isolates.

Methods

This was a cross sectional study involving use of archived Klebsiella pneumoniae isolates collected between January and December, 2019 at four tertiary hospitals in Uganda. All isolates were subject to antimicrobial susceptibility assays to determine phenotypic antibiotic resistance, pentaplex PCR to detect carbapenemases encoding genes and heptaplex PCR to identify capsular serotypes K1, K2, K3, K5, K20, K54 and K57.

Results

The study found an overall phenotypic carbapenem resistance of 23.3% (53/227) and significantly higher genotypic resistance prevalence of 43.1% (98/227). Over all, the most prevalent gene was blaOXA-48-like (36.4%), followed by blaIMP-type (19.4%), blaVIM-type (17.1%), blaKPC-type (14.0%) and blaNDM-type (13.2%). blaVIM-type and blaOXA-48-like conferred phenotypic resistance in all isolates and 38.3% of isolates that harbored them respectively. Capsular multiplex PCR revealed that 46.7% (106/227) isolates were pathogenic and the predominantly prevalent pathotype was K5 (18.5%) followed by K20 (15.1%), K3 (7.1%), K2 (3.1%) and K1 (2.2%). Of the 106 capsular serotypes, 37 expressed phenotypic resistance; thus, 37 of the 53 carbapenem resistant K. pneumoniae were pathogenic.

Conclusion

The high prevalence of virulent and antibiotic resistant K. pneumoniae among clinical isolates obtained from the four tertiary hospital as revealed by this study pose a great threat to healthcare. Our findings underline the epidemiological and public health risks and implications of this pathogen.

Keywords: Carbapenem resistance, Klebsiella pneumoniae PCR capsular typing, Virulent factors

Background

The growing prevalence of antibiotic-resistant clinical bacterial isolates is one of the main burdens to the healthcare systems worldwide [1, 2]. Knowledge of antibiotic resistance genetic determinants is critical in thwarting the emergence and spread of multidrug-resistant (MDR) bacteria. Of great concern, is the spread of MDR strains of pathogenic Klebsiella pneumoniae, the Gram-negative bacteria that cause healthcare associated infections (HAI), community acquired infections, urinary tract infections (UTI) and wound infections. K. pneumoniae can harbor and express beta lactamases, most importantly carbapenemases capable of hydrolyzing newer carbapenem drugs used in the treatment of MDR bacterial infections [3–5].

An array of virulent factors responsible for pathogenesis such as endotoxins, capsules, iron-scavenging systems, siderophores and adhesions can be expressed by K. pneumoniae. A capsule is a vital virulence factor, because it confers two pathogenic mechanisms; shielding the invading bacteria from phagocytosis, and neutralizing the host immune response [6]. Klebsiella capsular serotyping (K typing) differentiates K. pneumoniae into approximately 77 K types [7]. Several capsular (K) types, predominantly K1, K2, K54, K57, K20, and K5, are frequently linked to community-acquired invasive septicemia, pyogenic liver abscess syndrome and pneumonia [8, 9]. K3 is the usual cause of rhinoscleroma [10]. Pathogen survival requires the acquisition of drug resistance and virulent factors [11] and the acquired traits have been postulated to play an important part in the pathogenesis of K. pneumoniae infections [12].

Molecular capsular typing is presently the main technique employed in characterization of K. pneumoniae isolates and demonstrates excellent reproducibility in distinguishing clinical isolates [13]. Multiplex PCRs for detecting of the capsule repeat unit polymerase Wzy genes can be utilized for capsule typing of K. pneumoniae [14, 15]. Therefore, virulence factors encoding genes can be used to characterize the different pathotypes of K. pneumonia. In spite of this, the carbapenem resistance profiles of pathogenic K. pneumoniae in Uganda are yet to be documented. Thus, to obtain insights into this, we characterized the carbapenem genetic resistance determinants among the pathogenic Klebsiella pneumoniae clinical isolates collected from four main referral hospitals in Uganda.

Materials and methods

Bacterial strains

The study used 227 out of 284 archived MDR Klebsiella pneumoniae isolated between January and December, 2019 from clinical specimens in the Microbiology Laboratories of Mulago National Referral Hospital (MNRH) located in the central region 03381°N, 32.5761°E, Mbale Regional Referral Hospital (MRRH) in the Eastern region 1.0766°N, 34.1768°E, Mbarara Regional Referral Hospital (MBRRH),Western region 0.6171° S, 30.6577° E and Kampala International University Teaching Hospital (KIU-TH), Western region, 0.5468° S, 30.1387° E, Table 1.The isolates were initially assayed and confirmed to be resistant to several antibiotics.

Table 1.

Genes and their primers sequences for molecular characterization of K. pneumoniae

Target genes Primer sequence Ampilicon size (Bp) References
khe

F: TGATTGCATTCGCCACTGG

R: GGTCAACCCAACGATCCTG

428 Neuberger et al. [53]
WzyK1

F: GGTGCTCTTTACATCATTGC

R: GCAATGGCCATTTGCGTTAG

1283 Turton et al. [54]
WzyK2

F: GACCCGATATTCATACTTGACAGAG

R: CCTGAAGTAAAATCGTAAATAGATGGC

641 Turton et al. [54]
WzxK5

F: TGGTAGTGATGCTCGCGA

R: CCTGAACCCACCCCAATC

280 Turton et al. [54]
WzyK20

F: CGGTGCTACAGTGCATCATT

R: GTTATACGATGCTCAGTCGC

741 Fang et al. [9]
WzxK54

F: CATTAGCTCAGTGGTTGGCT

R: GCTTGACAAACACCATAGCAG

881 Fang et al. [9]
Wzy57

F: CTCAGGGCTAGAAGTGTCAT

R: CACTAACCCAGAAAGTCGAG

1037 Pan et al. [41]
WzyK3

F: TAGGCAATTGACTTTAGGTG

R: AGTGAATCAGCCTTCACCT

549 Fevre et al. [10]
BlaKPC

F-ATG TCA CTG TAT CGC CGT CT

R-TTT TCA GAG CCT TAC TGC CC

538 Dallenne et al. [19]
BlaIMP-1

F-TGA GCA AGT TAT CTG TAT TC

R-TTA GTT GCT TGG TTT TGA TG

139 Dallenne et al. [19]
BlaIMP-2

F-GGC AGT CGC CCT AAA ACA AA

R-TAG TTA CTT GGC TGT GAT GG

139 Dallenne et al. [19]
BlaVIM

F-GAT GGT GTT TGG TCG CAT A

R-CGA ATG CGC AGC ACC AG

390 Dallenne et al. [19]
BlaNDM

F-GGT TTG GCG ATC TGG TTT TC

R-CGG AAT GGC TCA TCA CGA TC

521 Mushi  et al. [24]
BlaOXA-48 like

F-TTG GTG GCA TCG ATT ATC GG

R- GAG CAC TTC TTT TGT GAT GGC

281 Dallenne et al. [19]

Recovery of isolates and carbapenem susceptibility

The isolates were transported to the microbiology laboratory, College of Veterinary Medicine Animal Resources and Biosecurity (COVAB) and instantly inoculated on blood agar for recovery. The identity of each isolate was reconfirmed by Microgen (Micro-biology International) kits for biochemical assays using procedures described by the manufacturer (www.microgenbioproducts.com). The isolates were subjected to antibiotic sensitivity assay on Muller-Hinton agar to ampicillin (AMP) 25 μg, amoxicillin/clavulanic acid (AMO) 20/10 μg, ciprofloxacin (CIP) 5 μg, cefuroxime (CXM) 30 μg, temocillin (TEM) 30 μg, piperacillin-tazobactum (TPZ) 110 μg, cefoxitin (FOX) 30 μg, cefipime (FEP) 30 μg, ceftriaxone (CRO) 30 μg, ceftazidime (CAZ) 30 μg, cefotaxime (CTX) 30 μg, ertapenem (ERT) 10 μg, imipenem (IMI) 10 μg and meropenem (MEM) 10 μg (Oxoid, UK). E. coli ATCC 25,922 was used as a susceptible strain and Klebsiella pneumoniae ATCC BAA-1705 as a positive control. Data generated by the susceptibility assay were interpreted based on the CLSI 2020 guidelines [16].

Molecular characterization of K. pneumoniae

Klebsiella pneumoniae capsular molecular typing and characterization of carbapenem resistant genes was done by multiplex PCR employing adjusted methods used in the typing of E. coli by Toma et al. [17]. The first Multiplex PCR typing was based on primers targeting the K1, K2, K5, K20, K54, K57, and K3 capsular antigen genes to detect the major seven serovars [18], Table 1. The second multiplex PCR used primers targeting carbapenemase encoding genes namely; blaVIM, blaIMP, blaKPC, blaOXA-48, and blaNDM [19], Table 1. Briefly, total genomic DNA was isolated using Qiagen DNA extraction kits according to the manufacturer’s instructions. For amplification, each multiplex PCR mixture contained a total of volume 50 μl composed of 23 μl 1X DreamTaqTM Green PCR Master Mix (Fermentas, Waltham, MA, USA), 0.8 μM of each primer pair (Eurofins Genomics AT GmbH, Austria) and 2.5 μl DNA template (100 ng/µl). Final PCR mixture volume was topped up to 50 μl and executed in a Bio-Rad PTC-200 Thermal Cycler (Bio-Rad, Hercules, CA, USA). For capsular typing, the PCR amplification conditions were; an initial denaturation at 95 °C for 5 min, then 35 amplification cycles at 95 °C for 30 s, 50 °C for 30 s, 72 °C for 1 min, and a final extension at 72 °C for 30 min. The reference strain K. pneumoniae GIM 46,117 (khe +) acted as a positive control while for carbapenemase genes molecular typing the annealing temperature was increased to 56 °C and the final elongation step performed for 10 min. PCR products were electrophoresed on a 1.5% agarose and stained with ethidium bromide to detect and assigning amplicons to their respective genes by comparing with 100–2000 base-pairs standard DNA ladder (Biomatik, USA). DSMZ 9377 Klebsiella pneumoniae was used as a negative control for all genes. Klebsiella pneumonia Nr.8 for NDM-1, Klebsiella pneumoniae 714 for OXA-48, Klebsiella pneumoniae 211 (T) for KPC, P. aeruginosa for IMP (Positive control strains from the Institute of Microbiology, Giessen, Germany) and E. coli for the VIM gene [20] were used as positive controls.

Statistical analysis

Data analysis was performed using SPSS Version 25 statistical software. Chi square tests and Spearman’s correlation were used to compare the frequencies of carbapenem resistant isolates, carbapenem resistance genes, capsular serotypes and correlation of resistance genes to phenotypic resistance. A P-value of ≤ 0.05 signified substantial statistical variation.

Results

Klebsiella pneumoniae isolates were obtained from different clinical samples of patients who were referred to the microbiology laboratories of the respective hospitals. A total of 284 isolates were obtained. However, 57 isolates were excluded because 24 isolates failed grow and 33 isolates were not Klebsiella pneumoniae. Of the 227 isolates used in this study, 128 were obtained from urine, 48 from pus swabs, 23 from blood, 16 rectal swabs, seven were from vaginal swabs, three from tracheal aspirate and two from sputum, Table 2.

Table 2.

Distribution of Klebsiella pneumoniae isolates in different clinical samples

Hospital Clinical sample Total
Urine Blood Pus swab Rectal swab sputum Vaginal swab Tracheal aspirate
MNRH 44 6 19 5 2 5 1 82
MRRH 22 – 2 – – – – 24
MBRRH 39 15 22 09 – – 2 87
KIU-TH 23 2 5 2 – 2 – 34
Total 128 23 48 16 2 7 3 227

Phenotypic carbapenem resistance profiles

Isolates used in this study were MDR as they exhibited resistance to different types of antibiotics, Table 3. Out of the 227 K. pneumoniae clinical isolates collected from different hospitals, 53 displayed phenotypic resistance to ertapenem; thus, this study established an overall phenotypic carbapenem resistance prevalence of 23.4%. Among the carbapenems, ertapenem registered the highest resistance (23.4%) while both imipenem and meropenem tied at 11.0%. Furthermore, MRRH scored the highest phenotypic carbapenem resistance prevalence (29.2%) followed by MBRRH (24.1%), MNRH (19.5%) and KIU-TH (11.8%), Table 3.

Table 3.

Phenotypic antibiotics resistance profiles of K. pneumoniae clinical isolates obtained from different referral hospitals in Uganda

Tertiary hospital Total Resistance prevalence (%)
MNRH MRRH MBRRH KIU-TH
Number of isolates 82 24 87 34 227 –
AMP 82 (100%) 24 (100%) 87 (100%) 34 (100%) 227 100
AMO 82 (100%) 24 (100%) 85 (97.7%) 34 (100%) 225 99.1
SXT 82 (97.6%) 24 (100%) 85 (97.7%) 33 (97.1%) 222 97.8
CXM 81 (98.8%) 24 (100%) 86 (98.9%) 34 (100%) 225 99.1
TEM 80 (97.6%) 24 (100%) 80 (92.0%) 32 (94.1%) 216 95.2
TPZ 64 (78.1%) 19 (79.2%) 77 (88.5%) 25 (73.5%) 185 81.5
FOX 52 (63.4%) 14 (58.3%) 48 (55.2%) 15 (44.1%) 129 56.8
FEP 80 (97.6%) 24 (100%) 83 (95.4%) 33 (97.1%) 220 96.9
CRO 82 (100%) 23 (95.8%) 86 (98.9%) 34 (100%) 225 99.1
CAZ 82 (100%) 24 (100%) 86 (98.9%) 34 (100%) 226 99.6
CTX 82 (100%) 24 (100%) 87 (100%) 34 (100%) 227 100
CIP 30 (36.6%) 9 (37.5%) 30 (34.5%) 13 (38.2%) 82 36.1
ERT 17 (20.7%) 7 (29.2%) 25 (28.7%) 4 (11.8%) 53 23.4
IMI 11 (13.4%) 3 (12.5%) 7 (8.1%) 4 (11.8%) 25 11.0
MEM 11 (13.4%) 3 (12.5%) 7 (8.1%) 4 (11.8%) 25 11.0

Distribution of carbapenemase encoding genes

From a total of 227 K. pneumoniae isolates, multiplex PCR amplification revealed that 43.1% (98/227) harbored one or more carbapenemases encoding gene combinations, Table 4. A total of 129 carbapenem resistance genes were scored. Of these, blaOXA-48 like was the most predominant gene with a genotypic frequency of 36.4% (47/129) followed by blaIMP-type (25/129 = 19.4%), blaVIM-type (22/129 = 17.1%), blaKPC-type (18/129 = 14.0%) and blaNDM-like (17/122 = 13.2%). K. pneumoniae isolates obtained from MRRH scored the highest genotypic prevalence of carbapenem resistance (17/24 = 70.7%) followed by MNRH (35/82 = 42.7%), MBRRH (35/87 = 40.2%) and KIU-TH (11/34 = 32.4%), Tables 4 and 5, Fig. 1.

Table 4.

Distribution of carbapenem resistant genes in K. pneumoniae isolates obtained from different referral hospitals in Uganda

Referral hospital n Carbapenemase encoding genes
NDM KPC IMP OXA-48 VIM NDM & OXA-48 KPC & IMP KPC & OXA-48 IMP & OXA-48 VIM & OXA-48 VIM, NDM & OXA-48 NDM, KPC & OXA-48 IMP, NDM & OXA-48 NDM, KPC, VIM & OXA-48 Total CR isolates Prevalence (%)
MNRH 82 3 3 8 8 2 2 2 – – 2 2 2 1 35 42.7
MRRH 24 3 4 3 2 – 1 – 4 – – 17 70.8
MBRRH 87 2 3 4 10 9 – – – 7 – – – – 35 40.2
KIU-TH 34 – 2 3 5 1 – – – – – – – – – 11 32.4
Total 227 98 43.2

Table 5.

Relationship between carbapenemase encoding gene with phenotypic resistance

Level of phenotypic and genotypic carbapenem resistance Carbapenem resistance genes
VIM OXA-48 IMP KPC NDM
Number of resistant isolates with the gene 22 18 15 13 7
Number of sensitive isolates with the gene 0 29 10 5 10
Percentage gene prevalence (%) 9.7 20.7 11.0 11 7.5
Percentage resistance conferred by gene presence (%) 100 38.3 60 72.2 41.2
Carbapenem resistance genotypic frequency (%) 17.1 36.4 19.4 14.0 13.2
Pearson Chi square P value 0.001 0.007 0.001 0.001 0.007

Fig. 1.

Fig. 1

Genotypic frequency of carbapenemase encoding genes

Correlation of phenotypic resistance with genotypic resistance

Variation between phenotypic and genotypic was registered. The prevalence of VIM gene was 9.7% and conferred phenotypic resistance to 100% of the isolates that harbored it. This was followed by KPC-like which exhibited phenotypic resistance in 72.2% of the isolates, then IMP at 60%, NDM at 41.2% and then OXA-48 protected only 38.3% of isolates that housed it. All the carbapenemase encoding genes significantly correlated to phenotypic resistance with chi square P value < 0.05, Table 5

Phenotypic carbapenem resistance profile among the Klebsiella pneumoniae pathotypes

The overall prevalence of pathogenic Klebsiella pneumoniae in Uganda was 46.3% (105/227) as revealed by multiplex PCR capsular typing. Of the 105 pathotypes, 37 exhibited phenotypic carbapenem resistance; thus, among the 53 phenotypic resistant klebsiella pneumoniae isolates, 37 (69.8%) were pathogenic. However, comparison of carbapenem resistance and susceptibility among the K pathotypes registered chi square P values > 0.05 indicating insignificant carbapenem resistance. PCR capsular typing targeted seven pathogenic genes where, WzyK5 scored the highest occurrence of 18.5% (42), followed by WzyK20 at 15.4% (35), WzyK3 at 7.1% (16), WzyK2 at 3.1% (07) and WzyK1 at 2.2% (05) Table 6. Capsular pathogenic genes WzyK54 and WzyK57 were not detected in any isolates. MRRH recorded the highest prevalence of Klebsiella pneumoniae pathotypes (15/24) trailed by MBRRH (46/87), KIU-TH (15/34) and MNRH (29/82). Pathogenic Klebsiella pneumoniae were isolated from urine (50), pus swabs (21), rectal swabs (19), blood (11), and other clinical specimens (04) Table 6.

Table 6.

Phenotypic carbapenem resistance profiles of Klebsiella pneumoniae capsular pathotypes isolated from different clinical specimens

Pathotype MNRH MRRH MBRRH KIU-TH Total capsular type/ Prevalence (%) CR pathotypes Chi square P value Clinical specimen
WzyK1 2 1 2 0 5/2.2 2 0.12 Tracheal aspirate (2) and Rectal swab (3)
WzyK2 1 3 3 0 7/3.1 2 0.91 Blood (5) and Virginal swab (2)
WzyK3 5 4 7 0 16/7.1 6 0.31 Urine (13) and Rectal swab (3)
WzyK5 12 3 20 7 42/18.5 16 0.41 Urine (20), Pus swab (13), blood (3) and Rectal swab (6)
WzyK20 9 4 14 8 35/15.4 11 0.07 Urine (17), Pus swab (8), blood (3), rectal swab (7)
WzyK54 – – – – – – N/A –
WzyK57 – – – – – – N/A –
Total 29/82 15/24 46/87 15/34 105 37
Prevalence % 35.4 62.5 52.9 44.1 46.7 16.3

Discussion

Klebsiella pneumoniae has been implicated as one of the main human pathogens causing nosocomial and community acquired infections over a long period of time. Due to antimicrobial resistance, treatment of K. pneumoniae infections has become exceedingly complicated (Moradigaravand et al. 2017). Furthermore, the situation is worsened when antimicrobial resistance is acquired by highly pathogenic strains. Most importantly, resistance to carbapenems in Klebsiella pneumoniae epitomizes a great threat to the delivery of health services worldwide. To decipher the state of affairs in Uganda, we investigated the prevalence of carbapenem resistant pathogenic K. pneumoniae in Uganda. Findings from this study exhibited that 56.4% of the MDR K. pneumoniae isolates were recovered from urine, 21.2% from pus swab and 10.1% from blood. Indeed, previous studies implicated K. pneumoniae as one of the predominant causes of urinary tract infections, surgical wound infections and bacteriemia [21, 22].

The study screened 227 MDR K. pneumoniae isolates obtained from four tertiary hospitals located in different regions for carbapenem resistance. High overall phenotypic carbapenem resistance prevalence of 23.3% was detected. This is in agreement with other studies in Uganda and Tanzania that reported phenotypic carbapenem resistance prevalence among Enterobacteriaceae of 22.4% [23] and 24% [24] respectively. However, a similar study at MBRRH detected lower phenotypic prevalence of 12.6% [25]. Contrary to this, studies in North Africa and West Africa reported remarkably higher phenotypic resistance of > 50% and K. pneumoniae were the most prevalent isolates [26–29]. Furthermore, a larger study which covered Gauteng, KwaZulu-Natal, Western Cape and Free State provinces in South Africa documented overwhelming phenotypic resistance of between 47 and 50% to imipenem, meropenem and doripenem, 84% and 89% to ertapenem [30, 31]. In comparison with previous studies at MNRH [23] and MBRRH [25] this study shows that the prevalence of carbapenem resistance in Uganda is on the rise and this is terrifying as recent meta-analyses revealed a substantial correlation between carbapenem resistant infections and increased risk of death [32].

Through molecular characterization, we detected carbapenem genotypic resistance frequency ranging from 32.4% at KIU-TH to 70.8% at MRRH and overall genotypic resistance prevalence of 43.2% in Uganda. In contrast, the overall genotypic prevalence was lower than that reported in Tunisia (86.3%) [33], Egypt (56%) [27], South Africa (86.0%), [31], India (76.3%) [34]. Among the five genes which were detected by multiplex PCR, the most encountered gene was OXA-48-like at a genotypic frequency of 36.4%. This corroborates well with recent studies which documented OXA-48-like gene and its variants as the most prevalent gene [27, 31, 33, 35]. OXA-48 was first detected in K. pneumoniae isolate in Turkey 2003. OXA-48 producers spread sporadically to the neighboring countries located in the southern and eastern part of the Mediterranean Sea, and north Africa [36]. This provides an insight why the occurrence of OXA-48 is predominantly high in Egypt and Tunisia [27, 33]. Previous studies reported NDM as the most dominant gene in South Africa [30, 37], VIM and IMP as the most prevalent genes in East Africa [23–25, 38] in contrast with the results of this study. This trend of events clearly shows that OXA-48 like producing E. coli and K. pneumoniae have invaded sub-Saharan Africa through immigration of individuals from the endemic region.

The overall phenotypic resistance registered by this study was lower than the genotypic resistance. For example, all isolates which harbored VIM expressed phenotypic resistance to ertapenem. Whereas OXA-48 like provided protection in only 38.3% of the isolates that sheltered it in disc diffusion assays. Oxacillinases encoded for by OXA-48 and its variant genes have been reported to possess low carbapenems hydrolyzing activity [36, 39, 40]. This enlighten why 61.7% of the isolates that housed OXA-48-like genes were sensitive to carbapenems. Furthermore, results of this study outlines that not all isolates that harbored carbapenemase genes were carbapenem insusceptible. This agrees with [40] findings who reported that modification and down regulation of outer membrane proteins through which drugs diffuse to reach their targets complements gene products and among the carbapenems, ertapenem is affected most by this scenario. This elucidates why resistance to ertapenem was significantly high. Thus, presence of a carbapenemase encoding genes alone does not guarantee resistance.

The capsule is one of the major factors that influence virulence in K. pneumoniae. Several studies have documented how capsular types influence pathogenicity of K. pneumoniae associated infections [9, 41]. Previous studies unraveled the structures of the gene cluster in Klebsiella spp responsible for capsular polysaccharide synthesis (CPS) in some types [42, 43]. The genetic structure is composed of a cluster of six highly conserved genes among different capsule types namely galF, cpsACP, wzi, wza, wzb and wzc that encodes for proteins that play a role in CPS translocation and processing at the bacterial surface and are located at the 5′ end of the cps regions and genes encoding glucose-6-phosphate dehydrogenase (gnd) and UDP-glucose dehydrogenase (ugd) found at the 3′ end. In the middle of the CPS loci lies a variable region that contains certain genes (Wzy and Wzx) that transcribe proteins accountable for polymerization and putting together of the specific CPS subunits. Thus, the great sequence variation of the wzy gene among the different capsular types is the basis of PCR capsular typing assays [43–45]. In light of this, we exploited the Wzy gene to characterize the most clinically important K. pneumoniae capsular serotypes isolated from different tertiary hospitals in Uganda.

Capsular typing by heptaplex PCR revealed that K1, K2, K3, K5 and K20 accounted 46.7% (106/227) of the K. pneumoniae clinical isolates. K54 and K57 were not detected in any of the isolates. Klebsiella pneumoniae K1 and K2 have been reported as the most virulent capsular types causing septicemia and liver abscess [41, 43]. However, other capsular serotypes are equally important as K5 and K20 are also associated with community acquired ailments whereas K3 causes chronic granulomatous infection of the nasal cavity and in some patients, the infection advance and lead to severe respiratory impairment [10, 13]. Thus, the high prevalence of pathogenic capsular serotypes isolated from clinical specimens is a great threat to the healthcare system. There is no data about incidence of K. pneumoniae K types within the sub-Saharan region for comparison. However, results of this study are in line with Lin et al. [46], who reported K1, K2, K3, K5 and K20 as the most prevalent capsular types in Taiwan. Furthermore, out of the 106 klebsiella pneumoniae capsular types, 37 exhibited resistance to carbapenems yet carbapenems are regarded as the drugs of choice for treatment of MDR Gram-Negative HAI when the first line drugs have failed [47]. Acquisition of carbapenem resistance in pathogenic bacteria correlates with treatment failure in addition to increased morbidity and mortality [21]. Investigations elsewhere which looked clinical samples, associated coexistence of capsular and other virulent factors such as rmpA and aerobactin genes with hypervirulent or hypermucoviscous K. pneumoniae variant (hvKP) [48, 49]. Despite the fact that this study did not attempt to detect other virulence factors, high occurrence of carbapenem resistance in capsular serotypes detected in study suggests possible existence carbapenem resistant hypervirulent K. pneumoniae (CR-HvKP) in Uganda clinical settings. Indeed, this has been case in clinical settings with substantial carbapenem resistance [50–52].

Conclusion

Findings of this study show that clinical K. pneumoniae isolates obtained from representative tertiary hospitals in Uganda exhibit high diversity of the main virulent capsular types and antibiotic resistance profiles to the frontline and last resort antibiotics. Based antimicrobial susceptibility assay, PCR capsular and carbapenemase gene typing, substantial prevalence of highly virulent MDR K. pneumoniae isolates were present in clinical specimens. High incidence of such isolates poses great health risks within healthcare and community settings; thus, should be treated with urgent attention. To the best of our knowledge, this is the first study to unravel the carriage of carbapenem resistance in pathogenic K. pneumoniae clinical isolates in Uganda. Thus, our data informs the need for regular surveillance of antibiotic resistance in pathogenic bacteria in clinical settings for meaningful control of emergence and spreading of AMR pathogens. Furthermore, this study only investigated carbapenem resistance carriage in capsular serotypes. However, to provide an insight into carbapenem resistance carriage in all K. pneumoniae pathotypes, additional virulence genes such as the rmpA gene expressing regulator of mucoid phenotype A; allS gene which is translated into the activator of the allantoin regulon, connected to allantoin metabolism; endotoxin encoding genes wabG, uge, and wcaG; iron acquisition system codifying genes iucB, iroNB, ybtA, and kfuBC; adhesin gene fimH (type I fimbriae); and ureA gene coding for a-subunit of the urease should be characterized.

Acknowledgements

We are thankful to MAPRONANO ACE funding this work.

Abbreviations

MDR

Multidrug-resistant

HAI

Healthcare associated infections

UTI

Urinary tract infection

K

Capsular

MNRH

Mulago National Referral Hospital

MRRH

Mbale Regional Referral Hospital

MBRRH

Mbarara Regional Referral Hospital

KIU-TH

Kampala International University-Teaching Hospital

COVAB

College of Veterinary Medicine Animal Resources and Biosecurity

AMP

Ampicillin

AMO

Amoxicillin/clavulanic acid

CIP

Ciprofloxacin

CXM

Cefuroxime

TEM

Temocillin

TPZ

Piperacillin-tazobactum

FOX

Cefoxitin

FEP

Cefipime

CRO

Ceftriaxone

CAZ

Ceftazidime

CTX

Cefotaxime

ERT

Ertapenem

IMI

Imipenem

MEM

Meropenem

ATCC

American Type Cell Cultures

bla

Beta lactamase

KPC

Klebsiella pneumoniae Carbapenemase

NDM

New Delhi Metallo-β-lactamase

VIM

Verona Integron-encoded Metallo-βlactamase

IMP

Imipenemase Metallo-β-lactamase

OXA

Oxacillinase

CPS

Capsular polysaccharide synthesis

Authors' contributions

This work was carried out in collaboration between all authors. Denis K. Byarugaba (BKB), Eddie Wampande (EW), Francis Ejobi (FE), Jesca L. Nakavuma (JLN), Robert Tweyongere (RT) and Charles Kato Drago (CKD) conceptualized and designed the format for this study. Kenneth Ssekatawa (KS) carried out all the Laboratory experiments. KS, CKD and EW conducted data analysis. All authors drafted and managed manuscript revisions. All authors read and approved the final manuscript.

Funding

The authors declare that this research project was funded by Africa Centre of Excellence in Materials, Product Development & Nanotechnology; MAPRONANO ACE, Grant No. P151847IDA credit 5797-UG, College of Engineering Design Art and Technology, Makerere University and WHO-TDR Grant No. 2020/1037452-0.

Availability of data and materials

All data generated by this study have been submitted with this manuscript. Raw data and any other forms data generated by this project can be obtained from the authors on request by e-mail.

Declarations

Ethics and consent to participate

Ethical Approval No.: MHREC1611 was granted by the Research and Ethics Committee for ethical review and approval, Mulago National Referral Hospital. The Research Ethics Committee waived the need for informed consent to use already coded archived samples in this study.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Kenneth Ssekatawa, Email: Kssekatee@gmail.com.

Denis K. Byarugaba, Email: dkb@covab.mak.ac.ug

Jesca L. Nakavuma, Email: jesca.nakuvuma@gmail.com

Charles D. Kato, Email: katodrago@gmail.com

Francis Ejobi, Email: ejobifrancis@gmail.com.

Robert Tweyongyere, Email: tmrobert966@gmail.com.

Wampande M. Eddie, Email: wamps@covab.mak.ac.ug

References

  • 1.Ferri M, et al. Antimicrobial resistance: a global emerging threat to public health systems. Crit Rev Food Sci Nutr. 2017;57(13):2857–2876. doi: 10.1080/10408398.2015.1077192. [DOI] [PubMed] [Google Scholar]
  • 2.EFSA EU Summary Report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2013. J EFSA. 2015;13(2):4036. doi: 10.2903/j.efsa.2017.4694. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bassetti M, et al. Multidrug-resistant Klebsiella pneumoniae: challenges for treatment, prevention and infection control. Expert Rev Anti Infect Ther. 2018;16(10):749–761. doi: 10.1080/14787210.2018.1522249. [DOI] [PubMed] [Google Scholar]
  • 4.Ferreira RL, et al. High prevalence of multidrug-resistant Klebsiella pneumoniae harboring several virulence and β-lactamase encoding genes in a Brazilian intensive care unit. Front Microbiol. 2019;9:3198. doi: 10.3389/fmicb.2018.03198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Moradigaravand D, et al. Evolution and epidemiology of multidrug-resistant Klebsiella pneumoniae in the United Kingdom and Ireland. mBio. 2017;8(1):e01976–e2016. doi: 10.1128/mBio.01976-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kang Y, Tian P, Tan T. Research advances in the virulence factors of Klebsiella pneumonia—a review. Acta Microbiologica Sin. 2015;55(10):1245–1252. [PubMed] [Google Scholar]
  • 7.Ørskov I, Ørskov F. Methods in microbiology. Elsevier; 1984. 4 serotyping of Klebsiella; pp. 143–164. [Google Scholar]
  • 8.Siri GP, Sithebe NP, Ateba CN. Identification of Klebsiella species isolated from Modimola dam (Mafikeng) North West Province South Africa. J Afr J Microbiol Res. 2011;5(23):3958–3963. [Google Scholar]
  • 9.Fang C-T, et al. Klebsiella pneumoniae genotype K1: an emerging pathogen that causes septic ocular or central nervous system complications from pyogenic liver abscess. Clin Infect Dis. 2007;45(3):284–293. doi: 10.1086/519262. [DOI] [PubMed] [Google Scholar]
  • 10.Fevre C, et al. PCR-based identification of Klebsiella pneumoniae subsp. rhinoscleromatis, the agent of rhinoscleroma. PLoS Negl Trop Dis. 2011;5(5):e1052. doi: 10.1371/journal.pntd.0001052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.da Silva GJ, Mendonça NJV. Association between antimicrobial resistance and virulence in Escherichia coli. Virulence. 2012;3(1):18–28. doi: 10.4161/viru.3.1.18382. [DOI] [PubMed] [Google Scholar]
  • 12.Vila A, et al. Appearance of Klebsiella pneumoniae liver abscess syndrome in Argentina: case report and review of molecular mechanisms of pathogenesis. Open Microbiol J. 2011;5:107. doi: 10.2174/1874285801105010107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Siu LK, et al. Molecular typing and virulence analysis of serotype K1 Klebsiella pneumoniae strains isolated from liver abscess patients and stool samples from noninfectious subjects in Hong Kong, Singapore, and Taiwan. J Clin Microbiol. 2011;49(11):3761–3765. doi: 10.1128/JCM.00977-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Turton JF, et al. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J Med Microbiol. 2010;59(5):541–547. doi: 10.1099/jmm.0.015198-0. [DOI] [PubMed] [Google Scholar]
  • 15.Cheng L, et al. Investigations on the virulence, serotypes and genotyping of Klebsiella pneumoniae producing KPC-2. Front Microbiol. 2015;33:591–595. [Google Scholar]
  • 16.CLSI., Performance Standards for Antimicrobial Disk Susceptibility Tests for Bacteria Isolated from Animals: CLSI Supplement VET01SEd5E; Replaces VET01-S2. 2020: Clinical and Laboratory Standards Institute.
  • 17.Toma C, et al. Multiplex PCR assay for identification of human diarrheagenic Escherichia coli. J Clin Microbiol. 2003;41(6):2669–2671. doi: 10.1128/JCM.41.6.2669-2671.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhang S, et al. Phenotypic and genotypic characterization of Klebsiella pneumoniae isolated from retail foods in China. Front Microbiol. 2018;9:289. doi: 10.3389/fmicb.2018.00289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Dallenne C, et al. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J Antimicrob Chemother. 2010;65(3):490–495. doi: 10.1093/jac/dkp498. [DOI] [PubMed] [Google Scholar]
  • 20.Fischer J, et al. Escherichia coli producing VIM1 carbapenemase isolated on a pig farm. J Antimicrob Chemother. 2012;67(7):1793–1795. doi: 10.1093/jac/dks108. [DOI] [PubMed] [Google Scholar]
  • 21.Cienfuegos-Gallet AV, et al. Risk factors and survival of patients infected with carbapenem-resistant Klebsiella pneumoniae in a KPC endemic setting: a case-control and cohort study. BMC Infect Dis. 2019;19(1):830. doi: 10.1186/s12879-019-4461-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Vading M, et al. Invasive infection caused by Klebsiella pneumoniae is a disease affecting patients with high comorbidity and associated with high long-term mortality. PLoS ONE. 2018;13(4):e0195258. doi: 10.1371/journal.pone.0195258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Okoche D, et al. Prevalence and characterization of carbapenem-resistant Enterobacteriaceae isolated from Mulago National Referral Hospital, Uganda. PLoS ONE. 2015;10(8):e0135745. doi: 10.1371/journal.pone.0135745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Mushi MF et al. Carbapenemase genes among multidrug resistant gram negative clinical isolates from a tertiary hospital in Mwanza, Tanzania. 2014; 2014. [DOI] [PMC free article] [PubMed]
  • 25.Ampaire LM, et al. Epidemiology of carbapenem resistance among multi-drug resistant enterobacteriaceae in Uganda. Br Microbiol Res J. 2015;8(2):418. doi: 10.9734/BMRJ/2015/17055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kotb S, et al. Epidemiology of carbapenem-resistant Enterobacteriaceae in Egyptian intensive care units using National Healthcare–associated Infections Surveillance Data, 2011–2017. Antimicrob Resist Infect Control. 2020;9(1):1–9. doi: 10.1186/s13756-019-0639-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.ElMahallawy HA, et al. Spread of carbapenem resistant Enterobacteriaceae at tertiary care cancer hospital in Egypt. Egypt. 2018;50(7):560–564. doi: 10.1080/23744235.2018.1428824. [DOI] [PubMed] [Google Scholar]
  • 28.Ogbolu D, Webber M. High-level and novel mechanisms of carbapenem resistance in Gram-negative bacteria from tertiary hospitals in Nigeria. J Int J Antimicrobial Agents. 2014;43(5):412–417. doi: 10.1016/j.ijantimicag.2014.01.014. [DOI] [PubMed] [Google Scholar]
  • 29.Elramalli A, Almshawt N, Ahmed MO. Current problematic and emergence of carbapenemase-producing bacteria: a brief report from a Libyan hospital. Pan Afr Med J. 2017;26:180. doi: 10.11604/pamj.2017.26.180.9637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Perovic O, et al. Molecular detection of carbapenemase-producing genes in referral Enterobacteriaceae in South Africa: a short report. S Afr Med J. 2016;106:2016. doi: 10.7196/SAMJ.2016.v106i10.11300. [DOI] [PubMed] [Google Scholar]
  • 31.Perovic O, et al. Carbapenem-resistant Enterobacteriaceae in patients with bacteraemia at tertiary hospitals in South Africa, 2015 to 2018. Eur J Clin Microbiol Infect Dis. 2020;39(7):1287–1294. doi: 10.1007/s10096-020-03845-4. [DOI] [PubMed] [Google Scholar]
  • 32.Soontaros S, Leelakanok N. Association between carbapenem-resistant Enterobacteriaceae and death: a systematic review and meta-analysis. Am J Infect Control. 2019;47(10):1200–1212. doi: 10.1016/j.ajic.2019.03.020. [DOI] [PubMed] [Google Scholar]
  • 33.Kollenda H, et al. Screening for carbapenemases in ertapenem-resistant Enterobacteriaceae collected at a Tunisian hospital between 2014 and 2018. Gut. 2019;9(1):9–13. doi: 10.1556/1886.2018.00033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Mohanty S, Gajanand M, Gaind R. Identification of carbapenemase-mediated resistance among Enterobacteriaceae bloodstream isolates: a molecular study from India. Indian J Med Microbiol. 2017;35(3):421–425. doi: 10.4103/ijmm.IJMM_16_386. [DOI] [PubMed] [Google Scholar]
  • 35.Mahrach Y, et al. Phenotypic and molecular study of carbapenemase-producing Enterobacteriaceae in a regional hospital in northern Morocco. J Clin Med Sci. 2019;3:113. [Google Scholar]
  • 36.Nordmann P, Naas T, Poirel L. Global spread of Carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011;17(10):1791–1798. doi: 10.3201/eid1710.110655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Singh-Moodley A, Perovic O. Antimicrobial susceptibility testing in predicting the presence of carbapenemase genes in Enterobacteriaceae in South Africa. J BMC Infectious Diseases. 2016;16(1):536. doi: 10.1186/s12879-016-1858-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kateete DP, et al. Carbapenem resistant Pseudomonas aeruginosa and Acinetobacter baumannii at Mulago Hospital in Kampala, Uganda (2007–2009) Springerplus. 2016;5(1):1308. doi: 10.1186/s40064-016-2986-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Nordmann P, Dortet L, Poirel L. Carbapenem resistance in Enterobacteriaceae: here is the storm! J Trends Mol Med. 2012;18(5):263–272. doi: 10.1016/j.molmed.2012.03.003. [DOI] [PubMed] [Google Scholar]
  • 40.Codjoe FS, Donkor ES. Carbapenem resistance: a review. Med Sci (Basel) 2017;6(1):1. doi: 10.3390/medsci6010001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Fung C, et al. A global emerging disease of Klebsiella pneumoniae liver abscess: is serotype K1 an important factor for complicated endophthalmitis? Gut. 2002;50(3):420–424. doi: 10.1136/gut.50.3.420. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Pan Y-J, et al. Capsular polysaccharide synthesis regions in Klebsiella pneumoniae serotype K57 and a new capsular serotype. J Clin Microbiol. 2008;46(7):2231–2240. doi: 10.1128/JCM.01716-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Chuang Y-P, et al. Genetic determinants of capsular serotype K1 of Klebsiella pneumoniae causing primary pyogenic liver abscess. J Infect Dis. 2006;193(5):645–654. doi: 10.1086/499968. [DOI] [PubMed] [Google Scholar]
  • 44.Shu H-Y, et al. Genetic diversity of capsular polysaccharide biosynthesis in Klebsiella pneumoniae clinical isolates. Microbiology. 2009;155(12):4170–4183. doi: 10.1099/mic.0.029017-0. [DOI] [PubMed] [Google Scholar]
  • 45.Rahn A, Drummelsmith J, Whitfield C. Conserved organization in the cps gene clusters for expression of Escherichia coli group 1 K antigens: relationship to the colanic acid biosynthesis locus and the cps genes from Klebsiella pneumoniae. J Bacteriol. 1999;181(7):2307–2313. doi: 10.1128/jb.181.7.2307-2313.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Lin Y-T, et al. Community-onset Klebsiella pneumoniae pneumonia in Taiwan: clinical features of the disease and associated microbiological characteristics of isolates from pneumonia and nasopharynx. Front Microbiol. 2015;6:122. doi: 10.3389/fmicb.2018.00122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ssekatawa K, et al. A systematic review: the current status of carbapenem resistance in East Africa. BMC Res Notes. 2018;11(1):629. doi: 10.1186/s13104-018-3738-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Arena F, et al. Infections caused by carbapenem-resistant Klebsiella pneumoniae with hypermucoviscous phenotype: a case report and literature review. Virulence. 2017;8(8):1900–1908. doi: 10.1080/21505594.2017.1286439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Martin RM, Bachman MA. Colonization, infection, and the accessory genome of Klebsiella pneumoniae. J Front Cell Infect Microbiol. 2018;8:4. doi: 10.3389/fcimb.2018.00004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Zhang Y, et al. Emergence of a hypervirulent carbapenem-resistant Klebsiella pneumoniae isolate from clinical infections in China. J Infect. 2015;71(5):553–560. doi: 10.1016/j.jinf.2015.07.010. [DOI] [PubMed] [Google Scholar]
  • 51.Zhang R, et al. Emergence of carbapenem-resistant serotype K1 hypervirulent Klebsiella pneumoniae strains in China. Antimicrob Agents Chemother. 2016;60(1):709–711. doi: 10.1128/AAC.02173-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Zhang Y, et al. High prevalence of hypervirulent Klebsiella pneumoniae infection in China: geographic distribution, clinical characteristics, and antimicrobial resistance. J Antimicrobial Agents Chemother. 2016;60(10):6115–6120. doi: 10.1128/AAC.01127-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Neuberger A, Oren I, Sprecher H. Clinical impact of a pcr assay for rapid identification of Klebsiella pneumoniae in blood cultures. J Clin Microbiol. 2008;46:377–379. doi: 10.1128/JCM.00568-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Turton JF, Baklan H, Siu LK, Kaufmann ME, Pitt TL. Evaluation of a multiplex PCR for detection of serotypes K1, K2 and K5 in Klebsiella sp. and comparison of isolates within these serotypes. FEMS Microbiol Lett. 2008;284:247–252. doi: 10.1111/j.1574-6968.2008.01208.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated by this study have been submitted with this manuscript. Raw data and any other forms data generated by this project can be obtained from the authors on request by e-mail.


Articles from Antimicrobial Resistance and Infection Control are provided here courtesy of BMC

RESOURCES