Skip to main content
BMC Genomic Data logoLink to BMC Genomic Data
. 2021 Mar 18;22:12. doi: 10.1186/s12863-021-00966-3

Cloning and expression analysis of GATA1 gene in Carassius auratus red var

Yusu Tian 1, Yuandong Sun 1,, Mi Ou 2, Xiaojuan Cui 1, Dinggang Zhou 1, Wen’an Che 1
PMCID: PMC7977614  PMID: 33736593

Abstract

Background

GATA1 is a key transcription factor in the GATA family, and promotes the differentiation and maturation of red blood cell, which is essential for normal hematopoiesis.

Results

Our results showed that the cDNA sequence of GATA1 was 2730 bp long encoding 443 amino acids. qRT-PCR analysis demonstrated that GATA1 had the highest expression in testis (T), followed by pituitary (P) and spleen (S). GATA1 gene expression in C. auratus red var. embryo from the neuroblast stage (N) to the embryo hatching (H) changes continuously; and the gene expression levels of nonylphenol (NP)-treated and those of control embryos were significantly different. Moreover, Methylation levels of GATA1 gene in NP-treated embryos were higher than those in control embryos, indicating that NP affected GATA1 methylation.

Conclusions

Our study provides cues for further studying the roles of GATA1 gene in fish development, and suggested a potential molecular mechanism by which NP leads to abnormal development of fish embryos.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12863-021-00966-3.

Keywords: Carassius auratus red var.,; GATA1; Cloning; Methylation; Expression characteristics

Background

Nonylphenol (NP), an environmental hormone that mimics estrogen and binds to its receptors in the cell, interferes with endocrine metabolism and has toxic effects on animals [1]. Studies demonstrated that NP was detrimental to reproduction. For example, NP causes male reproductive dysfunction, damages the development of testis, and leads to the decline of male fertility and sperm counts [2]. A low 4-NP (a typical isomer of para-NP) dosage induced uterine nutrition response in prepuberty rats, but not in ovariectomized adult rats [3]. Tanaka et al. showed that Rivulus marmoratus had abnormal gonadal development and testis insufficiency when exposed to NP [4]. In Oryzias latipes, the percentage of motile spermatozoa after sperm exposure to NP decreased dramatically [5]. However, although 4-NP did affect sperm production in Oncorhynchus mykiss, it showed no effect on sperm density, motility and fertility [6]. NP not only affected adult fish, but also interfered with fish embryonic development. When Puntius conchonius embryos were exposed to NP, they showed developmental abnormalties such as egg coagulation, spinal deformity, and delayed development [7]. NP had drastic toxicity to development of goldfish embryos, which showed higher sensitivity to low concentrations of NP than adult fish [8]. 4-NP also affected the development of embryos and larvae of Oncorhynchus mykiss at the end of the yolk sac stage, reducing their survival rate [6]. In NP-exposured zebrafish embryos, the distribution of PGCs along the anterior–posterior axis in 24-h-old embryos changed, which may influence the juvenile and adult gonadal structures [9].

There have been some studies on the effects of NP on gene expression in vivo. Xia et al. reported that the expression of cy5 and cy3 in the rat was down-regulated under NP exposure [10]. When Chironomus riparius larvae were treated with NP, the expression level of CrEcR was significantly up-regulated, through which nonylphenol might have significant implications in various developmental stages of C. riparius [11]. P353-NP (a typical isomer of para-NP) caused embryonic dysplasia in zebrafish (Danio rerio), with the expression of ntl and spt unchanged but that of tbx6 significantly increased [12]. Nonylphenol exposure reduced Na+/K+-ATPase activity, plasma cortisol and triiodothyronine levels in Salmo salar gills [13]. In addition, another study in Salmo salar suggests NP could regulate the hepatic enzyme activities that were mediated by Cyp3a and Cyp1a1 through Pxr and Ahr. Furthermore, NP might have impacts on metabolism of both endogenous and exogenous substrates [14]. Paolo et al. found that significantly higher PPARα mRNA levels in Solea solea were associated with 4-NP treatment for 3 days while the highest dose of 4-NP in their study also led to up-regulation of retinoid X receptor α (RXRα) transcription [15].

GATA1 is a key transcription factor for erythropoiesis, and it contains three conserved functional domains: C-zinc finger, N-zinc finger, and N-terminal activation [16]. The two zinc finger domains are responsible for DNA binding and protein-protein interactions, which allow them to recognize typical GATA binding sites with a consensus sequence WGATAR [17]. GATA1 is indispensable in differentiation of erythroid cells and megakaryocytes. In the development of erythroid cells, GATA1 functions early in megakaryocytes. GATA1 controls terminal maturation and its deficiency induces proliferation [18]. Galloway established a transcriptional hierarchy dependent on GATA in the process of hematopoiesis, and demonstrated that GATA1 played an integral role in the fate determination of myelo-erythroid lineage during embryogenesis [19]. Chan et al. found that reduced hematopoiesis in Choonodraco hamatus was associated with miR-152-mediated down-regulation of GATA1 [16]. More importantly, studies have found abnormal localization of P-selectin induced by GATA1 (low) mutations, and increased pathological interactions with leucocytes as well, which were responsible for increased thrombosis in mice [20].

Carassius auratus red var. fulfills our basic requirements of experimental animals. It is convenient for artificial breeding, easy to discover and eliminate mutant individuals, and highly sensitive to NP [21, 22]. C. auratus red var. embryos developed malformations under NP stress, such as spine curvature, tail deformity, pericardial abnormalities and thrombosis [23]. Our previous transcriptome study revealed that GATA1 expression in C. auratus red var. embryos was affected by NP-treatment, which may be one of the causes for embryonic malformation C. auratus [23]. In this study, we cloned and sequenced the full-length GATA1 cDNA in C. auratus red var., and conducted bioinformatics analysis. In addition, we used realtime fluorescence quantitative PCR (qRT-PCR) to explore expression patterns of GATA1 in different tissues of C. auratus red var. and transcriptional changes of GATA1 after exposure to different concentrations of NP. Moreover, we measured differences in DNA methylation levels of the C. auratus red var. embryos between the NP treatment groups and the control ones at various developmental stages, and measured NP treatment effects on GATA1 methylation. This study investigated the expression of GATA1 gene in abnormal development of C. auratus red var. embryos under NP stress, and explored the relationship between thrombosis and GATA1 gene in malformed embryos. Our study provides cues for further research on the molecular mechanism of embryo development deformity in C. auratus red var. caused by NP.

Results

Analysis of GATA1 sequences from C. auratus red var

The cDNA sequence of GATA1 from C. auratus red var. (GenBank Accession no. MT322308) is 2730 bp in length, with an ORF of 1332 bp encoding 443 amino acids (aa), 541 bp 5′-UTR, 857 bp 3′-UTR with three poly (A) signal sequences (AATAA), three RNA instability motifs (ATTTA), and a poly (A) tail. Two ZnF domains (aa 225–275, aa 279–329) were predicted in GATA1 protein (Fig. 1).

Fig. 1.

Fig. 1

Nucleotide and putative amino acid sequences of GATA1and its product. The sequences numbers of nucleotide (lower row) and putative amino acid (upper row) are shown on the left. The translation initiation codon (ATG), stop codons (TGA) are in bold and yellow background. The motif associated mRNA instability (ATTTA) is doubly underscored, and poly-adenylation signal sequence (AATAA) is emphasized by wavy line. The ZnF domains are marked with gray background

The genomic sequence of GATA1 from C. auratus red var. is 14,759 bp in length, which contains 5 exons and 4 introns following the consensus rule of GT/AG (Fig. 2). Comparison of GATA1 genomic structures among Carassius auratus (Gene ID: 113081347), Cyprinus carpio (Gene ID: 109098530), Sinocyclocheilus rhinocerous (Gene ID: 107749468), Sinocyclocheilus grahami (Gene ID: 107581944), Danio rerio (Gene ID: 564960), Mastacembelus armatus (Gene ID: 113130813) and Monopterus albus (Gene ID: 109968602) demonstrated that the genomic structure of GATA1 from C. auratus red var. is identical to the GATA1 from other teleost fish, all consisting of 5 exons and 4 introns.

Fig. 2.

Fig. 2

Genomic structure of GATA1 genes. The lengths of the elements are shown in base pairs (bp), and the numbers above and below each schematics represent the lengths of exons and introns of corresponding gene, respectively

Multiple alignments and phylogenetic analysis

BLASTP analysis (Fig. 3) showed that GATA1 in C. auratus red var.shared highest similarity to CaGATA1 (99.10%) and CcGATA1 (83.97%), medium similarities to SrGATA1 (81.07%), SgGATA1 (80.36%), DrGATA1 (59.78%), and ChGATA1 (39.6%), and lowest similarities to MaGATA1 (20.77%) and MoGATA1 (20.77%).

Fig. 3.

Fig. 3

Multiple alignments of GATA1 with GATA1 proteins from various species. The amino acid sequences of GATA1 from typical organisms were aligned using the ClustalW 2.1 program. The black shade represents 100% identity, dark gray represented 80% identity. CaGATA1 stands for GATA1 protein in Carassius auratus (Protein ID. XM_026253445.1), CcGATA1 stands for GATA1 protein in Cyprinus carpio (Protein ID. XM_019103428.1), SrGATA1 stands for GATA1 protein in Sinocyclocheilus rhinocerous (Protein ID. XM_016537268.1), SgGATA1 stands for GATA1 protein in Sinocyclocheilus grahami (Protein ID. XM_016271639.1), DrGATA1 stands for GATA1 protein in Danio rerio (Protein ID. XP_021334219.1), ChGATA1 stands for GATA1 protein in Chionodraco hamatus (Protein ID. KP221299.1), MaGATA1 stands for GATA1 protein in Mastacembelus armatus (Protein ID. XP_026189425.1), MoGATA1 stands for GATA1 protein in Monopterus albus (Protein ID. XM_020614979.1)

Phylogenetic analysis further supported gene homology among those species (Fig. 4). Homologous amino acid sequences of GATA1 from other teleost fish and non-fish animals were collected from NBCI to construct a phylogenetic tree, which indicated that these homolog proteins could be divided into five groups, representing mammals, birds, amphibians, fishes and invertebrates, respectively. The phylogenetic tree revealed that the GATA1 protein in C. auratus red var. is closest to of its ortholog in C. auratus, with a high bootstrap value of 99%. All the fish GATA1 proteins clustered together, and diverged from their counterparts in other groups. GATA1 proteins in invertebrates were far separated from those in vertebrates. Thus, the phylogenetic tree reflected a genetic consistency among those species in evolution.

Fig. 4.

Fig. 4

Phylogenetic tree of the GATA1 proteins in different species. A neighbor-joining phylogenetic tree was constructed using MEGA 5.0 software. The bootstrap values of the branches were obtained by testing the tree 1000 times and values were over 50% percent marked. The GenBank accession numbers of GATA1 proteins are given after the species names in the tree

Distribution of GATA1 in C. auratus red var. tissue

qRT-PCR was performed to analyze the tissue distribution of GATA1 mRNA expression. As shown in Fig. 5, GATA1 expression was detected in all organs tested, and the values were calibrated against the expression level in heart (H). GATA1 had the highest expression level in testis (T) (100.44 folds, P < 0.05); intermediate levels in pituitarium (P) (7.91 folds, P < 0.05), spleen (S) (5.70 folds, P < 0.05), gills (G) (3.90 folds, P < 0.05), brain (B) (3.43 folds, P < 0.05); and the lowest levels in muscle (M) (0.68 folds), liver (L) (0.35 folds), and ovary (O) (0.33 folds).

Fig. 5.

Fig. 5

qRT-PCR analysis of the distribution of GATA1 in different tissues. Expression of β-actin was used as an internal control for qRT-PCR. The relative expression was the ratio of gene expression in different tissues relative to that in the heart (H). Detailed values are listed at the bottom of the figure. The assay was performed three times, and data were analyzed by the unpaired t-test. *P < 0.05, compared with control

GATA1 expression in different developmental stages after NP treatment

To determine the effect of NP exposure on GATA1 gene expression, the levels of GATA1 mRNA in different developmental stages were examined (Fig. 6). During the normal embryonic development, the GATA1 gene expression can be detected from the N stage, and the expression level increased at the S5 stage, decreased continuously at S14 and S21 stages, and then increased again at the P5 stage. Afer that, it reached to the highest at the P25 stage, and dropped again after embryo hatching. GATA1 expression levels in both the 3 μmol / L and 5 μmol / L NP-treated groups showed the biggest difference from that in the control group at the S14 stage, while the biggest difference in GATA1 expression between the 7 μmol / L NP-treated and control groups happened at S21 stage. (Fig. 6). On the other hand The biggest difference in GATA1 mRNA levels at the neuroblast stage was found between the control and the 3 μmol / L NP treated groups when compared with other group pairs. When embryos developed to the 5 somite stage, the 7 μmol / L NP-exposure group had greater effect on the expression of GATA1 gene than other treated groups with lower NP dosages (Fig. 6). Apparently, NP affected GATA1 expression during the development of C. auratus red var. embryos, and the greatest effect took place in somatic embryos.

Fig. 6.

Fig. 6

Expression levels of GATA1 in the treatment and control groups at various developmental stages. CK: 0 μmol / LNP-treated embryos; NP3: 3 μmol / LNP-treated embryos; NP5: 5 μmol / LNP-treated embryos; NP7: 7 μmol / LNP-treated embryos. C. auratus red var. embryos mostly failed to hatch under NP7 treatment, so no H stage samples were collected. The data between different treatment groups at the same developmental period were analyzed by the unpaired t-test. *P < 0.05, compared with control

The methylation levels of GATA1 changed significantly in NP -treated groups

Our selected GATA1PCR target fragment was 277 bp in size and had 10 CpG sites. Table 1 shows the methylation status of 10 CpG sites in the control and NP5 treatment groups. In the control groups, the methylation rates of GATA1 gene at N, S5, S14, S21, P5, P25 and H stages were 85.88, 94.33, 92.86, 89.61, 92.67, 98.00, and 89.33%, respectively. While in the NP-treated groups, the methylation rates of GATA1 gene at N, S5, S14, S21, P5, P25 and H stages were 93.52, 96.67, 98.00, 97.06, 98.00, 98.67, and 97.00%, respectively (Fig. 7). Obviously, methylation levels of GATA1 gene in the NP-treated embryo groups were mostly higher than that in the control group. We analyzed correlation between GATA1 mRNA expression and methylation of GATA1 gene in both the control and NP-treated groups, and found GATA1 expression was significantly positively correlated with its methylation level in the control group (r = 0.771, P < 0.05), but not in the NP-treated groups (r = 0.533, P > 0.05).

Table 1.

Methylation status of the 5’UTR region of the GATA1 gene

CpG sites Methylation level of the CK/% Methylation level of NP5/%
− 3681 100.00 100.00
− 3668 100.00 100.00
− 3657 97.94 100.00
− 3528 86.60 96.08
− 3518 79.38 97.06
− 3490 60.82 69.61
− 3478 89.69 97.06
− 3466 98.79 100.00
− 3434 100.00 100.00
− 3413 100.00 100.00

The CpG sites were located between − 3413 ~ − 3681 upstream to the start codon

CK: 0 μmol / LNP-treated embryos; NP5: 5 μmol / LNP-treated embryos

Degree of methylation = methylation number of the measured CpG sites/total number of the CpG sites measured

Fig. 7.

Fig. 7

Correlation analysis between GATA1 mRNA expression and GATA1 gene methylation. a: Scatter plot of correlation between GATA1 mRNA expression and methylation degree of 5’UTR region of GATA1 gene in control group embryos; b: Scatter plot of correlation between GATA1 mRNA expression and methylation degree of GATA1 gene 5’UTR region of NP treatment group

Discussion

In this study, C. auratusthe full-length GATA1 cDNA sequence was obtained from C. auratus red var. by homologous cloning and RACE Technologyc. auratus. GATA1 cDNA is 2730 bp in length with a 1332 bp-long ORF encodeing 443 amino acids (aa) a 541 bp-long 5′-UTR and an 857-long bp 3′-UTR. C. auratus red var. is a variant of Carassius auratus. Alignment analysis revealed that the similarity between the C. auratus red var. GATA1 and C. auratus GATA1 protein was as high as 99.1%. Also, phylogenetic analysis showed that the GATA1 protein in C. auratus red var. was closest to that in C. auratus, with bootstrap values reaching 99%. The high similarity between the C. auratus red var. and C. auratus amino acid sequences is in line with our expectations. In vertebrates, members of the GATA family generally consist of five or six exons and include two conserved type IV zinc finger domains: an amino terminal zinc finger (N) and a carboxyl terminal one (C) [24]. We analyzed the conserved domains in the predicted GATA1 protein with SMART, and found that the C. auratus red var. GATA1 contains two ZnF domains (aa 225–275, aa 279–329); The C. auratus red var. GATA1 gene consists of five exons, which is consistent with its paralogs in other species.

The tissue distribution of GATA1 mRNA was analyzed through qRT-PCR. GATA1 expression was detected in all tested tissues of C. auratus red var. GATA1 had the highest expression level in testicle (T); intermediate levels in pituitarium (P), spleen (S), gills (G), brain (B); and lower levels in muscle (M), liver (L), and ovary (O). GATA1 is abundantly transcribed in mouse testis and regulates genes involved in the earliest stages of spermatogenesis [25]. Studies have shown that spermatogenesis is induced by GATA-1 expression in Sertoli cells. As atranscription factor, GATA-1 is a developmental stage- and spermatogenic cycle-specific regulator of gene expression in Sertoli cells [26]. In sexually mature C. auratus red var. individuals used in this study, the GATA1 expression is most enriched in the testes among all tissues and organs. The GATA transcription factor family is essential for pituitary cell differentiation and gonadotropin subunit expression [27]. GATA1 inhibits formation of rat cortical neurons, and GATA1 overexpression ofin the hippocampus can cause depressive behavior in rats [28]. Spleen is an important hematopoietic organ in animal bodies, and the gills are the respiratory fish organs with a large number of capillaries. Accordingly as a key regulator of red blood cell production [18], the GATA1 gene is expressed at high levels in P, S, G, and B of C. auratus red var. We also found very low GATA1 expression in L and O of C. auratus red var. which was consistent with a report in Nile tilapia (Oreochromis niloticus) [29]. C. auratus. Thus, our results with GATA1 expression pattern in various tissues and organs C. auratus provided essential cues to understand GATA1 functions in C. auratus red var. adults.

In C. auratus red var. embryos, the GATA1 gene starts to be detectable from the neural embryo stage, and stays continuously expressed during embryonic development with relatively stable expression levels, which indicates that GATA1 is involved in the entire embryonic development of C. auratus red var. GATA1is also involved in early embryonic development in other fish. In general, early blood islands emerged in the yolk sac endoderm and splanchnic mesoderm during early embryonic development. GATA expression became detectable in zebrafish ectoderm 9 h after fertilization [30]. In Branchiostoma belcheri, GATA1 expression signal could also be detected at the mesendoderm of gastrula stage [31]. NP affects GATA1 expression during the development of C. auratus red var. embryos, C. auratus with a strongest effect at the somatic stage, and with a most effective NP concentration at 3 μmol / LC. auratus. During vertebrate early embryogenesis, the ventral development is directed by the ventral-to-dorsal activity gradient of the bone morphogenetic protein (BMP) signaling [32]. Abnormalties in the BMP signaling pathway may cause strong dorsalization phenotypes in embryos [33]. GATA1 gene is a downstream target of the BMP signaling pathway [34], and is shown to exert repressive effects on spine formation in cortical neurons [35]. Under NP stress, the abnormal expression of GATA1 gene in C. auratus red var. embryos may count for dorsalization after NP treatment. The transcriptional activity of GATA1 is related to the expression level of vitellogenin (Vg) [36]. Vg expression measurement has been used as a biomarker of exposure to endocrine-disrupting chemicals [37]. Up-regulation of GATA1 expression in C. auratus red var. embryos under NP exposure may increase Vg expression, further proving NP is an environmental endocrine disruptor. Yokomizo et al.’s experiments in mouse embryos provided evidence showing the presence of GATA-1(+) hemangioblastic cells in the extra-embryonic region, demonstrating that the GATA1 is involved in definitive hematopoiesis at embryonic stage in close association with endothelial development [38]. GATA1 or GATA2 is required to initiate blood production in the embryo, so GATA1 and GATA2 double deficient mice exhibit no visible blood cells [39]. In addition, GATA1 mutations lead to increased thrombosis in mice [20]. Therefore, the occurrence of thrombosis in C. auratus red var. embryos under NP stress may be related to down-regulation of GATA1 gene expression.

DNA methylation is a heritable modification that affects gene expression without changing DNA sequences. This modification is crucial to embryonic development. Either abnormally higher or lower methylation levels could be detrimental to the normal growth and embryonic development [40]. Reduced methylation on H3-K4 in Lsd1 mutant fruit flies results in tissue-specific developmental defects [41]. Compared with that in normal embryos, H19 gene methylation is severely altered in abnormally developing embryos [42]. In offspring of vitamin-deficient rats, the embryos showed a higher incidence of heart defects, possibly due to the high methylation level of the GATA4 gene [43]. In this study, we found that the methylation level of GATA1 in the control group was lower than that in the NP-treated C. auratus red var. embryos, which demonstrates that NP stress increases methylation level of GATA1 in C. auratus red var. during embryonic development. GATA1 expression is significantly positively correlated with its methylation level in the control group, but not in the NP-treated group. In addition, high levels of GATA1 expression during the same developmental period are not necessarily low in methylation level. Since GATA1 expression levels at different developmental stages in the control group were apparently correlated with GATA1 methylation levels, we suspected that NP exposure affected GATA1 expression through changing its methylation status. However, due to the lack of correlation between GATA1 expression and its methylation in the NP-treated groups, other mechanisms must have been involved. C. auratus This is similar to what Okada et al. reported in mice. In 3 T3-L1 preadipocytes, demethylation did not increase leptin gene expression, and the diet-induced up-regulation of leptin, Mest/Peg1, and sFRP5 gene expression in white adipose tissue (WAT) during the development of obesity in mice is not mediated directly by changes in DNA methylation [44]. In addition, when studying the effect of monomeric and oligomeric flavanols (MOF) consumption on the gene expression profile of leukocytes, Milenkovic et al. found that daily supplementation with 200 mg MOF for 8 weeks modulates the expression of genes associated with cardiovascular disease pathways without major changes of their DNA methylation status [45].

Conclusions

In this study, the full-length cDNA sequence of GATA1 gene in C. auratus red var. was cloned, and the special and temporal expression patterns of GATA1 gene in various tissues/organs and embryonic developmental stages of C. auratus red var. were analyzed. Changes in GATA1 expression during NP-stressed embryonic development was measured, which revealed a role of NP-stress in regulation of GATA1 expression. It provides important cues for unravel GATA1 functions in fish development and molecular mechanisms through which NP leads to abnormal development in fish embryos.

Methods

Fish and sampling

Two-year-old healthy C. auratus red var., weighting about 200 ± 10 g with an average length of 15 ± 3 cm, were obtained from the Engineering Research Center of Polyploid Fish Breeding and Reproduction of the State Education Ministry at Hunan Normal University. All experiments performed were approved by the Animal Care Committee of Hunan Normal University. Before experiments, the fish were acclimatized in an indoor freshwater tank at 25 ± 1 °C and fed twice daily with a commercial diet for 1 week. After no abnormal symptoms were observed, the C. auratus red var. were subjected to further study.

Three healthy fish were sacrificed as one group, and samples from the gills (G), liver (L), spleen (S), intestines (I), middle kidney (MK), muscle (M), head kidney (HK), heart (H), brain (B), pituitarium (P), and gonads (testis (T) or ovary (O)) were collected, respectively. All samples were immediately homogenized in TRIzol reagent (Invitrogen, USA) and stored at − 80 °C until RNA extraction. At the same time, fin tissues were isolated and fixed in 95% ethanol. To minimize suffering, 100 mg/L MS-222 (Sigma-Aldrich, St Louis, MO, USA) was used to anaesthetize fish before dissection.

NP treatment

NP was used for challenge experiments. All the embryos 2 min after fertilization were exposed to NP with the concentrations of 0 μmol/L (blank control, 0.01% ethanol), 3 μmol/L, 5 μmol/L and 7 μmol/L, respectively. Each group was employed for 5 parallel repetitions. Embryo incubation and NP exposure were carried out in 25 cm glass at 25 ± 1 °C.

Intact embryos were collected at 7 stages: neuroblast stage (N), 5 somite stage (S5), 14 somite stage (S14), 21 somite stage (S21), pharyngeal stage-primordium-5 (P5), pharyngeal stage-primordium-25 (P25) and hatching stage (H) after NP exposure. Six groups with 30 embryos in each group were collected at each time points and we used liquid nitrogen to stop embryo development. Samples within each group were homogenized, and aliquots of homogenized tissues were taken for DNA and RNA isolation, respectively.

RNA extraction and cDNA synthesis

The total RNAs were extracted according to the manufacturer’s instruction for TRIzol reagent. Later, the RNA samples were incubated in RNase-free DNase I (Promega, USA) to eliminate any contaminating genomic DNA. Random primers and a ReverTra Ace kit (Toyobo, Japan) were used for reverse transcription to generate cDNA. Samples that need to be extracted total RNAs include: various tissues of healthy adult fish, embryos of the treatment group and the control group at different developmental stages. SMART™ RACE cDNA Amplification Kit (Takara, Japan) was used to obtain 5′-RACE Ready cDNA and 3′-RACE Ready cDNA.

Full-length cDNA cloning and analysis

To identify the cDNA sequence of GATA1 from C. auratus red var., primers GATA1-F1/R1 (Table 2) were designed and synthesized based on the highly conserved regions of known fish GATA1 sequences, including Carassius auratus GATA1 (CaGATA1, Accession no. XM_026253445.1) and Sinocyclocheilus rhinocerous GATA1 (SrGATA1, Accession no. XM_016537268.1). The 5′ and 3′ untranslated regions (UTRs) were obtained according to the manufacturer’s instruction for SMART™ RACE cDNA Amplification Kit. The full-length cDNA sequences were amplified by PCR using GATA1-F2/R2 primers (Table 2) within the 5′and 3′UTRs, respectively.

Table 2.

Primers for full-length cDNA cloning and qRT-PCR

Primer name Sequence (5′ → 3′) Application
GATA1-F1 GCTCCACAAAAGAAAGTCAT partial sequence obtaining
GATA1-R1 ACGAGGGTGTGTAGAGAAGT
GATA1-F2 CCTCAATCACCCACTATGCC ORF qualifying
GATA1-R2 GTGGATTGAGATTCCGACAT
GATA1-R-out GCTCTGGCATAGTGGGTGATTGAGGTTA 5′-Race PCR amplification
GATA1-R-in ATAATCGAAACACATCACTCACCCCA
GATA1-F-out GGCGTCTACAGCCACTCATCCCATTCAC 3′-Race PCR amplification
GATA1-F-in GGATGCTTTAGTCACACGATGTCGGAAT
GATA1-qF CCTTCCCTCCCTTATCCAG qRT-PCR amplification
GATA1-qR GGTAGTGTCCCGTTCCATC

Sequence Manipulation Suite (STS) (http://www.bio-soft.net/sms/) was used to analyse the sequences of GATA1 from C. auratus red var.. The BLASTP program (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to search for GATA1 protein sequence from other species in the NCBI (http:// www.ncbi.nlm.nih.gov/). Multiple sequence alignments were performed by the ClustalX 2.1 program (http://www.ebi.ac.uk/tools/ clustalx2.1). Simple Modular Architecture Research Tool (SMART) (http://smart.embl-heidelberg.de/) was used to predict the protein domain features. A phylogenetic tree was constructed by the neighbor-joining (NJ) algorithm embedded in Mega 5.0 software (http://www.megasoftware.net/ index.html) with a minimum of 1000 bootstraps.

Genomic sequence cloning

Genomic DNA (gDNA) was extracted from the tail fin using the Universal Genomic DNA Kit (CWBio, China) according to the manufacturer’s instructions. Based on the cDNA sequences of GATA1, primers (Table 3) were designed to amplify the genomic sequences gradually. Five overlapping fragments were amplified from gDNA and sequenced.

Table 3.

Primers for genomic DNA sequences

Primer name Sequence (5′ → 3′) Product Length (bp)
GATA1-gDNA-F1 CAATCACCCACTATGCCAGAGC 914 bp
GATA1-gDNA-R1 GCTGAATAAAGAGGGCAGGCTG
GATA1-gDNA-F2 TGGTCCACACTGAGGAGGGTTC 1238 bp
GATA1-gDNA-R2 GGAAACTGTGTACCAGGGACGG
GATA1-gDNA-F3 CTGAGCCACTACAGTCCCTATG 1172 bp
GATA1-gDNA-R3 AGGGGTCTGTTCTGTCTATTCA
GATA1-gDNA-F4 GATGGAACGGGACACTACCTCT 664 bp
GATA1-gDNA-R4 TAGAGTCCGCAAGCATTACACA
GATA1-gDNA-F5 GGAACTCAATGTGTGAACTGTC 528 bp
GATA1-gDNA-R5 CTGTTCTTGCTGGACATCTTAC

The 5 ‘unknown sequence of the GATA1 gene was obtained from the existing gDNA sequence using the Genome Walking Kit (Takara, Japan) according to the manufacturer’s instructions. The gDNA sequence was confirmed by sequencing the PCR product amplified by primers (Table 4) within the 5′ unknown sequences.

Table 4.

Primers for 5′unknown sequences

Primer name Sequence (5′ → 3′) Application
GATA1-SP1 CAGAGCAAGGCTGTGGAAGTCATTT 5′- Walking PCR amplification
GATA1-SP2 GTCCTGGTTTGGAGGTTGTTTGCC
GATA1-SP3 GCTTCCACCTTTGATAGAGGCTGA
GATA1-F3 ATGGCTGTAGTGCTCATTCATCGCT verification
GATA1-R3 CAAGAGATTCACAACTATGACTGCG

Quantification of gene expression

qRT-PCR was carried out in StepOnePlus Real-Time PCR System (ABI, USA) to quantify the mRNA expression of GATA1 in different tissues, including intestine (I), liver (L), spleen (S), gills (G), middle kidney (MK), muscle (M), head kidney (HK), heart (H), brain (B), pituitarium (P), testicle (T), and ovary (O). Specific primers (Table 2) were designed for qRT-PCR. The housekeeping gene β-actin [46] (Table 5) was utilized as an internal control for cDNA normalization, and the expression level in the heart (H) was used as the baseline (1.0) for qRT-PCR.

Table 5.

Primers for others

Primer name Sequence (5′ → 3′) Application
β-actin -F GGCCTCCCTGTCTATCTTCC qRT-PCR
β-actin -R TTGAGAGGTTTGGGTTGGTC
GATA1-F4 TTTATTTCGTTGGAGGAGATC methylation sequence obtaining
GATA1-R4 CGCTATCTAAAATACTTTCCACG

To determine the effects of NP stress on GATA1 mRNA expression, the expression levels of GATA1 in different developmental stages of C. auratus red var. embryos (neuroblast stage (N), 5 somite stage (S5), 14 somite stage (S14), 21 somite stage (S21), pharyngeal stage-primordium-5 (P5), pharyngeal stage-primordium-25 (P25) and hatching stage (H)) treated with different concentrations of NP (0 μmol/L, 3 μmol/L, 5 μmol/L and 7 μmol/L) were analyzed. The housekeeping gene β-actin was used as the reference gene, and the GATA1expression level in neuroblast stage under 0 μmol/L NP stress was used as the baseline for qRT-PCR (1.0).

Three replicates were performed per sample. Expression levels of corresponding genes were calculated using the 2–△△CT method [47]. The GATA1 expression levels were measured by one-way analysis of variance, followed by Dunnett’s tests for multiple comparisons using SPSS Statistics 20 software. P < 0.05 was considered statistically significant.

Methylation of the GATA1 from C. auratus red var

The genomic DNAs in different developmental stages from the 5 μmol/L NP stress group and control group were extracted, respectively. The DNA was subjected to sulfite modification using the EZ DNA Methylation-Gold™ Kit (Zymo Research, China) according to the manufacturer’s instructions. The software Methyl Primer Express v1.0 was used to design specific primers GATA-F4 / R4 (Table 5) in the 5’UTR region of the GATA1 gene. The PCR products were purified by a Gel Extraction Kit (Omega, USA), and the purification products were ligated into pMD19-T vectors (Takara, Japan). The ligation products were then transformed into competent Escherichia coli DH5α cells (TransGen, China) and cultured at 37 °C. Positive colonies were selected and sequenced by a Bio-tech company (TIANYI HUIYUAN, China). Fifteen groups of colonies were selected for sequencing at each developmental stage. The sequencing results were sorted and methylation status was analyzed. The degree of methylation was expressed as the percentage of the methylation number of the measured CpG sites to the total number of the methylation sites measured. Correlation analysis was performed on the expression of GATA1 mRNA and the degree of methylation in the 5’UTR region of GATA1 gene using SPSS Statistics 20 software. The correlation between the two variables was showed by the correlation coefficient (r).

Supplementary Information

12863_2021_966_MOESM1_ESM.docx (129.6KB, docx)

Additional file 1 Checklist S1. Completed “The ARRIVE Guidelines Checklist” for reporting animal data in this manuscript.

Acknowledgements

We thank the laboratory members for their technical assistance and constructive comments. Work in our laboratories is supported by the Hunan University of Science and Technology, State Key Laboratory of Developmental Biology of Freshwater Fish and Pearl River Fisheries Research Institute.

Abbreviations

NP

Nonylphenol

qRT-PCR

Realtime fluorescence quantitative PCR

G

Gills

L

Liver

S

Spleen

T

Testis

P

Pituitarium

I

Intestines

MK

Middle kidney

M

Muscle

HK

Head kidney

H

Heart

B

Brain

O

Ovary

N

Neuroblast stage

S5

5 somite stage

S14

14 somite stage

S21

21 somite stage

P5

Pharyngeal stage-primordium-5

P25

Pharyngeal stage-primordium-25

H

Hatching stage

STS

Sequence Manipulation Suite

SMART

Simple Modular Architecture Research Tool

NJ

Neighbor-joining

gDNA

Genomic DNA

Authors’ contributions

YDS, DGZ and MO: initial conceptual and experimental design of the study. YST, XJC and WAC: performed the experiment, interpretation of data, key discussions on principle findings. YST and MO: wrote and edited the manuscript. All authors read and approved the final version of the manuscript.

Funding

This work was supported by the Scientific Research Project of National Natural Science Foundation of China (31873038), Hunan Provincial science and technology Department (2019NK4218, 2019JJ70038), Hunan Education Department (17A072) and State Key Laboratory of Developmental Biology of Freshwater Fish (2018KF008). Funding bodies played no role in the design of the study or analysis or interpretation of data or in writing the manuscript.

Availability of data and materials

Data and materials are available from the authors on reasonable request. The GATA1 cDNA sequence is available in the GenBank (Accession number MT322308)

Declarations

Ethics approval and consent to participate

This study was approved by the Animal Ethical Review Committee (AERC) of Hunan Normal University and followed the guidelines statement of the Administration of Affairs Concerning Animal Experimentation of China. This manuscript does not involve the use of any human data or tissue. The animals used in the study came from Hunan Normal University, and we have obtained written consent from Hunan Normal University to use these animals in our research.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Yu J, Wu J, Zhang B, Xu J. Toxic effects of nonylphenol on the organisms and its mechanism. J Environ Hygiene. 2013;3:268–272. [Google Scholar]
  • 2.Lukac N, Lukacova J, Pinto B, Knazicka Z, Tvrda E, Massanyi P. The effect of nonylphenol on the motility and viability of bovine spermatozoa in vitro. J Environ Sci. 2013;48(8):973–979. doi: 10.1080/10934529.2013.762744. [DOI] [PubMed] [Google Scholar]
  • 3.Laws SC, Carey SA, Ferrell JM, Bodman GJ, Cooper RL. Estrogenic activity of octylphenol, nonylphenol, bisphenol a and methoxychlor in rats. Toxicol Sci. 2000;54(1):154–167. doi: 10.1093/toxsci/54.1.154. [DOI] [PubMed] [Google Scholar]
  • 4.Tanaka JN, Grizzle JM. Effects of nonylphenol on the gonadal differentiation of the hermaphroditic fish, Rivulus marmoratus. Aquat Toxicol. 2002;57(3):117–125. doi: 10.1016/s0166-445x(01)00186-2. [DOI] [PubMed] [Google Scholar]
  • 5.Kawana R, Strüssmann CA, Hashimoto S. Effect of p-Nonylphenol on sperm motility in Japanese medaka (Oryzias latipes) Fish Physiol Biochem. 2003;28(1):213–214. [Google Scholar]
  • 6.Lahnsteiner F, Berger B, Grubinger F, Weismann T. The effect of 4-nonylphenol on semen quality, viability of gametes, fertilization success, and embryo and larvae survival in rainbow trout (Oncorhynchus mykiss) Aquat Toxicol. 2005;71(4):297–306. doi: 10.1016/j.aquatox.2004.11.007. [DOI] [PubMed] [Google Scholar]
  • 7.Xiao Q, Xu YY. On the effects of nonylphenol on the embryonic development of Puntius conchonius. J Saf Environ. 2010;10(6):9–12. [Google Scholar]
  • 8.Zhang QY, Sun YD, Wang ZJ, Hu XJ, Kui X. Toxic effects of Nonylphenol on the embryonic development of goldfish (Carassius auratus) Progress Modern Biomed. 2016;16:3040–3043. [Google Scholar]
  • 9.Willey JB, Krone PH. Effects of endosulfan and nonylphenol on the primordial germ cell population in pre-larval zebrafish embryos. Aquat Toxicol. 2001;54(1–2):113–123. doi: 10.1016/s0166-445x(00)00178-8. [DOI] [PubMed] [Google Scholar]
  • 10.Lü B, Zhan P. Effects of nonylphenol on brain gene expression profiles in F1 generation rats. Toxicol Environ Chem. 2009;91(3):559–565. doi: 10.1016/S0895-3988(08)60001-X. [DOI] [PubMed] [Google Scholar]
  • 11.Nair PMG, Choi J. Modulation in the mRNA expression of ecdysone receptor gene in aquatic midge, Chironomus riparius upon exposure to nonylphenol and silver nanoparticles. Environ Toxicol Pharmacol. 2012;33(1):98–106. doi: 10.1016/j.etap.2011.09.006. [DOI] [PubMed] [Google Scholar]
  • 12.Klempt M, Vobach M, Wiegand H, Preuss TG, Schäffer AKU. 353-nonylphenol induces expression of the t-box 6 gene in zebrafish embryos-linking transcriptional information with deformities. J Fish Sci. 2013;7(1):30–42. [Google Scholar]
  • 13.Robertson LS, McCormick SD. The effect of nonylphenol on gene expression in Atlantic salmon smolts. Aquat Toxicol. 2012;122-123:36–43. doi: 10.1016/j.aquatox.2012.05.009. [DOI] [PubMed] [Google Scholar]
  • 14.Meucci V, Arukwe A. The xenoestrogen 4-nonylphenol modulates hepatic gene expression of pregnane X receptor, aryl hydrocarbon receptor, CYP3A and CYP1A1 in juvenile Atlantic salmon (Salmo salar) Comparative Biochem Physiol Part C. 2006;142(1–2):142–150. doi: 10.1016/j.cbpc.2005.11.011. [DOI] [PubMed] [Google Scholar]
  • 15.Cocci P, Mosconi G. Palermo F a: effects of 4-nonylphenol on hepatic gene expression of peroxisome proliferator-activated receptors and cytochrome P450 isoforms (CYP1A1 and CYP3A4) in juvenile sole (Solea solea) Chemosphere. 2013;93(6):1176–1181. doi: 10.1016/j.chemosphere.2013.06.058. [DOI] [PubMed] [Google Scholar]
  • 16.Chan JL, Hu XX, Wang CC. Xu QH: miRNA-152 targets GATA1 to regulate erythropoiesis in Chionodraco hamatus. Biochem Biophys Res Commun. 2018;501(3):711–717. doi: 10.1016/j.bbrc.2018.05.053. [DOI] [PubMed] [Google Scholar]
  • 17.Bárbara FZ, Pavón L, Calés C. CDC6 expression is regulated by lineage-specific transcription factor GATA1. Cell Cycle. 2012;11(16):3055–3066. doi: 10.4161/cc.21471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ling T, Crispino JD, Zingariello M, Martelli F, Migliaccio AR. GATA1 insufficiencies in primary myelofibrosis and other hematopoietic disorders: consequences for therapy. Expert Rev Hematol. 2018;11(3):169–184. doi: 10.1080/17474086.2018.1436965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Galloway JL, Wingert RA, Thisse C, Thisse B, Zon LI. Loss of Gata1 but not Gata2 converts erythropoiesis to Myelopoiesis in Zebrafish embryos. Dev Cell. 2005;8(1):109–116. doi: 10.1016/j.devcel.2004.12.001. [DOI] [PubMed] [Google Scholar]
  • 20.Zetterberg E, Verrucci M, Martelli F, Zingariello M, Sancillo L, D'Amore E, Rana RA, Migliaccio AR. Abnormal P-selectin localization during megakaryocyte development determines thrombosis in the gata1 low model of myelofibrosis. Platelets. 2014;25(7):539–547. doi: 10.3109/09537104.2013.840720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wu DS. Current situation and Prospect of the standardization research and application of laboratory red Crucian carp. Lab Anim Sci. 2016;33(3):56–60. [Google Scholar]
  • 22.Lü XH, Gu Y, Song Y. Toxicity and tissue accumulation of nonylphenol in Carassius auratus red variety, Grass Carp and Sliver Carp. J Hygiene Res. 2012;41(5):785–789. [PubMed] [Google Scholar]
  • 23.Tian YS, Sun YD, Ou M, Liu YF, Cui XJ, Zhou DG, Che WA. Preliminary studies on the mechanism of nonylphenol-induced malformation of Carassius auratus red var. J Fish China. 2020;44(10):1619–1636. [Google Scholar]
  • 24.Lowry JA, Atchley WR. Molecular evolution of the GATA family of transcription factors: conservation within the DNA-binding domain. J Mol Evol. 2000;50(2):103–115. doi: 10.1007/s002399910012. [DOI] [PubMed] [Google Scholar]
  • 25.Ito E, Toki T, Ishihara H, Ohtani H, Gu L, Yokoyama M, Engel JD, Yamamoto M. Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis. Nature. 1993;362(6419):466–468. doi: 10.1038/362466a0. [DOI] [PubMed] [Google Scholar]
  • 26.Yomogida K, Ohtani H, Harigae H, Ito E, Nishimune Y, Engel JD, Yamamoto M. Developmental stage- and spermatogenic cycle-specific expression of transcription factor GATA-1 in mouse Sertoli cells. Development. 1994;120(7):1759–1766. doi: 10.1242/dev.120.7.1759. [DOI] [PubMed] [Google Scholar]
  • 27.Thomas RL, Crawford NM, Grafer CM, Zheng W, Halvorson LM. GATA augments GNRH-mediated increases in Adcyap1 gene expression in pituitary gonadotrope cells. J Mol Endocrinol. 2013;51(3):313–324. doi: 10.1530/JME-13-0089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Miyeon C, Wang SE, Ko SY, Kang HJ, Chae SY, Lee SH, Kim YS, Duman RS, Hyeon S. Overexpression of human GATA-1 and GATA-2 interferes with spine formation and produces depressive behavior in rats. PLoS One. 2014;9(10):e109253. doi: 10.1371/journal.pone.0109253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ye K. Preliminary studies on expression patterns and functional analysis of GATA factors in Nile tilapia. Chongqing: Southwest University; 2012. [Google Scholar]
  • 30.Kwan W, North TE. Netting novel regulators of hematopoiesis and hematologic malignancies in Zebrafish. Curr Top Dev Biol. 2017;124:125–160. doi: 10.1016/bs.ctdb.2016.11.005. [DOI] [PubMed] [Google Scholar]
  • 31.Zhang YJ, Mao BY. Developmental expression of an Amphioxus (Branchiostoma belcheri) gene encoding a GATA transcription factor. Zool Res. 2009;30(2):137–143. [Google Scholar]
  • 32.Martyn U, Merker SS. The ventralized ogon mutant phenotype is caused by a mutation in the zebrafish homologue of sizzled, a secreted frizzled-related protein. Dev Biol. 2003;260(1):58–67. doi: 10.1016/s0012-1606(03)00221-5. [DOI] [PubMed] [Google Scholar]
  • 33.Bauer H, Lele Z, Rauch GJ, Geisler R, Hammerschmidt M. The type I serine/threonine kinase receptor Alk8/lost-a-fin is required for Bmp2b/7 signal transduction during dorsoventral patterning of the zebrafish embryo. Development. 2001;128(6):849–858. doi: 10.1242/dev.128.6.849. [DOI] [PubMed] [Google Scholar]
  • 34.Kim JH, Park JB, Lee JY, Kim J. PV.1 suppresses the expression of FoxD5b during neural induction in Xenopus embryos. Mol Cell. 2014;37(3):220–225. doi: 10.14348/molcells.2014.2302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Shibata K, Ishimura A, Maéno M. GATA-1 inhibits the formation of notochord and neural tissue inXenopusEmbryo. Biochem Biophys Res Commun. 1998;252(1):241–248. doi: 10.1006/bbrc.1998.9490. [DOI] [PubMed] [Google Scholar]
  • 36.Sun ZX, Kang K, Cai YJ, Zhang JQ, Zhai YF, Zeng RS, Zhang WQ. Transcriptional regulation of the vitellogenin gene through a fecundity-related single nucleotide polymorphism within a GATA-1 binding motif in the brown planthopper, Nilaparvata lugens. Insect Mol Biol. 2018;27(3):365–372. doi: 10.1111/imb.12378. [DOI] [PubMed] [Google Scholar]
  • 37.Lee KW, Hwang DS, Rhee JS, Ki JS, Park HG, Ryu JC, Raisuddin S, Lee JS. Molecular cloning, phylogenetic analysis and developmental expression of a vitellogenin (Vg) gene from the intertidal copepod Tigriopus japonicus. Comp Biochem Physiol B: Biochem Mol Biol. 2008;150(4):395–402. doi: 10.1016/j.cbpb.2008.04.009. [DOI] [PubMed] [Google Scholar]
  • 38.Tomomasa Y, Satoru T, Naomi M, Takashi K, Masatsugu E, Asami W, Ritsuko S, Osamu O, Motomih O, Hitoshi O. Characterization of GATA-1+ hemangioblastic cells in the mouse embryo. EMBO J. 2007;26(1):184–196. doi: 10.1038/sj.emboj.7601480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Fujiwara Y, Chang AN, Williams AM, Orkin SH. Functional overlap of GATA-1 and GATA-2 in primitive hematopoietic development. Blood. 2003;103(2):583–585. doi: 10.1182/blood-2003-08-2870. [DOI] [PubMed] [Google Scholar]
  • 40.Salvaing J, Peynot N, Bedhane MN, Veniel S, Pellier E, Boulesteix C, Beaujean N, Daniel N, Duranthon V. Assessment of ‘one-step ‘versus’ sequential’ embryo culture conditions through embryonic genome methylation and hydroxymethylation changes. Hum Reprod. 2016;31(11):2471–2483. doi: 10.1093/humrep/dew214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Stefano LD, Ji JY, Moon NS, Herr A, Dyson N. Mutation of Drosophila Lsd1 disrupts H3-K4 methylation, resulting in tissue-specific defects during development. Curr Biol. 2007;17(9):808–812. doi: 10.1016/j.cub.2007.03.068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Samira IR, Mohamed AK, Rita K, Thierry B, Guérin JF, Annick L. Analysis of H19 methylation in control and abnormal human embryos, sperm and oocytes. Eur J Hum Genet. 2011;19(11):1138–1143. doi: 10.1038/ejhg.2011.99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Feng Y, Zhao LZ, Hong L, Shan C, Shi W, Cai W. Alteration in methylation pattern of GATA-4 promoter region in vitamin A-deficient offspring's heart. J Nutr Biochem. 2013;24(7):1373–1380. doi: 10.1016/j.jnutbio.2012.11.005. [DOI] [PubMed] [Google Scholar]
  • 44.Okada Y, Sakaue H, Nagare T, Kasuga M. Diet-induced up-regulation of gene expression in adipocytes without changes in DNA methylation. Kobe J Med Sci. 2009;54(5):241–249. [PubMed] [Google Scholar]
  • 45.Milenkovic D, Berghe WV, Boby C, Leroux C, Declerck K, Szic KS, Heyninck K, Laukens K, Bizet M, Defrance M, et al. Dietary Flavanols modulate the transcription of genes associated with cardiovascular pathology without changes in their DNA methylation state. PLoS One. 2014;9(4):e95527. doi: 10.1371/journal.pone.0095527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wang JS, Wei YH, Li XM, Cao H, Xu MQ, Dai JY. The identification of heat shock protein genes in goldfish (Carassius auratus) and their expression in a complex environment in Gaobeidian Lake, Beijing, China. Comparative Biochem Physiol Part C. 2007;145(3):350–362. doi: 10.1016/j.cbpc.2007.01.018. [DOI] [PubMed] [Google Scholar]
  • 47.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2–△△CT method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12863_2021_966_MOESM1_ESM.docx (129.6KB, docx)

Additional file 1 Checklist S1. Completed “The ARRIVE Guidelines Checklist” for reporting animal data in this manuscript.

Data Availability Statement

Data and materials are available from the authors on reasonable request. The GATA1 cDNA sequence is available in the GenBank (Accession number MT322308)


Articles from BMC Genomic Data are provided here courtesy of BMC

RESOURCES