Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 May 1.
Published in final edited form as: Ticks Tick Borne Dis. 2021 Jan 19;12(3):101659. doi: 10.1016/j.ttbdis.2021.101659

A New Genetic Approach to Distinguish Strains of Anaplasma phagocytophilum that Appear Not to Cause Human Disease

Dionysios Liveris 1, Maria E Aguero-Rosenfeld 2,8, Thomas J Daniels 3, Sandor Karpathy 4, Christopher Paddock 4, Sahar Adish 5, Felicia Keesing 6, Richard S Ostfeld 5, Gary P Wormser 7, Ira Schwartz 1,7
PMCID: PMC7979512  NIHMSID: NIHMS1664480  PMID: 33497885

Abstract

Genetic diversity of Anaplasma phagocytophilum was assessed in specimens from 16 infected patients and 16 infected Ixodes scapularis ticks. A region immediately downstream of the 16S rRNA gene, which included the gene encoding SdhC, was sequenced. For the A. phagocytophilum strains from patients no sequence differences were detected in this region. In contrast, significantly fewer ticks had a sequence encoding SdhC that was identical to that of the human strains (11/16 vs. 16/16, p=0.04). This variation is consistent with the premise that not all A. phagocytophilum strains present in nature are able to cause clinical illness in humans. A strain referred to as A. phagocytophilum Variant 1 that is regarded as non-pathogenic for humans was previously described using a different typing method. Data from the current study suggest that both typing methods are identifying the same non-pathogenic strains.

Keywords: Human granulocytic anaplasmosis, Anaplasma phagocytophilum, Lyme disease, Tick-borne infection, Molecular typing

INTRODUCTION

Anaplasma phagocytophilum is an emerging tick-borne pathogen of humans responsible for the infection referred to as human granulocytic anaplasmosis (HGA). The infection was first discovered in patients in 1994 (Bakken et al., 1994; Chen et al., 1994). Over time, it became clear that not all strains of A. phagocytophilum found in Ixodes scapularis ticks or in animals were associated with symptomatic infections in humans. Based on sequence data of a portion of the 16S rRNA gene, information emerged that strains causing clinical illness in humans could be distinguished from strains that did not. The human pathogen has been referred to as A. phagocytophilum-human active (Ap-ha), whereas the recognized non-pathogenic strain is referred to as A. phagocytophilum-Variant 1 (Ap-V1) (Massung et al., 1998, 2002b).

This study conducted in part prior to the recognition of the 16S rRNA gene strain differences similarly found apparent genetic differences among strains of A. phagocytophilum that appeared to correlate with human pathogenicity, but using a different genetic marker. Although the original isolates and/or DNA from our experiments are no longer available, we have recently examined other A. phagocytophilum strains that had been identified as Ap-V1 based on the 16S rRNA sequence and demonstrate that they can also be identified as Ap-V1 by the alternative genetic approach described in this report.

Materials and Methods

Sample Sources and DNA Isolation.

EDTA-treated whole-blood samples were collected from 16 different patients with HGA from the lower Hudson Valley region (LHV) of New York State (Joseph et al., 2011) between 1995 and 1998 (phase 1 of the study). All study subjects provided written informed consent prior to sample collection, in accordance with the research protocol approved by the Institutional Review Board of New York Medical College (NYMC-L4127).

The clinical and laboratory features for some of these patients have been reported elsewhere (Aguero-Rosenfeld et al., 1996, 2000). Blood samples were stored at 4°C and processed for DNA isolation within 72 hours. Adult I. scapularis ticks were collected in the summer and fall of 1995 at several field sites in the LHV of New York State. Tick specimens were preserved in 70% ethanol until dissection and DNA extraction. Anaplasma phagocytophilum clinical isolates were propagated in HL-60 promyelocytic leukemia cells, as previously described (Heimer et al., 1997). The term "strain" in this report refers to organisms identified in in vitro culture, as well as to those organisms identified directly in ticks or patient samples; strain similarity was assessed based on DNA sequencing.

DNA was prepared from 0.2 ml aliquots of patient whole blood or from 1.0 ml of HL-60 cell cultures using the Isoquick DNA extraction kit (ORCA Research, Bothell, WA), according to the manufacturer’s directions. Final DNA pellets were suspended in 50 ul of sterile water, and 10 ul were used for PCR. Individual ticks were removed from 70% ethanol and minced with a sterile 18G needle. DNA was extracted using the Isoquick kit, as previously described (Schwartz et al., 1997). Anaplasma phagocytophilum strain MRK DNA was extracted from IFA slides containing infected horse leukocytes obtained from the University of California, Irvine.

PCR amplification.

The sequences of all PCR primers used in this study are listed in Table 1. A portion of the heat shock operon, including the 3’end of groES, an intergenic spacer and the 5’ end of groEL, was amplified by a nested PCR procedure as previously described (Sumner et al., 1997), using primers HS1 and HS6 in the first-round PCR and HS43 and HS45 in the second-round PCR.

Table 1.

Primers used for PCR amplification

Designation Nucleotide sequence
HS1 TGGGCTGGTA(A/C)TGAAAT
HS6 CCICCIGGIACIA(C/T)ACCTTC
HS43 AT(A/T)GC(A/T)AA(G/A)GAAGCATAGTC
HS45 ACTTCACG(C/T)(C/T)TCATAGAC
16SUniF GAAGTCGTAACAAGG
16SNF GTAGGTGAACCTGCGG
23SNR CCAGTGTAAAATACTCTTTCC
23SUniR GCCAAGGCATCCACC
ER5-3 TTGAGAGTTTGATCCTGG
ER-R1 GGAGGTAATCCAGCCGCA
Ap-F1 TCCTGGCTCAGAACGAACG
Ap-R1 CCTACAGCTACCTTGTTACG
Open in a new tab

A DNA region located immediately downstream from 16S rRNA gene was amplified in a nested PCR reaction protocol employing primers 16S UniF/23S UniR in the first reaction and primers 16S NF/23S NR in the second round (Table 1). The first-round amplification used 10 ul of DNA template in a 50 ul total volume, containing 10 mM Tris-HCl, 1.5 mM MgCl2, 50 mM KCl (pH 8.3), 100 mM of each of the four deoxyribonucleotides (dNTPs), 1.5 U of Taq polymerase and 30 pmol of each primer. 1 ul of the primary PCR reaction was used as the template for the second-round PCR in a total volume of 50 ul. Cycling conditions for both first- and second-round PCR consisted of an initial 2-min denaturation at 94°C followed by 35 cycles of denaturation at 94°C for 30s, annealing at 52°C for 30s, and extension at 72°C for 30s. PCR products were visualized by UV illumination of ethidium bromide-stained 1% agarose gels after their resolution by electrophoresis in TBE buffer.

DNA cloning and sequencing.

PCR products were incubated with T4 DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN) to convert termini to blunt ends and cloned into the plasmid vector pT7Blue-3 (Novagen, Madison,WI). Recombinant clones were obtained by blue/white selection and were verified by PCR amplification of individual colonies. Three clones of each PCR product were randomly selected for DNA sequencing. Plasmid DNA was purified by using the QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany), and sequencing was performed at Genewiz, Inc. (South Plainfield, NJ).

In phase 2 of this study the DNA region located immediately downstream from the 16S rRNA gene of 3 additional tick-derived strains of A. phagocytophilum was evaluated as described above. All 3 strains had previously been identified as Ap-V1 (Keesing et al., 2014). Two of the 3 ticks had been collected in the LHV of New York State (from Dutchess County) in 2009. An isolate of A. phagocytophilum Ap-V1 (MN-61–2) that had been found in an I. scapularis tick collected in Minnesota in 2003 (Massung et al., 2007) was similarly investigated. To reconfirm that these strains were in fact Ap-V1 based on the Massung classification system, the 5’-end of the 16S rRNA gene was amplified by nested PCR using primers ER5–3 and ER-R1 for the first round of PCR and Ap-F1 and Ap-R1 (Table 1) for the second round (Inayoshi et al., 2004). First round PCR reaction mixtures contained 5 ul of tick DNA, 10 pM of each primer, 0.2 mM of deoxynucleoside triphosphate mixture, 1.25 unit of Taq polymerase and 1.5 mM MgCl2 in a final volume of 25 ul. The PCR conditions were 1 cycle of denaturation for 3 minutes at 94°C, followed by 38 cycles consisting of 1-minute denaturation at 94°C, 1-minute annealing at 58°C and 1-minute extension at 72°C. Second round PCR was conducted with 1 ul of the first round PCR product as template DNA in a reaction mixture and under the same cycling conditions as for round one.

Nucleotide sequence analysis.

In phase 2 of the study, A. phagocytophilum sequences were downloaded from the NCBI Genome database (https://www.ncbi.nlm.nih.gov/genome/genomes/1083). Open reading frame analysis was performed using ORF Finder on the NCBI web site (https://www.ncbi.nlm.nih.gov/orffinder/). Multiple sequence alignments were performed with MUSCLE (http://www.phylogeny.fr). Nucleotide sequences for A. phagocytophilum strains Ap-tick73, Ap-MN, Ap-V01 and Ap-NYMC1 have been deposited in GenBank with accession numbers MW424439—MW424442, respectively.

RESULTS

Sequence of A. phagocytophilum groESL in clinical specimens.

In phase 1, specimens were obtained from patients seen at the Lyme Disease Diagnostic Center located in the LHV of New York State before the year 2000 and from ticks collected in the LHV, also before the year 2000. The sequence of a portion of the groESL operon was amplified by nested PCR from 16 A. phagocytophilum strains associated with infection in 16 different patients with HGA (6 cultured isolates and 10 strains identified in whole blood samples) and from the A. phagocytophilum strains identified in 16 infected I. scapularis ticks (Sumner et al., 1997). All specimens yielded the expected 480 bp product. Except for single nucleotide changes in two of the 16 tick strains, DNA sequences for all 32 samples were invariant and identical to that of Ehrlichia sp., HGE agent (GenBank accession # U96728).

Sequence of a region immediately downstream from the 16S rRNA gene in HGA patient specimens.

Ribosomal RNA genes in most eubacteria are located within operons containing tandem 16S and 23S rRNA genes separated by an intergenic spacer of variable length (Srivastava and Schlessinger, 1990). The sequences within these spacers accumulate nucleotide changes at a higher rate than the surrounding genes, and this region has been extensively used for bacterial strain differentiation (Gurtler and Stanisich, 1996; Li et al., 2009). We reasoned that this region would be an appropriate target for delineating possible genomic variation among A. phagocytophilum strains. This region was amplified for 6 patient isolates cultured in HL60 cells by use of broad-specificity PCR primers derived from highly conserved sequences at the 3’ end of 16S rRNA gene and the 5’ end of 23S rRNA gene (16SUniF and 23SUniR, Table 1). Subsequent to the time that the sequencing studies described here were performed, Massung et al (2002a) reported that the A. phagocytophilum 16S rRNA and 23S rRNA genes are present in single copy and separated by at least 11 kB, consistent with the rRNA gene arrangement in other Rickettsia species (Andersson et al., 1995, 1999). Whole genome sequencing of A. phagocytophilum isolates since then has revealed that these genes are in fact separated by substantially greater distances (>0.5 Mb). Despite this, PCR amplification of specimens with the broad-specificity eubacterial primers described above resulted in a product of 566 bp, whereas no such product was amplified from uninfected HL-60 cell cultures (Figure 1). This unexpected finding is apparently due to the fortuitous presence of a 9-nucleotide sequence in the A. phagocytophilum genome located 513 bp downstream of the 3’-end of the 16S RNA gene (GGTGGATGC) that is a perfect complement to the terminal 9 nucleotides of the 23S UniR primer (Table 1).

Figure 1. Sequence of A. phagocytophilum rrs-sdhc region.

Figure 1.

Open in a new tab

The 566 bp sequence shown was amplified using broad-specificity eubacterial primers. Positions of PCR primers 16SNF and 23SNR are indicated, and amplication using these primers resulted in a 539 bp product. The 3’ end of the 16S rRNA gene is indicated by a downward arrow. The SdhC coding region is indicated by forward and reverse arrows.

The amplified products were cloned, and three random clones were selected and sequenced for each isolate. Based on these sequences a second set of primers designated as 16SNF and 23SNR (Table 1) were chosen for use in a nested PCR reaction. PCR amplification with this primer pair resulted in products of 539 bp from all 6 cultured isolates (Figure 1). This nested PCR protocol facilitated amplification of the equivalent region directly from the blood of patients with HGA. In testing 10 infected blood specimens, a 539 bp product was also produced from each of the specimens. DNA sequencing of the products obtained from all 16 HGA patient specimens revealed identical sequences in all samples. The sequence for one of these strains was employed in the analyses described below and designated as Ap-NYMC1.

Sequence analysis of the region immediately downstream from the 16S rRNA gene in field-collected ticks.

The 539 bp sequence of the region immediately downstream of the A. phagocytophilum 16S rRNA gene (hereafter also referred to as the rrs-sdhc region) was determined for the A. phagocytophilum strains found in the 16 infected ticks described above. Eleven of these ticks (68.8%) were infected with an A. phagocytophilum strain containing a 16S rRNA downstream sequence identical to that found in the patient-derived specimens. This sequence that was found in all of the A. phagocytophilum clinical samples and in these 11 ticks was designated as rrs-sdhc type 1.

The 5 remaining ticks of the 16 studied (31.2%; 95% CI: 11.0%-58.7%) harbored an A. phagocytophilum strain with a sequence that varied at 10 nucleotide positions from that found in the clinical specimens. Interestingly, 9 of the 10 changes occurred in an open reading frame encoding SdhC located within this sequence. Only 4 of these 9 changes, however, result in a non-synonymous codon change that would give rise to an amino acid replacement. Because the sequence in these 5 A. phagocytophilum tick samples differed from that of the human samples, it was designated as rrs-sdhc type 2; of note, all 5 of these tick strains had identical type 2 sequences. The rrs-sdhc sequence from one of these tick strains was employed in subsequent analyses and is designated Ap-tick73 (Figure 2A).

Figure 2. A) Nucleotide sequences of rrs-sdhc region for selected A. phagocytophilum strains.

Figure 2.

Open in a new tab

Sequences determined in the present study (Ap-NYMC1, Ap-tick73, Ap-MN, Ap-V01) were compared with a human-derived sequence, Ap-Webster, that was downloaded from the NCBI Genome database (GCA_000964685.1). The human-derived sequences (Ap-Webster and Ap-NYMC1) are classified as rrs-sdhc type 1 and the remainder are classified as rrs-sdhc type 2 strains. Shown is a 503 bp sequence of the rrs-sdhc region, rather than the 539 bp sequence, as a high quality 3’-end sequence from Ap-V01 was not obtained beyond this point. Sequences were aligned using MUSCLE v. 3.8.31. An asterisk below the sequence blocks indicates the identical nucleotide in all 5 sequences. B) Alignment of SdhC sequences for selected A. phagocytophilum strains. Sequences were aligned using MUSCLE v. 3.8.31. Identical amino acid residues are indicated by an asterisk and conservative or non-conservative changes are indicated by a colon or a period, respectively.

The region immediately downstream of the A. phagocytophilum 16S rRNA gene contains an open reading frame.

Analysis of the rrs-sdhc region in the A. phagocytophilum strains revealed a 384 bp open reading frame (ORF) beginning 93 nucleotides downstream of the putative 3’ end of 16S rRNA gene. This sequence would encode a protein of 127 amino acids. As reported previously by other investigators using other A. phagocytophilum strains, this ORF encodes SdhC, the cytochrome B560 subunit of succinate dehydrogenase (Massung et al., 2002a, 2008). The SdhC coding regions for the rrs-sdhc type 1 (Ap-NYMC1) and type 2 (Ap-tick73) A. phagocytophilum strains studied in phase 1 were of identical size with just 4 amino acid differences between the 2 deduced sequences (Figure 2B). All strains that were designated as rrs-sdhc type 2 would have been classified as type 2 even if only the sdhC gene had been sequenced.

Comparison of the rrs-sdhc regions among sequenced A. phagocytophilum strains.

The phase 1 molecular and sequencing studies of the described clinical and tick specimens were performed in 2001. Subsequent to this, whole genome sequences for multiple A. phagocytophilum isolates have been determined and deposited in the NCBI genome database (https://www.ncbi.nlm.nih.gov/genome/genomes/1083). Four of those that were deposited are fully assembled, and the remainder were deposited as partially assembled scaffolds. Sequence variation in the rrs-sdhc region was assessed for the 7 available A. phagocytophilum genome sequences from the NCBI genome database from strains that had been found in humans. Of note, the rrs-sdhc type 1 nucleotide sequence found in the 16 human strains evaluated in the current study is identical to that found for the 7 human strains in the NCBI Genome database (data not shown). The identical sequence was also present in 4 of the A. phagocytophilum strains in the database that were found in domestic animals or wildlife (JM, Dog2, Annie, CR1007), although this sequence was not found in 2 other domestic animal-derived strains. Of note, although several A. phagocytophilum genome sequences in the NCBI database from tick and domestic animal sources contain a variant rrs-sdhc region from that found in infected humans, none is a close match to the Ap-tick73 (rrs-sdhc type 2) tick-derived sequence identified in phase 1 of the present study (data not shown).

Massung et al. (2002b) originally described several A. phagocytophilum variant strains obtained from ticks based on sequence differences in the 5’ region of the 16S rRNA gene, and these were designated as Ap-V1. As noted above, the phase 1 PCR and sequencing experiments of the clinical and tick strains of A. phagocytophilum reported here were performed over 20 years ago, and no isolates or DNA from the A. phagocytophilum strains which had been evaluated at that time point were still available. This precluded our ability to directly determine the sequence in the 5’-end of 16S rRNA for these strains. Instead, molecular analysis of 3 previously documented Ap-V1 strains (one from Minnesota [designated here as Ap-MN] and two from the LHV of New York) was performed in order to determine if our typing system would also classify these strains as rrs-sdhc type 2, as described above. As the original Ap-V1 designation for these 3 tick strains of A. phagocytophilum was based on 16S rRNA sequences, we re-sequenced the 16S rRNA gene of all 3 strains and confirmed that they contained the 2 nucleotide changes (A76G, G84A) consistent with the Ap-V1 designation (Massung et al., 2002b). As expected, the 3 tick strains previously identified as Ap-V1 had nucleotide changes in the rrs-sdhc region that were inconsistent with rrs-sdhc type 1, and therefore all 3 were classified as rrs-sdhc type 2 (Figures 2A, B). It should be noted that both rrs-sdhc type 2 sequences from the New York ticks were identical; therefore,only one of these (Ap-V01) is shown in the nucleotide and amino acid alignments (Figures 2A, B).

DISCUSSION

Most of the experiments described in this report were carried out in 2000–2001 and designated as phase 1. At that time, the heat shock operon was in common use for PCR detection and phylogenetic analysis of members of the genus Ehrlichia (Sumner et al., 1997, 2000; Chae et al., 2000). Therefore, a nested PCR assay (Sumner et al., 1997) directed at the heat shock operon was used in the present study to detect the presence of A. phagocytophilum in patients and in field-collected ticks, both from the LHV of New York State. A striking feature of the data is the nearly complete sequence conservation within a 480 bp portion of the groESL operon in all 16 infected human clinical samples and in all 16 infected I. scapularis ticks. Very high sequence conservation in the groESL region among A. phagocytophilum strains has also been noted by others (Sumner et al., 1997; Chae et al., 2000), but this locus does not capture the full extent of variation among A. phagocytophilum strains (Dugat et al., 2015).

Based on our phase 1 study findings, the region immediately downstream of the 16S rRNA gene (referred to as the rrs-sdhc region) harbored two distinct sequence variants. All patient-derived sequences were identical (designated as rrs-sdhc type 1), but only 11 of the 16 tick-derived sequences from the phase 1 study were identical to the patient-derived sequences at this gene site (16/16 vs 11/16, p=0.04, by Fisher’s exact test). An identical patient-derived sequence was also present in all 7 human-derived A. phagocytophilum genome sequences found in the NCBI Genome database. The tick-derived sequences that differed from the sequences found in patients was designated as rrs-sdhc type 2.

SdhC is an integral membrane protein that serves as the anchor for the catalytic subunit of the succinate dehydrogenase complex (Cecchini et al., 2002). Massung et al. (2002a, 2008) reported that the gene encoding SdhC is located downstream of the 16S rRNA gene and is co-transcribed with it. The extensive variation in this region suggests that it is not under the same selective pressure as the adjacent 16S rRNA gene. Of interest, the lack of sequence variation among the patient-derived strains at two distinct genetic loci (SdhC and 16S rRNA) suggests that A. phagocytophilum was recently introduced into the human pathogen pool.

The existence of A. phagocytophilum genotypic variants was first reported by Massung et al. (1998, 2002a) based on 16S rRNA gene sequences. Significantly, all human-derived A. phagocytophilum sequences were identical, whereas varying percentages of tick-derived sequences represented a variant (Ap-V1) considered non-pathogenic for humans (Massung et al., 2002b; Keesing et al., 2014). Ap-V1 is also unable to infect the human tissue culture cell line HL-60 (Massung et al., 2007). The Ap-V1 variant is consistently characterized by the same two SNPs at positions 76 and 84 in the 16S RNA gene sequence relative to the human-derived A. phagocytophilum sequences. In phase 2 of the present study, we extended the analysis of the 5’-end of the 16S rRNA gene and identified an additional nucleotide change at position 609 in the 3 strains of Ap-V1 that were evaluated.

Analysis of the 384 bp ORF encoding SdhC alone is adequate to distinguish strains of A. phagocytophilum that are pathogenic for humans from those that are not. The sdhC sequence in the 16 human-derived strains of A. phagocytophilum and the 11 tick strains classified as rrs-sdhc type 1 in this study were identical. In the 5 tick strains classified as rrs-sdhc type 2, there were 9 SNPs in this region compared with the human strains. All 3 Ap-V1 strains studied in phase 2 had at least 11 SNPs (range 11 to 12 in number) in this region compared with the human-derived rrs-sdhc type 1 strains we analyzed.

Based on sequencing the region immediately downstream of the 16S rRNA gene (the rrs-sdhc region), which included a sequence encoding SdhC, we have shown that Ap-ha can be distinguished from Ap-V1. Since the description of strain variation based on the 16S rRNA gene sequence, several other genetic regions besides sdhC have been investigated for their utility in differentiating strains of A. phagocytophilum that are pathogenic for humans versus those that are non-pathogenic, such as on the p44ESup1 gene upstream from the msp2/p44 expression site on the same polycistronic mRNA transcript (Morissette et al., 2009; Barbet et al., 2013; Al-Khedery and Barbet, 2014).

In conclusion, the current study adds to a body of data indicating that there is substantial A. phagocytophilum strain diversity in nature, but only a limited subset of strains have been associated with clinical illness in humans. Whether the apparently non-pathogenic strains in general, or those specifically identified in this study, can result in asymptomatic, self-resolving infections in humans is unclear (Matei et al., 2019). In addition, further studies should be conducted to confirm our findings using a larger sample size. Additional studies should also be performed to determine if the findings pertain to strains of A. phagocytophilum causing infection in other geographic areas of the United States, as well as in Europe. Furthermore, the biologic explanation, or explanations, for non-pathogenicity still remains to be elucidated.

ACKNOWLEDGMENTS

This work was supported by the National Institutes of Health grant AR41511, grant C-015087 from the New York State Department of Health Tick-Borne Disease Institute and a grant from the Westchester County Department of Health. We thank Shobha Varde, Joseph Wu, T.-C. Hsieh, Jobby Jacobs, Mehdi Baluch and Fatemeh Kalantarpour for their participation in various aspects of this work and Rob Massung for providing unpublished DNA sequence information.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Disclosures: Dr. Wormser reports receiving research grants from Institute for Systems Biology and Pfizer, Inc. He owns equity in Abbott/AbbVie; has been an expert witness in malpractice cases involving Lyme disease and babesiosis; and is an unpaid board member of the American Lyme Disease Foundation. None of the other authors report any disclosures. The findings described herein are those of the authors and do not necessarily represent the official position of the U.S. Department of Health and Human Services.

author comment

This is a revision of manuscript TTBDIS-D-20-00033R1. All reviewer suggestions and comments have been made. In response to the reviewer, two figures have been added to the revised manuscript.

REFERENCES

  1. Aguero-Rosenfeld ME, Horowitz HW, Wormser GP, McKenna DF, Nowakowski J, Munoz J, Dumler JS, 1996. Human granulocytic ehrlichiosis: a case series from a medical center in New York State. Ann. Intern. Med. 125, 904–908. 10.7326/0003-4819-125-11-199612010-00006 [DOI] [PubMed] [Google Scholar]
  2. Aguero-Rosenfeld ME, Kalantarpour F, Baluch M, Horowitz HW, McKenna DF, Raffalli JT, Hsieh T, Wu J, Dumler JS, Wormser GP, 2000. Serology of culture-confirmed cases of human granulocytic ehrlichiosis. J. Clin. Microbiol. 38, 635–638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Al-Khedery B, Barbet AF, 2014. Comparative genomics identifies a potential marker of human-virulent Anaplasma phagocytophilum. Pathogens. 3, 25–35. 10.3390/pathogens3010025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Andersson SG, Stothard DR, Fuerst P, Kurland CG, 1999. Molecular phylogeny and rearrangement of rRNA genes in Rickettsia species. Mol. Biol. Evol. 16, 987–995. 10.1093/oxfordjournals.molbev.a026188 [DOI] [PubMed] [Google Scholar]
  5. Andersson SG, Zomorodipour A, Winkler HH, Kurland CG, 1995. Unusual organization of the rRNA genes in Rickettsia prowazekii. J. Bacteriol. 177, 4171–4175. 10.1128/jb.177.14.4171-4175.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bakken JS, Dumler JS, Chen SM, Eckman MR, Van Etta LL, Walker DH, 1994. Human granulocytic ehrlichiosis in the upper Midwest United States. A new species emerging? JAMA. 272, 212–218. [PubMed] [Google Scholar]
  7. Barbet AF, Al-Khedery B, Stuen S, Granquist EG, Felsheim RF, Munderloh UG, 2013. An emerging tick-borne disease of humans is caused by a subset of strains with conserved genome structure. Pathogens. 2, 544–555. 10.3390/pathogens2030544 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cecchini G, Schroder I, Gunsalus RP, Maklashina E, 2002. Succinate dehydrogenase and fumarate reductase from Escherichia coli. Biochim. Biophys. Acta. 1553, 140–157. 10.1016/s0005-2728(01)00238-9 [DOI] [PubMed] [Google Scholar]
  9. Chae JS, Foley JE, Dumler JS, Madigan JE, 2000. Comparison of the nucleotide sequences of 16S rRNA, 444 Ep-ank, and groESL heat shock operon genes in naturally occurring Ehrlichia equi and human granulocytic ehrlichiosis agent isolates from Northern California. J. Clin. Microbiol. 38, 1364–1369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen SM, Dumler JS, Bakken JS, Walker DH, 1994. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 32, 589–595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dugat T, Lagree AC, Maillard R, Boulouis HJ, Haddad N, 2015. Opening the black box of Anaplasma phagocytophilum diversity: current situation and future perspectives. Front. Cell Infect. Microbiol. 5, 61. 10.3389/fcimb.2015.00061 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gurtler V, Stanisich VA, 1996. New approaches to typing and identification of bacteria using the 16S-23S rDNA spacer region. Microbiology. 142 ( Pt 1), 3–16. 10.1099/13500872-142-1-3 [DOI] [PubMed] [Google Scholar]
  13. Heimer R, Van Andel A, Wormser GP, Wilson ML, 1997. Propagation of granulocytic Ehrlichia spp. from human and equine sources in HL-60 cells induced to differentiate into functional granulocytes. J. Clin. Microbiol. 35, 923–927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Inayoshi M, Naitou H, Kawamori F, Masuzawa T, Ohashi N, 2004. Characterization of Ehrlichia species from Ixodes ovatus ticks at the foot of Mt. Fuji, Japan. Microbiol. Immunol. 48, 737–745. 10.1111/j.1348-0421.2004.tb03599.x [DOI] [PubMed] [Google Scholar]
  15. Joseph JT, Roy SS, Shams N, Visintainer P, Nadelman RB, Hosur S, Nelson J, Wormser GP, 2011. Babesiosis in Lower Hudson Valley, New York, USA. Emerg. Infect. Dis. 17, 843–847. 10.3201/eid1705.101334 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Keesing F, McHenry DJ, Hersh M, Tibbetts M, Brunner JL, Killilea M, LoGiudice K, Schmidt KA, Ostfeld RS, 2014. Prevalence of human-active and variant 1 strains of the tick-borne pathogen Anaplasma phagocytophilum in hosts and forests of eastern North America. Am. J. Trop. Med. Hyg. 91, 302–309. 10.4269/ajtmh.13-0525 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Li W, Raoult D, Fournier PE, 2009. Bacterial strain typing in the genomic era. FEMS Microbiol. Rev. 33, 892–916. 10.1111/j.1574-6976.2009.00182.x [DOI] [PubMed] [Google Scholar]
  18. Massung RF, Hiratzka SL, Brayton KA, Palmer GH, Lee KN, 2008. Succinate dehydrogenase gene arrangement and expression in Anaplasma phagocytophilum. Gene. 414, 41–48. 10.1016/j.gene.2008.02.005 [DOI] [PubMed] [Google Scholar]
  19. Massung RF, Lee K, Mauel M, Gusa A, 2002a. Characterization of the rRNA genes of Ehrlichia chaffeensis and Anaplasma phagocytophila. DNA Cell Biol. 21, 587–596. 10.1089/104454902320308960 [DOI] [PubMed] [Google Scholar]
  20. Massung RF, Levin ML, Munderloh UG, Silverman DJ, Lynch MJ, Gaywee JK, Kurtti TJ, 2007. Isolation and propagation of the Ap-Variant 1 strain of Anaplasma phagocytophilum in a tick cell line. J. Clin. Microbiol. 45, 2138–2143. 10.1128/JCM.00478-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Massung RF, Mauel MJ, Owens JH, Allan N, Courtney JW, Stafford KC 3rd, Mather TN, 2002b. Genetic variants of Ehrlichia phagocytophila, Rhode Island and Connecticut. Emerg. Infect. Dis. 8, 467–472. 10.3201/eid0805.010251 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Massung RF, Slater K, Owens JH, Nicholson WL, Mather TN, Solberg VB, Olson JG, 1998. Nested PCR assay for detection of granulocytic Ehrlichiae. J. Clin. Microbiol. 36, 1090–1095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Matei IA, Estrada-Pena A, Cutler SJ, Vayssier-Taussat M, Varela-Castro L, Potkonjak A, Zeller H, Mihalca AD, 2019. A review on the eco-epidemiology and clinical management of human granulocytic anaplasmosis and its agent in Europe. Parasit. Vectors. 12, 599. 10.1186/s13071-019-3852-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Morissette E, Massung RF, Foley JE, Alleman AR, Foley P, Barbet AF, 2009. Diversity of Anaplasma phagocytophilum strains, USA. Emerg. Infect. Dis. 15, 928–931. 10.3201/eid1506.081610 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Schwartz I, Varde S, Nadelman RB, Wormser GP, Fish D, 1997. Inhibition of efficient polymerase chain reaction amplification of Borrelia burgdorferi DNA in blood-fed ticks. Am. J. Trop. Med. Hyg. 56, 339–342. 10.4269/ajtmh.1997.56.339 [DOI] [PubMed] [Google Scholar]
  26. Srivastava AK, Schlessinger D, 1990. Mechanism and regulation of bacterial ribosomal RNA processing. Annu. Rev. Microbiol. 44, 105–129. 10.1146/annurev.mi.44.100190.000541 [DOI] [PubMed] [Google Scholar]
  27. Sumner JW, Nicholson WL, Massung RF, 1997. PCR amplification and comparison of nucleotide sequences from the groESL heat shock operon of Ehrlichia species. J. Clin. Microbiol. 35, 2087–2092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Sumner JW, Storch GA, Buller RS, Liddell AM, Stockham SL, Rikihisa Y, Messenger S, Paddock CD, 2000. PCR amplification and phylogenetic analysis of groESL operon sequences from Ehrlichia ewingii and Ehrlichia muris. J. Clin. Microbiol. 38, 2746–2749. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES