Skip to main content
PMC home page
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2021 Mar 15;27(3):497–514. doi: 10.1007/s12298-020-00893-0

Introgression of dual abiotic stress tolerance QTLs (Saltol QTL and Sub1 gene) into Rice (Oryza sativa L.) variety Aiswarya through marker assisted backcross breeding

Meenu M Nair 1, K S Shylaraj 1,✉
PMCID: PMC7981364  PMID: 33854279

Abstract

Salinity and submergence are two very prominent abiotic stress conditions affecting rice yield adversely in the coastal agro ecosystem. Marker Assisted Backcross Breeding (MABB) is an efficient and fast track molecular tool to incorporate a desired stress tolerant QTL/gene into an improved cultivar. The present study was carried out for the introgression of Saltol QTL responsible for salinity tolerance and Sub1 gene responsible for submergence tolerance into the high yielding rice variety Aiswarya independently through MABB. Final objective of the study is to develop dual stress tolerant (tolerance to salinity and submergence) Aiswarya rice variety by pyramiding the both target QTLs introgressed BC2F2 progenies having maximum background homozygosity. The donors of Saltol QTL and Sub1 gene used in the present study were FL478 and Swarna Sub1, respectively. Based on the background genome analysis of the introgressed plants, the plants with > 85–90% background similarity were selected for pyramiding of Saltol QTL and Sub1 gene into the elite background of rice variety Aiswarya. Those selected introgressed lines with Saltol QTL and Sub1 gene will be again crossed to pyramid both Saltol QTL and Sub1 gene into the rice variety Aiswarya. Such a mega rice variety pyramided with dual stress tolerant QTLs is the expected outcome of this study and can be recommended for cultivation in the flood prone saline coastal agroecosystem.

Keywords: Marker assisted breeding, Saltol QTL, Sub1 gene, SSR markers, Salinity tolerance, Submergence tolerance

Introduction

Rice, (Oryza sativa L.) is the most important food crop in India and is the staple food for half of the world’s population and providing 30–80% of the daily calories required in Asian population (Hossain and Narciso 2002). In developing countries, rice is the principal source of calories and nutrients. Various abiotic stresses such as drought, salinity, submergence, and extreme temperature cause a threatening impact on the growth and productivity of rice (Gregorio et al. 2013). Among these, salinity and submergence are the major issues faced by farmers of coastal agroecosystem. Farmers suffer from crop losses caused by the intrusion of saline water into rice fields and occasional flash floods during the monsoon season. Submergence stress due to unexpected heavy rains adversely affected rice crops and reduced the grain yield drastically (Sarkar and Bhattacharjee 2011). Rice can be susceptible to salinity at the seedling and reproductive stages (Lutts et al. 1995). The flowering stage is also a highly sensitive stage that is affected by salinity stress (Singh et al. 2007) and yield potential at the mature stage was affected due to salinity (Todaka et al. 2012). Salinity affects yield parameters such as panicle emergence, flowering, panicle length, spikelet number per panicle, and grain yield (Thomson et al. 2010). Submergence affects many plant physiological processes such as water absorption, respiration, photosynthetic activity and substantially reduce crop productivity (Fukao et al. 2011).

Thus, to tackle this abiotic stress induced yield reductions in stress fields; a permanent and sustainable approach is required. The most viable solution is to introgress the genes for abiotic stress tolerance into already developed improved high yielding rice cultivar through MABB. It has been identified that salinity tolerance is controlled by quantitative trait locus (QTL) on chromosome 1 which is responsible for low Na+ high K+ uptake (Mohammadi et al. 2008) and submergence tolerance is controlled by quantitative trait locus (QTL) on chromosome 9 (Neeraja et al. 2007). MABB is a precise and effective method to introgress the trait of interest without altering the essential characters of elite varieties. The objective of the present study was to improve the rice cultivar Aiswarya for salinity and submergence tolerance using the MABB strategy. In this paper, the parallel introgression of Saltol QTL and Sub1 gene through MABB strategy are discussed in detail which is a pre-requisite for pyramiding of these two abiotic stress tolerance QTLs, into the rice variety Aiswarya.

Materials and methods

Rice varieties – recurrent and donor parents

The saline tolerant rice breeding line FL-478, developed at IRRI (The International Rice Research Institute 1996) was used as the donor of Saltol QTL. The donor of Sub1 gene used was the Swarna Sub1, submergence tolerant rice variety developed at International Rice Research Institute, manila, Philippines. The recurrent parent used for improvement in this study is a high yielding rice cultivar, Aiswarya, developed at the Regional Agricultural Research Station, Pattambi, which is sensitive to salinity and submergence with an average yield of 6.3—6.5 tons/ha.

Breeding scheme for Saltol QTL introgression

The recurrent parent (RP) Aiswarya and donor parent (DP) FL-478 were crossed and F1 generation was raised. In case of Saltol QTL introgression, in each generation both phenotypic screening and genotypic screening were done, and the QTL introgressed plants were advanced into next generation. In the F1 generation genotypic screening was done in the phenotypically survived plants under saline condition and plants with heterozygous loci for the target trait alone were selected and backcrossed with the respective recurrent parent and raised BC1F1 generation. The heterozygous plants with the target locus in the BC1F1 generation were again selected for backcrossing with the respective recurrent parent to raise BC2F1 progenies. The heterozygous BC2F1 plants were selected to raise BC2F2 progenies by selfing and the homozygous plants in the target locus alone were selected from the selfed BC2F2 progenies (Fig. 1). After the Phenotyping of the BC2F2 progenies the plants with Score-3 (SES, IRRI) alone were selected for genotyping. The SES is a plant score of 1–9 spectrum based on morphological manifestation/stress symptoms under stress conditions where a lower SES score shows resistance and a higher score shows a sensitive response (Table 1).

Fig. 1.

Fig. 1

Open in a new tab

Breeding scheme of Saltol QTL Introgression into mega rice variety Aiswarya, as a Recurrent Parent (RP) and Saltol- FL-478, as a Donor Parent (DP)

Table 1.

Standard evaluation system (SES) score for salinity tolerance (IRRI 1996)

Score Observation Tolerance
1 Nearly normal growth, no leaf symptoms Highly Tolerant
3 Nearly normal growth, but leaf tips or few leaves whitish and rolled Tolerant
5 Growth severely retarded; most leaves rolled; only a few are elongating Moderately Tolerant
7 Complete cessation of growth; most leaves dry; some plants dying Susceptible
9 Almost all plants dead or dying Highly Susceptible
Open in a new tab

Breeding scheme for Sub 1 gene introgression

The recurrent parent (RP) Aiswarya and donor parent (DP) Swarna Sub1 were crossed and F1 generation was raised. In case of Sub1gene introgression the screening in each generation was done by genotyping and phenotypic screening was done in the final stage. In the F1 generation genotypic screening was done and plants with heterozygous loci for the target trait alone were selected and backcrossed with the respective recurrent parent and raised BC1F1 generation. The heterozygous plants with the target locus in the BC1F1 generation were again selected for backcrossing with the respective recurrent parent to raise BC2F1 progenies. The heterozygous BC2F1 plants were selected to raise BC2F2 progenies by selfing and the homozygous plants in the target locus alone were selected from the selfed BC2F2 progenies. After the Phenotyping of the BC2F2 progenies the plants with Score-3 (SES, IRRI) alone were selected (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Breeding scheme of Sub1gene Introgression into mega rice variety Aiswarya, as a Recurrent Parent (RP) and Swarna Sub1, as a Donor Parent (DP)

DNA isolation and PCR assay

The young leaf samples were collected, and genomic DNA was extracted using CTAB method (Doyle and Doyle 1987) The concentration of DNA was measured using Nano Drop 2000c (Thermo Scientific). Target gene sequence was amplified by PCR assay, in which the total volume of reaction is 20 μl containing 2μlDNA template, 10μlPCR Master Mix (Thermo Scientific) consist of 1XTaq Buffer, Taq DNA polymerase, MgCl2, 1 μl each of reverse and forward primer along with 6 μl water. To begin the PCR program the initial denaturation temperature was raised to 95°C then annealing temperature lowered to 55–65°C and extension temperature at 72°C. The cycle of changing temperature was then repeated up to 30–35 cycles.

Quality control with electrophoresis and DNA visualization

The DNA quality was tested by 8% Polyacrylamide gel electrophoresis (PAGE). Silver stain method were used for staining gels and were visualized using Gel Doc (Bio-Rad Gel Doc XR +). Selected SSR markers were used for foreground, recombinant and background selection.

Polymorphism assay and selection of SSR markers

Simple sequence repeats are co-dominant markers which occur at high frequency and they prominent throughout the genome. SSR markers shows a high level of polymorphism between the plant varieties. A total of 545 SSR markers were screened for polymorphism between the recurrent parent and donor parents, which is narrated in Table 10.

Table 10.

Genome wide SSR markers used for parental polymorphism assay

Sl. No Primer name Chr. No Sl. No Primer name Chr. No Sl. No Primer name Chr. No
1 RM499 1 27 RM140 1 53 RM5536 1
2 RM3252 1 28 RM595 1 54 RM315 1
3 RM323 1 29 RM129 1 55 RM472 1
4 RM476A 1 30 RM113 1 56 RM431 1
5 RM10209 1 31 RM562 1 57 RM3362 1
6 RM1 1 32 RM24 1 58 RM6840 1
7 RM220 1 33 RM9 1 59 RM165 1
8 RM6289 1 34 RM5 1 60 OSR23 1
9 RM283 1 35 RM306 1 61 RM104 1
10 RM151 1 36 RM488 1 62 RM529 1
11 RM576 1 37 RM1196 1 63 RM414 1
12 RM490 1 38 RM246 1 64 RM14 1
13 RM575 1 39 RM237 1 65 RM568 1
14 RM259 1 40 RM443 1 66 RM3340 2
15 RM35 1 41 RM403 1 67 OSR17 2
16 RM243 1 42 RM128 1 68 RM154 2
17 RM583 1 43 RM543 1 69 OSR14 2
18 RM600 1 44 RM302 1 70 RM279 2
19 RM578 1 45 RM212 1 71 RM279 2
20 RM292 1 46 RM102 1 72 RM1075 2
21 RM572 1 47 RM476B 1 73 RM1347 2
22 RM580 1 48 RM486 1 74 RM8 2
23 RM312 1 49 RM226 1 75 RM555 2
24 RM23 1 50 RM265 1 76 RM174 2
25 RM81A 1 51 RM297 1 77 RM1352 2
26 RM238A 1 52 RM8236 1 78 RM71 2
79 RM1081 2 120 RM406 2 161 RM5959 3
80 RM492 2 121 RM213 2 162 RM503 3
81 RM5812 2 122 RM482 2 163 RM135 3
82 RM452 2 123 RM207 2 164 RM426 3
83 RM550 2 124 RM266 2 165 RM6135 3
84 RM438 2 125 RM498 2 166 RM532 3
85 RM5101 2 126 RM535 2 167 RM504 3
86 RM4499 2 127 RM7382 2 168 RM1221 3
87 RM465A 2 128 RM81B 3 169 RM203 3
88 RM324 2 129 RM60 3 170 RM7324 3
89 RM262 2 130 RM132 3 171 RM186 3
90 RM561 2 131 RM22 3 172 RM55 3
91 RM1303 2 132 RM523 3 173 RM168 3
92 RM341 2 133 RM569 3 174 RM448 3
93 RM5430 2 134 RM231 3 175 RM3583 3
94 RM475 2 135 RM175 3 176 RM416 3
95 RM3352 2 136 RM489 3 177 RM520 3
96 RM1385 2 137 RM545 3 178 RM293 3
97 RM1367 2 138 RM36 3 179 RM227 3
98 RM3220 2 139 OSR16 3 180 RM468 3
99 RM106 2 140 RM517 3 181 RM571 3
100 RM263 2 141 RM546 3 182 RM422 3
101 RM3275 2 142 RM218 3 183 RM422 3
102 RM526 2 143 RM3204 3 184 RM143 3
103 RM599 2 144 RM232 3 185 RM130 3
104 RM5607 2 145 RM251 3 186 RM114 3
105 RM221 2 146 RM563 3 187 RM514 3
106 RM525 2 147 RM5626 3 188 RM570 3
107 RM573 2 148 RM554 3 189 RM148 3
108 RM1092 2 149 RM282 3 190 RM442 3
109 RM5421 2 150 RM338 3 191 RM85 3
110 RM318 2 151 RM473D 3 192 RM307 4
111 RM6 2 152 RM2614 3 193 RM2146 4
112 RM3650 2 153 RM156 3 194 RM5414 4
113 RM240 2 154 RM411 3 195 RM551 4
114 RM7485 2 155 RM487 3 196 RM401 4
115 RM425 2 156 RM16 3 197 RM537 4
116 RM250 2 157 RM347 3 198 RM6770 4
117 RM1063 2 158 RM5172 3 199 RM3471 4
118 RM166 2 159 RM6213 3 200 RM5953 4
119 RM208 2 160 RM319 3 201 RM335 4
202 RM518 4 243 RM413 5 284 RM190 6
203 RM3317 4 244 RM194 5 285 RM510 6
204 RM261 4 245 RM1089 5 286 RM111 6
205 RM456B 4 246 RM5994 5 287 RM276 6
206 RM185 4 247 RM6229 5 288 RM402 6
207 RM177 4 248 RM169 5 289 RM6467 6
208 RM471 4 249 RM509 5 290 RM527 6
209 RM417 4 250 RM1237 5 291 RM5745 6
210 RM1155 4 251 RM598 5 292 RM1161 6
211 RM142 4 252 RM465C 5 293 RM6818 6
212 RM119 4 253 RM249 5 294 RM5753 6
213 RM1136 4 254 RM146 5 295 RM541 6
214 RM5320 4 255 RM39 5 296 RM1925 6
215 RM273 4 256 RM291 5 297 RM454 6
216 RM1703 4 257 RM430 5 298 RM162 6
217 RM252 4 258 RM473B 5 299 RM275 6
218 RM456A 4 259 RM1090 5 300 RM343 6
219 RM3217 4 260 RM440 5 301 RM1340 6
220 RM241 4 261 RM459 5 302 RM5814 6
221 RM1100 4 262 RM1187 5 303 RM528 6
222 RM451 4 263 RM161 5 304 RM1161 6
223 RM470 4 264 RM305 5 305 RM1150 6
224 RM303 4 265 RM173 5 306 RM30 6
225 RM317 4 266 RM534 5 307 RM340 6
226 RM5047 4 267 RM188 5 308 RM439 6
227 RM1018 4 268 RM538 5 309 RM461 6
228 RM255 4 269 RM5770 5 310 RM103 6
229 RM348 4 270 RM233B 5 311 RM494 6
230 RM349 4 271 RM6200 5 312 RM295 7
231 RM131 4 272 RM421 5 313 RM192 7
232 RM124 4 273 RM5968 5 314 RM436 7
233 RM127 4 274 RM178 5 315 RM427 7
234 RM280 4 275 RM26 5 316 RM1132 7
235 RM567 4 276 RM274 5 317 RM3555 7
236 RM559 4 277 RM87 5 318 RM125 7
237 RM153 5 278 RM480 5 319 RM1135 7
238 RM507 5 279 RM334 5 320 RM180 7
239 RM122 5 280 RM133 6 321 RM3484 7
240 RM5693 5 281 RM508 6 322 RM6111 7
241 RM5796 5 282 RM197 6 323 RM214 7
242 RM17960 5 283 RM469 6 324 RM500 7
325 RM445 7 366 RM44 8 407 RM219 9
326 RM6776 7 367 RM32 8 408 RM524 9
327 RM1362 7 368 RM72 8 409 RM342B 9
328 RM11 7 369 RM88 8 410 RM5526 9
329 RM3859 7 370 RM195 8 411 RM105 9
330 RM560 7 371 RM330B 8 412 RM321 9
331 RM182 7 372 RM350 8 413 RM1817 9
332 RM336 7 373 RM404 8 414 RM2144 9
333 RM351 7 374 RM483 8 415 RM409 9
334 RM70 7 375 RM1345 8 416 RM460 9
335 RM455 7 376 RM137 8 417 RM3912 9
336 RM1085 7 377 RM331 8 418 RM566 9
337 RM505 7 378 RM1109 8 419 RM4692 9
338 RM1134 7 379 RM1235 8 420 RM434 9
339 RM234 7 380 RM223 8 421 RM410 9
340 RM18 7 381 RM515 8 422 RM2482 9
341 RM47 7 382 RM284 8 423 RM257 9
342 RM478 7 383 RM6193 8 424 RM1896 9
343 RM118 7 384 RM556 8 425 RM3700 9
344 RM134 7 385 RM210 8 426 RM242 9
345 RM429 7 386 RM531 8 427 RM108 9
346 RM1253 7 387 RM419 8 428 RM288 9
347 RM5426 7 388 RM256 8 429 RM553 9
348 RM172 7 389 RM149 8 430 RM278 9
349 RM420 7 390 RM308 8 431 RM201 9
350 RM2381 7 391 RM230 8 432 RM160 9
351 RM248 7 392 RM433 8 433 RM107 9
352 RM408 8 393 RM1309 8 434 RM328 9
353 RM337 8 394 RM502 8 435 OSR28 9
354 RM152 8 395 RM458 8 436 RM189 9
355 RM1308 8 396 RM477 8 437 RM3164 9
356 RM1376 8 397 RM447 8 438 RM2855 9
357 RM3481 8 398 RM281 8 439 RM215 9
358 RM3262 8 399 RM264 8 440 RM1026 9
359 RM25 8 400 RM41 9 441 RM1328 9
360 RM6471 8 401 RM296 9 442 RM 245 9
361 RM5999 8 402 RM1553 9 443 RM205 9
362 RM6032 8 403 RM5799 9 444 RM6364 10
363 RM6008 8 404 RM316 9 445 RM474 10
364 RM310 8 405 RM464 9 446 RM474 10
365 RM547 8 406 RM464 9 447 RM330A 10
448 RM2504 10 489 RM552 11 530 RM277 12
449 RM216 10 490 RM116 11 531 RM27973 12
450 RM239 10 491 RM120 11 532 RM519 12
451 RM311 10 492 RM6115 11 533 RM1246 12
452 RM5689 10 493 RM479 11 534 RM313 12
453 RM1375 10 494 RM5731 11 535 RM83 12
454 RM467 10 495 RM536 11 536 RM463 12
455 RM5629 10 496 RM7303 11 537 RM1986 12
456 RM6100 10 497 RM7120 11 538 RM235 12
457 RM596 10 498 RM287 11 539 RM270 12
458 RM1108 10 499 RM209 11 540 RM1103 12
459 RM184 10 500 RM229 11 541 RM2854 12
460 RM271 10 501 RM5961 11 542 RM6396 12
461 RM6128 10 502 RM1341 11 543 RM1296 12
462 RM269 10 503 RM457 11 544 RM17 12
463 RM258 10 504 RM473E 11 545 RM1227 12
464 RM5666 10 505 RM6965 11
465 RM1374 10 506 RM206 11
466 RM171 10 507 RM254 11
467 RM304 10 508 RM456C 11
468 RM3123 10 509 RM2136 11
469 RM6016 10 510 RM6094 11
470 RM294A 10 511 RM224 11
471 RM228 10 512 RM139 11
472 RM484 10 513 RM144 11
473 RM147 10 514 RM27172 11
474 RM333 10 515 RM1880 12
475 RM496 10 516 RM2851 12
476 RM590 10 517 RM3483 12
477 RM591 10 518 RM19 12
478 RM4B 11 519 RM453 12
479 RM20B 11 520 RM247 12
480 RM286 11 521 RM117 12
481 RM26652 11 522 RM491 12
482 RM7163 11 523 RM512 12
483 RM7173 11 524 RM179 12
484 RM1240 11 525 RM415 12
485 RM1124 11 526 RM2529 12
486 RM332 11 527 RM1036 12
487 RM5704 11 528 RM3246 12
488 RM167 11 529 RM101 12
Open in a new tab

Foreground, recombinant and background selection for Saltol QTL

For the screening of Saltol QTL introgressed progenies of all generations, 7 foreground markers AP3206, SKC10, RM3412, RM8094, RM10713, RM10711, RM10772, 6 recombinant markers RM10793, RM493, RM10696, RM10701, RM1287, RM10694 and 545 genome wide SSR markers were screened between parents and then polymorphic markers were selected for genotypic screening of progenies of Aiswarya X FL-478.

Foreground, recombinant and background selection for Sub1 gene

For the screening of Sub1 gene introgression and background genome recovery 11 foreground markers which are IYT1, IYT3, AEX, Sub1A203, ART3, ART5, Sub1C173, Sub1AB1, Sub1BC1, Sub1BC2 and Sub1BC3, 16 recombinant markers RM316, RM219, RM464, RM23668, RM23679, RM8303, RM23770, RM23788, RM23778, RM23805, RM23887, RM23917, RM23922, RM23958, RM23928 and RM24005, and 545 genome wide markers were screened and evaluated. The markers which showed polymorphism between parents were selected for genotypic screening of all generations.

Analysis of molecular data

The Microsoft Excel sheet containing Saltol marker and Sub1 marker data was used and analysed in the Graphical Tools for Genotyper (GGT 2.0) (Ralph, 2008). GGT analysis software was used to measure recovery of parent genome in selected Introgressed progenies of Saltol X Sub1 lines. The alleles were scored for homozygous recipient allele, homozygous donor allele and heterozygous allele as ‘A’, ‘B’, ‘C’, respectively. So, the percentage of background genomic recovery were calculated.

Screening for salinity tolerance

Phenotypic screening at seedling stage for salinity and submergence was done. The salinity screening was done using the standard protocol SES developed at IRRI. The pre germinated seeds were sown in the holes on the float in distilled water for 3 days. FL-478 plants were used as the check and RP Aiswarya was used as susceptible check. On fourth day, distilled water was replaced with Yoshida nutrient solution having EC of 6 dS m−1 and on 7th day the Yoshida nutrient solution was replaced with fresh nutrient solution having EC of 12 dS m−1.The pH of the solution was maintained at 5.5 daily by adding either 1 N NaOH or 1 N HCL. The nutrient solution was replaced after every 7 days up to 21 days. The tolerance score was done using SES score developed at IRRI, 1996. Table 1 describes the SES score for salinity tolerance.

Screening for submergence tolerance

In screening for submergence tolerance, germinated seedlings of the selected progenies along with donor and recurrent parents were sown in pots. The experimental pots with fourteen-day old seedlings were completely submerged for 21 days in 1.5 m height tanks filled with water. The average depth of water was 90 cm and pH was 7.2. Control sets were also maintained for each of the varieties without any submergence treatment. After the completion of submergence treatment the plants were removed and 14 days after the completion of submergence treatment tolerance as per SES developed at IRRI. Table 2 describes the SES score for submergence tolerance.

Table 2.

Standard evaluation system (SES) score for submergence tolerance (IRRI 1996)

Score Percentage survival Tolerance
1 100% Minor visible symptoms
3 95–99% Some visible symptoms
5 75–94% Moderately injury
7 50–54% Severe injury
9 0–94% Complete death
Open in a new tab

Results and discussion

The MABB approach was used to introgress the Saltol QTL and Sub 1 genes into Aiswarya rice variety and is an effective and appropriate method for introgressing our gene of interest and recovering the maximum genome background of recurrent parents in progenies (Collard and Mackill 2007). The highly tolerant F1 plants were selected based on phenotyping and genotyped with selected foreground markers for confirmation, and the tolerant lines with heterozygous locus were alone selected. The selected tolerant lines in F1 and BC1F1 generations were backcrossed with recurrent parent and genotyped with foreground, recombinant and background primers. At last from the selfed BC2F2 lines having the salinity and submergence tolerance score similar to FL-478 and Swarna Sub1 with maximum recipient genotype recovery could be identified.

Parental Polymorphism Assay of Foreground, Recombinant and Background Markers

Total 545 SSR markers covering 12 chromosomes were used for the parental polymorphic screening between recurrent parent and donor parent. For salinity screening 88 polymorphic markers and for submergence screening 90 polymorphic markers were selected and used for screening of every F1, BC1F1, BC2F1 and BC2F2 generation. Foreground markers are used for efficient selection of target locus and these markers are tightly linked with the target gene (Hospital and Charcosset 1997). The recombinant markers that flank a target gene are used for eliminating the undesirable gene as quick as possible and linkage drag can be minimized (Hasan et al. 2015). Background selection involves selecting progenies with the maximum proportion of RP genome, and these markers are unlinked to the target locus. Genetic analysis of the salt tolerant rice varieties using SSR markers through molecular characterization is done (John and Shylaraj.2017). The result was verified with some other previous reports of the polymorphic markers between the parents in target region of Saltol (Niones 2004). Within the Sub1 cluster the diagnostic markers developed and microsatellite markers along the Sub1 region has been reported (Neeraja et al. 2007). Sub1 QTL was introgressed into the most popular rice variety, Jyothi, from the donor parent Swarna-Sub1 for submergence tolerance (John and Shylaraj 2017). Number of Polymorphic markers screened and used for parental screening are narrated in Table 3 below. Tables 4,5,6,7,8,9 describes the name of selected foreground, recombinant and background SSR markers. Total 545 genomewide SSR markers screened for parental polymorphism in both salinity and submergence were narrated in Table 10.

Table 3.

Polymorphic markers screened and markers used for parental screening

SSR markers screened for polymorphism Polymorphic markers selected
Salinity Submergence Salinity Submergence
1 Foreground markers 7 11 3 3
2 Recombinant markers 6 16 2 3
3 Background markers 545 545 88 90
Open in a new tab

Table 4.

Saltol SSR markers used for foreground selection

Primer Sequence Distance (mb)
AP206 F TTCTCATCGCACCATCTCTG 11.2
AP206R GGAGGAGGAGAGGAAGAAG
SKC10F ATAGGGGATATTGGCTGCAC 11.2
SKC10R CAACCAAGCGTGACTAAAAAGA
RM3412F TGATGGATCTCTGAGGTGTAAAGAGC 11.6
RM3412R TGCACTAATCTTTCTGCCACAGC
Open in a new tab

Table 5.

Saltol Polymorphic SSR markers used for Recombinant selection

Primer Sequence Distance (mb)
RM493 F GTACGTAAACGCGGAAGGTGACG 12.3
RM493R CGACGTACGAGATGCCGATCC
RM10696F CCTTCGACTCCATGAAACAAACG 10.6
RM10696R TCTCTTTGCCCTAACCCTATGTCC
Open in a new tab

Table 6.

Saltol Polymorphic SSR markers used for Background selection

Chr. No SSR markers Position (cM) Chr.No SSR markers Position (cM) Chr.No SSR markers Position (cM)
1 1196 0 4 RM 537 0 6 RM 439 117
1 RM 10209 18.8 4 RM 3471 16.7 7 RM 295 0
1 RM 600 61.30 4 RM 3317 32.1 7 RM 3859 42.4
1 RM595 78.40 4 RM471 53.8 7 RM 214 61.5
1 RM 246 115.2 4 RM 401 63.4 7 RM 11 93.8
1 RM 212 148.7 4 RM 142 100.2 7 RM 118 130.5
1 RM 472 171.6 4 RM 273 116.8 7 RM 420 144.6
2 RM 174 33.8 4 RM 153 0.5 8 RM 408 0
2 RM 1347 26.6 4 RM17960 18.8 8 RM1235 12.8
2 RM 71 49.8 4 RM 1089 37.2 8 RM 1376 15.2
2 RM 1352 48.1 5 RM 169 57.9 8 RM547 27.3
2 RM 5430 11.5 5 RM 6229 63.6 8 RM25 59.6
2 RM 1303 81.7 5 RM 1187 96.1 8 RM149 122.1
2 RM 526 136.3 5 RM249 122.1 8 RM 447 131.3
2 RM240 158 5 RM5770 103.9 9 RM 1328 0
2 RM 498 194.6 5 RM334 141.8 9 RM 316 1.5
3 RM 175 18.9 6 RM508 0 9 RM 3912 46.3
3 RM545 35.3 6 RM469 2.8 9 RM 1553 68.2
3 RM 227 120.1 6 RM 197 15.1 9 RM 189 90.7
3 RM 168 138.6 6 RM 276 30.8 9 RM 205 114.7
3 RM6135 158.2 6 RM 527 59.9 10 RM 214 27.8
3 RM 85 179.7 6 RM 454 86.5 10 RM 2504 35.9
3 RM7324 166.4 6 RM 1340 82.9 10 RM 311 46.4
3 RM520 191.6 6 RM 30 115.7 10 RM184 79.3
10 RM 294A 109.4 11 RM 6965 101.9 12 RM 1105 91.4
11 RM 332 12.3 11 RM 206 104.2 12 RM 1296 108.2
11 RM 536 42 11 RM 144 121.4 12 RM 17 109.1
11 RM 7120 56.2 12 RM1328 0 12 RM 1227 130.8
11 RM 229 66.5 12 RM 19 20.9
11 RM 209 84.7 12 RM 27973 57.6
Open in a new tab

Table 7.

Submergence SSR markers used for foreground selection

Primer Sequence Distance (mb)
SUB1C173F AACGCCAAGACCAACTTCC Exon of Sub1C
SUB1CI73R AGGAGGCTGTCCATCAGGT
ART5F CAGGGAAAGAGATGGTGGA Sub1C promoter
ART5R TTGGCCCTAGGTTGTTTCAG
Sub1BC2F AAAACAATGGTTCCATACGAGAC Between Sub1B and C
Sub1BC2R GCCTATCAATGCGTGCTCTT
Open in a new tab

Table 8.

Submergence SSR markers used for recombinant selection

Primer Sequence Distance (mb)
RM8303F AGGGGAGAGGACACACACAC 2.3
RM8303R GGATCCTCCTGCAAAATCAA
RM23770F GACCTTGTCCAGAGTGATTTTG 3.7
RM23770R ATTTGAGAATAACTTTTCCTACTTCG
RM23958F GAGACAGATGTGTACGGTTTGGTG 7.9
RM23958R TTGACAAGGGAATTGAAGGAGAAG
Open in a new tab

Table 9.

Submergence Polymorphic SSR markers used for Background selection

Chr. No SSR Marker Position (cM) Chr. No SSR Marker Position (cM) Chr. No SSR Marker Position (cM)
1 RM 3252 0.0 4 RM 261 31.1 6 RM 340 137.5
1 RM 595 78.4 4 RM 401 63.4 7 RM 295 0.0
1 RM1196 107.5 4 RM 273 116.8 7 RM 3859 42.4
1 RM246 115.2 4 RM 142 100.2 7 RM 125 44.4
1 RM443 122.7 4 RM 559 173.3 7 RM 214 61.5
2 RM7382 0.0 4 RM 1155 58.9 7 RM 11 93.8
2 RM 1347 26.6 5 RM 153 0.0 7 RM 1362 116.1
2 RM324 66.0 5 RM 169 57.9 7 RM 420 144.6
2 RM 5430 111.5 5 RM 188 108.7 8 RM 337 0.1
2 RM7485 145.7 5 RM 334 11.7 8 RM 1235 12.8
2 RM 240 158.0 5 RM 6467 143.8 8 RM 1376 15.2
3 RM 175 18.9 5 RM 30 174.6 8 RM 547 27.3
3 RM 545 35.3 6 RM 469 2.8 8 RM 3481 44.7
3 RM 282 61.5 6 RM 402 3.2 8 RM 310 57.0
3 RM5626 122.4 6 RM 197 15.1 8 RM 25 59.6
3 RM 118 138.6 6 RM 276 30.8 8 RM 433 87.2
3 RM 227 229.7 6 RM 454 86.5 8 RM 149 122.1
4 RM 551 0.0 6 RM 1340 82.9 8 RM 447 131.3
8 RM 264 138.2 10 RM 1374 72.8 11 RM 206 104.2
9 RM 1328 0.0 10 RM 184 79.3 11 RM 144 121.4
9 RM 316 1.5 10 RM 6016 83.0 11 RM 27172 123.3
9 RM 3912 46.3 10 RM 294A 109.4 11 RM 2136 136.8
9 RM 3164 72.1 11 RM 332 12.3 12 RM 247 12.0
9 RM 328 82.4 11 RM 287 57.4 12 RM 19 20.9
9 RM 245 112.3 11 RM 7303 64.2 12 RM 3246 48.2
10 RM 216 27.8 11 RM 229 66.5 12 RM 27973 57.6
10 RM 2504 35.9 11 RM 1341 80.2 12 RM 235 82.0
10 RM 596 34.8 11 RM 5961 79.9 12 RM 1103 91.4
10 RM 311 46.4 11 RM 209 84.7 12 RM 17 109.1
10 RM 1108 55.3 11 RM 6965 101.9 12 RM 1227 130.8
Open in a new tab

Genotyping of F1 generation

Saltol F1 generation

For the foreground selection of Saltol F1 generation, 35 / 55 plants were heterozygous for AP3206, SKC-10 and RM3412 foreground markers. After that recombinant selection was done with RM493 and RM10696. Recently the highly salt tolerant rice variety FL478 has been used to transfer Saltol QTL into the high yielding grown cultivars ASS996 using MABC strategy in Vietnam (Huyen et al. 2012). Figure 3 shows the genotypic screening with SKC10 marker.

Fig. 3.

Fig. 3

Open in a new tab

Genotypic screening of Saltol trait specific F1 progenies with foreground marker SKC-10 (Aiswarya X FL 478)

Sub1 F1 generation

For the selection of Sub1 F1 generation of the 48 plants, 26 plants were heterozygous for ART5, SUIBC2 And SUB1C173 foreground markers and recombinant selection carried out with RM8303, RM23770 and RM24005. The successful introgression of sub1 from donor rice variety IR64 into popular rice variety AS996 through MABC using ART5 and SC3 has been done in Vietnam (Cuc et al. 2012). After selection of heterozygous plants, they were backcrossed with the respective recurrent parents to develop BC1F1 plants. Figure 4 shows the Genotypic screening of Sub1 F1 progenies with foreground marker ART5.

Fig. 4.

Fig. 4

Open in a new tab

Genotypic screening of Sub1 trait specific F1 progenies with foreground marker ART5 (Aiswarya X Swarna Sub1)

Genotyping of BC1F1 generation

Saltol BC1F1 generation

In 90 plants of BC1F1 the 58 plants were Saltol introgressed plants, confirmed with AP3206, SKC-10 and RM3412 foreground markers and Recombinant selection was carried out on 58 Saltol introgressed plants and 66 Sub1 introgressed plants. Background analysis was done of Saltol introgressed plants with selected SSR markers and indicated a recovery of 64%. The Introgression of Saltol QTL into an elite rice variety Jyothi is done using marker assisted selection (Rohini and Shylaraj 2017). Seventeen Saltol BC1F1 recombinant plants were further used for backcross breeding. Figure 5 shows the Genotypic screening of Saltol BC1F1 progenies with foreground marker SKC-10 and Fig. 6 shows the Genotypic screening of Saltol BC1F1 progenies with recombinant marker RM10696.

Fig. 5.

Fig. 5

Open in a new tab

Genotypic screening of Saltol trait specific BC1F1 progenies with foreground marker SKC-10

Fig. 6.

Fig. 6

Open in a new tab

Genotypic screening of Saltol trait specific BC1F1 progenies with recombinant marker RM10696

Sub1 BC1F1 generation

In 94 BC1F1 plants, 66 plants were Sub1 introgressed plants, confirmed with ART5, SUIBC2 And SUB1C173 and Recombinant selection was carried out on 58 Saltol introgressed plants and 66 Sub1 introgressed plants. Background analysis was done in Sub1 introgressed plants with selected SSR markers and indicated a recovery of 67%. Nineteen Sub1 BC1F1 recombinant plants were further used for backcross breeding. Figure 7 shows the Genotypic screening of Sub1 BC1F1 progenies with foreground marker ART5 and Fig. 8 shows the Genotypic screening of Sub1 BC1F1 progenies with recombinant marker RM8303.

Fig. 7.

Fig. 7

Open in a new tab

Genotypic screening of Sub1 trait specific BC1F1 progenies with foreground marker ART5

Fig. 8.

Fig. 8

Open in a new tab

Genotypic screening of Sub1 trait specific BC1F1 progenies with recombinant marker RM8303

Genotyping of BC2F1 and BC2F2 generation

Saltol BC2F1 and BC2F2 generation

In BC2F1 generation 10 plants with Saltol introgressed were phenotypically and genotypically analyzed and indicated a recovery of 75% to 82%. After that, all the selected BC2F1 plants were selfed and BC2F2 generation were obtained. On the basis of phenotypic and genotypic screening, the best four plants with maximum genome recovery of 89% to 92% were selected. Figure 9 shows the Genotypic screening of Saltol BC2F2 progenies with foreground marker SKC-10. Figure 10 shows the Genotypic screening of Saltol trait specific BC2F2 progenies with recombinant marker RM10696. The Fig. 11 shows the graphical representation of selected best plant with 92% background genomic recovery.

Fig. 9.

Fig. 9

Open in a new tab

Genotypic screening of Saltol trait specific BC2F2 progenies with foreground marker SKC-10

Fig. 10.

Fig. 10

Open in a new tab

Genotypic screening of Saltol trait specific BC2F2 progenies with recombinant marker RM10696

Fig. 11.

Fig. 11

Open in a new tab

Graphical presentation of the best BC2F2 plant with Saltol QTL introgression (A: Homozygous to the recipient genome B: Homozygous to the donor genome H: Heterozygous region)

Sub1 BC2F1 and BC2F2 generation

In BC2F1 generation 12 plants with Sub1 introgressed were phenotypically and genotypically analyzed and indicated a recovery of 70% to 80%. After that, all the selected BC2F1 plants were selfed and BC2F2 generation produced. On the basis of phenotypic and genotypic screening, the best four plants with maximum genome recovery of 85% to 93% were selected. Figure 12 shows the Genotypic screening of Sub1 BC2F2 progenies with foreground marker ART5. Figure 13 shows the Genotypic screening of Sub1 BC2F2 progenies with recombinant marker RM8303. The Fig. 14 shows the graphical presentation of best selected plant with 93% background genomic recovery.

Fig. 12.

Fig. 12

Open in a new tab

Genotypic screening of Sub1 trait specific BC2F2 progenies with foreground marker ART5

Fig. 13.

Fig. 13

Open in a new tab

Genotypic screening of Sub1 trait specific BC2F2 progenies with recombinant marker RM8303

Fig. 14.

Fig. 14

Open in a new tab

Graphical presentation of the best BC2F2 plant with Sub 1 gene introgression (A: Homozygous to the recipient genome B: Homozygous to the donor genome H: Heterozygous region)

Phenotypic Screening for Salinity tolerance and submergence tolerance

The selected Saltol BC2F2 lines showed salinity tolerance at seedling stage under salt stress. The salinity tolerance score of these lines were similar to the donor variety FL-478. A salinity tolerant Q5DB was developed using marker assisted selection, which was controlled by a major Saltol QTL (Huyen et al. 2013) and the selected Sub1 introgressed BC2F2 lines showed submergence tolerance and recovery after submergence of 21 days so the tolerance score of these lines were similar to the donor variety Swarna Sub1. A single major quantitative trait locus (QTL) SUBMERGENCE 1 (SUB1) near the centromere of chromosome 9 in the rice genome along with a number of minor QTLs linked to submergence tolerant had been identified (Xu et al. 2006). Based on these results the introgression of Saltol and Sub1 QTL in these lines was confirmed. Figure 15 shows the phenotypic screening of selected progenies for salinity tolerance and Fig. 16 shows the phenotypic screening of submergence tolerance.

Fig. 15.

Fig. 15

Open in a new tab

Phenotypic screening for salinity screening. a Control set of progenies without salinity stress b progenies with salinity stress

Fig. 16.

Fig. 16

Open in a new tab

Phenotypic screening of submergence tolerance

Outcome of the study

The present study could develop 5 best lines of Saltol QTL introgressed Aiswarya with 85%–92% of background homozygosity of Aiswarya and 4 best lines of Sub1 gene introgressed lines of Aiswarya with 88%–93% of background homozygosity of Aiswarya. These lines can be released for cultivation in the saline prone coastal areas as well as in submergence prone coastal areas. Further these lines can be used to pyramid both the abiotic stresses into the variety Aiswarya to develop a dual stress tolerant rice variety.

Conclusion

This work aimed to develop a Saltol QTL and Sub1 QTL introgressed Aiswarya variety by using Marker Assisted Backcross Breeding. This study can make a good impact on rice breeding through the development of a salinity and submergence tolerant variety Aiswarya which can be cultivated throughout Kerala. Climatic changes and environmental issues harming rice production, which is the most important food crop in India (Kurokawa et al. 2018). Abiotic stresses include drought, salinity, submergence, heat, cold etc. disapprovingly impends crop production and causes yield loss in low land areas and coastal areas (Pareek et al. 2010). Due to unexpected linkage drag it is difficult to use conventional breeding method to introgress these tolerant genes into high yielding varieties (Jeung et al. 2005). Hence using molecular breeding is a good option which did not affect grain quality and yield. A rice cultivar OMCS2000 developed with improved salt tolerant genes using maker assisted selection (Lang et al. 2008). Salt tolerance is controlled by many eleven QTL which are located on 5 chromosomes from the population of Nona Bokra and Koshihikari (Ren et al., 2005). 10.000 hectares of rice were submerged by 2011 floods, due to which faced a severe economic loss and loss of rice productivity (MARD 2011). Approximately 40.000 km2, a huge amount of area will be disappeared if sea level rise is by 1 m (Khanh et al. 2013).

In this study we used the MABB breeding method to introgress the Saltol gene and Sub1 gene into a popular rice variety Aiswarya by phenotypic and genotypic selection. Using SSR markers the Saltol gene and Sub1 gene introgression was confirmed. Our results accomplish that a salinity tolerant gene (Saltol) from the donor parent FL478 was successfully transferred into Aiswarya and submergence tolerant gene Sub1 from the donor parent Swarna Sub1 was successfully transferred into Aiswarya independently. The future line of work of the study is to pyramid both these abiotic stresses into the rice variety Aiswarya to make it dual stress tolerant variety. Better profitability can be achieved directly benefiting the farmers by increasing their harvest in saline and flood affected lands. Due to this sole reason this work will have a significant impact on the socio-economic factors of low-lying areas and will lead to upliftment of farmers of these regions.

Acknowledgement

The authors are grateful to the funding agency, Department of Science and Technology, Government of India for the Inspire Fellowship and Kerala Agriculture University for providing the necessary lab facilities to carry out the study.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Collard CY, Mackill J (2007) Marker-assisted selection: an approach for precision plant breeding in the twenty-first century Phil Trans R Soc B 36310.1098/rstb.2007.2170 [DOI] [PMC free article] [PubMed]
  2. Cuc LM, Huyen LTN, Hien PTM, Hang VTT, Dam NQ, Mui PT, Quang VD, Ismail AM, Ham LH. Application of marker assisted backcrossing to introgress the submergence tolerance QTLSUB1 into the Vietnam elite rice variety-AS996. Am J Plant Sci. 2012;3:528–536. doi: 10.4236/ajps.2012.34063. [DOI] [Google Scholar]
  3. Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 1987;19:11–15. [Google Scholar]
  4. Fukao T, El Y, Bailey-Serres J. The submergence tolerance regulator sub1a mediates crosstalk between submergence and drought tolerance in rice. Plant Cell. 2011;23:412–427. doi: 10.1105/tpc.110.080325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Gregorio GB, Islam MR, Vergara GV, Thirumeni S. Recent Advances in rice science to design salinity and other abiotic stress tolerant rice varieties. SABRAO J Breed Genet. 2013;45:31–41. [Google Scholar]
  6. Hasan MM, Rafii MY, Ismail MR, et al. Marker-assisted backcrossing: a useful method for rice improvement. Biotechnol Equip. 2015;29:237–254. doi: 10.1080/13102818.2014.995920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hospital F, Charcosset A. Marker-Assisted Introgression of Quantitative Trait Loci. Genetics. 1997;147:1469–1485. doi: 10.1093/genetics/147.3.1469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hossain M, Narciso J. Global Rice Market: Trends and Perspectives. The Bangladesh Dev Stud. 2002;28:1–28. [Google Scholar]
  9. Huyen LTN, Cuc LM, Ismail AM, Ham LH. Introgression the salinity tolerance QTLs Saltol into AS996, the elite rice variety of Vietnam. Am J Plant Sci. 2012;3:981–987. doi: 10.4236/ajps.2012.37116. [DOI] [Google Scholar]
  10. Huyen LTN, Cuc LM, Ham LH, Khanh TD. Introgression the SALTOL QTL into Q5DB, The Elite Variety of Vietnam Using Marker-Assisted-Selection (MAS) Am J BioSci. 2013;1:80–84. doi: 10.11648/j.ajbio.20130104.15. [DOI] [Google Scholar]
  11. IRRI (1996). Standard evaluation system for rice. The International Rice Research Institute, Manila, Philippines. pp 44
  12. Jeung JU, Hwang HG, Moon HP, Jena KK. Fingerprinting temperate japonica and tropical Indica rice genotypes by comparative analysis of DNA markers. Euphytica. 2005;146:239–251. doi: 10.1007/s10681-005-9022-2. [DOI] [Google Scholar]
  13. John D, Shylaraj KS. Introgression of Sub1 QTL into an elite rice (Oryza sativa L.) variety Jyothi through Marker Assisted Backcross Breeding. J Tropical Agric. 2017;55:1–11. [Google Scholar]
  14. John D, Rohini PS, Shylaraj KS. Genetic analysis of the salt tolerant rice varieties of Kerala through molecular characterization using SSR markers. Green Farming. 2017;8:1012–1017. [Google Scholar]
  15. Khanh TD, Linh LH, Ham LH, Xuan TD. Rapid and high-precision marker assisted backcrossing to introgress the SUB1 QTL into the Vietnamese elite rice variety. J Plant Bred Crop Sci. 2013;5:26–33. doi: 10.5897/JPBCS12.052. [DOI] [Google Scholar]
  16. Kurokawa Y, Nagai K, Huan PD, Shimazaki K, Qu H, Mori Y, Toda Y, Kuroha T, Hayashi N, Aiga S. Rice leaf hydrophobicity and gas films are conferred by a wax synthesis gene (LGF1) and contribute to flood tolerance. New Phytol. 2018;218:1558–1569. doi: 10.1111/nph.15070. [DOI] [PubMed] [Google Scholar]
  17. Lang NT, Buu BC, Ismail AM. Molecular mapping and marker assisted selection for salt tolerance in rice (Oryza sativa L.) Omonrice. 2008;16:0–56. [Google Scholar]
  18. Lutts S, Kinet JM, Bouharmont J. Changes in plant response to NaCl during development of rice (Oryza sativa L.) varieties differing in salinity resistance. J Exp Bot. 1995;46:1843–1852. doi: 10.1093/jxb/46.12.1843. [DOI] [Google Scholar]
  19. [MARD] Ministry of Agriculture and Rural Development (2011). Vietnam News Agency report, Nov 12.
  20. Mohammadi N, Arzani A, Rezai AM, Singh RK, Gregorio GB. Assessment of rice genotypes for salt tolerance using microsatellite markers associated with the saltol. QTL Afr J Biotech. 2008;7:9. [Google Scholar]
  21. Neeraja C, Maghirang Rodriguez R, Pamplona A, Heuer S, Collard B, Septiningsih E. A marker-assisted backcross approach for developing submergence-tolerant rice cultivars. Theor Appl Genet. 2007;115:767–776. doi: 10.1007/s00122-007-0607-0. [DOI] [PubMed] [Google Scholar]
  22. Niones, JM (2004) Fine mapping of the salinity tolerance gene on chromosome 1 of rice (Oryza sativa L.) using near- isogenic lines. MS dissertation. University of the Philippines Los Baños. pp.78
  23. Pareek A, Sopory SK, Bohnert HJ, Govindjee (2010) Abiotic stress adaptation in plants. Physiol mol genomic found. 10.1007/978-90-481-3112-9
  24. Ralph VB. GGT 2.0: Versatile software for visualization and analysis of genetic data. J Hered. 2008;99:232–236. doi: 10.1093/jhered/esm109. [DOI] [PubMed] [Google Scholar]
  25. Ren ZH, Gao JP, Li LG, Cai XL, Huang W, Chao DY, Zhu MZ, Wang ZY, Luan S, Lina HX. Rice quantitative trait locus for salt tolerance encodes a sodium transporter. Nat Genet. 2005;37:1141–1146. doi: 10.1038/ng1643. [DOI] [PubMed] [Google Scholar]
  26. Rohini PC, Shylaraj KS. Introgression of Saltol QTL into an elite rice variety Jyothi through marker assisted selection. Green Farming. 2017;8:512–517. [Google Scholar]
  27. Sarkar RK, Bhattacharjee B. Rice Genotypes with SUB1 QTL Differ in Submergence Tolerance, Elongation Ability during Submergence and Re-generation Growth at Re-emergence. Rice (NY) 2011;295(5):7. doi: 10.1007/s12284-011-9065-z. [DOI] [Google Scholar]
  28. Singh RK, Glein B, Gregorio RK. QTL mapping for salinity tolerance in rice. Physiol Mol Biol Plants. 2007;13:87–99. [Google Scholar]
  29. Thomson MJ, Ocampo DE, Egdane J, et al. Characterizing the Saltol quantitative trait locus for salinity tolerance in rice. Rice. 2010;3:148–160. doi: 10.1007/s12284-010-9053-8. [DOI] [Google Scholar]
  30. Todaka D, Nakashima K, Shinozaki K. Toward understanding transcriptional regulatory networks in abiotic stress responses and tolerance in rice. Rice. 2012;5:6. doi: 10.1186/1939-8433-5-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Xu K, Xu X, Fukao T, Canlas P, Maghirang Rodriguez R, Heuer S, Ismail AM, Serres B, Ronald J, Mackill DJ. Sub1A is an ethylene-response-factor-like gene that confers submergence tolerance to rice. Nature. 2006;442:705–708. doi: 10.1038/nature04920. [DOI] [PubMed] [Google Scholar]

Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES