Skip to main content
BMC Veterinary Research logoLink to BMC Veterinary Research
. 2021 Mar 23;17:128. doi: 10.1186/s12917-021-02837-6

Development of TaqMan-based real-time RT-PCR assay based on N gene for the quantitative detection of feline morbillivirus

Siti Tasnim Makhtar 1, Sheau Wei Tan 2, Nur Amalina Nasruddin 1, Nor Azlina Abdul Aziz 1, Abdul Rahman Omar 1,2, Farina Mustaffa-Kamal 1,2,
PMCID: PMC7987112  PMID: 33757494

Abstract

Background

Morbilliviruses are categorized under the family of Paramyxoviridae and have been associated with severe diseases, such as Peste des petits ruminants, canine distemper and measles with evidence of high morbidity and/or could cause major economic loss in production of livestock animals, such as goats and sheep. Feline morbillivirus (FeMV) is one of the members of Morbilliviruses that has been speculated to cause chronic kidney disease in cats even though a definite relationship is still unclear. To date, FeMV has been detected in several continents, such as Asia (Japan, China, Thailand, Malaysia), Europe (Italy, German, Turkey), Africa (South Africa), and South and North America (Brazil, Unites States). This study aims to develop a TaqMan real-time RT-PCR (qRT-PCR) assay targeting the N gene of FeMV in clinical samples to detect early phase of FeMV infection.

Results

A specific assay was developed, since no amplification was observed in viral strains from the same family of Paramyxoviridae, such as canine distemper virus (CDV), Newcastle disease virus (NDV), and measles virus (MeV), and other feline viruses, such as feline coronavirus (FCoV) and feline leukemia virus (FeLV). The lower detection limit of the assay was 1.74 × 104 copies/μL with Cq value of 34.32 ± 0.5 based on the cRNA copy number. The coefficient of variations (CV) values calculated for both intra- and inter-assay were low, ranging from 0.34–0.53% and 1.38–2.03%, respectively. In addition, the clinical sample evaluation using this assay showed a higher detection rate, with 25 (35.2%) clinical samples being FeMV-positive compared to 11 (15.5%) using conventional RT-PCR, proving a more sensitive assay compared to the conventional RT-PCR.

Conclusions

The TaqMan-based real-time RT-PCR assay targeting the N gene described in this study is more sensitive, specific, rapid, and reproducible compared to the conventional RT-PCR assay targeting the N gene, which could be used to detect early infection in cats.

Keywords: Feline morbillivirus, TaqMan-based real-time RT-PCR, N gene

Background

Family Paramyxoviridae belongs to the order Mononegavirales and can be further classified into four subfamilies: Rubulavirinae, Avulavirinae, Metaparamyxovirinae, and subfamily Orthoparamyxovirinae [1]. Feline morbillivirus (FeMV) is a novel virus under the subfamily Orthoparamyxovirinae, which has been associated with the occurrence of chronic kidney disease in cats. FeMV was first discovered in Hong Kong in 2012, followed by that in other countries such as Japan, United States, Italy, Turkey, Thailand, Germany, and Brazil [28]. Similar to other morbilliviruses, the FeMV genome is composed of six genes (3′-N-P/V/C-M-F-H-L-5′), which encode for six structural and two non-structural proteins [8]. The RNA of the virus is being encapsidated by the nucleoprotein (N), which makes up for the nucleocapsid [9]. The large protein (L) and phosphoprotein (P) form the RNA-dependent RNA polymerase (RdRp) complex that is responsible for all polymerase activities, which only recognized the encapsidated RNA as a template [10]. Fusion (F) and hemagglutinin (H) proteins are glycoprotein which form the envelope of the virus [1]. The matrix (M) protein is a non-glycosylated, hydrophobic viral protein, which acts as a bridge to connect the envelope protein with ribonucleoprotein (RNP) core consisting the nucleocapsid, L protein, and P protein [11]. In relation to that, a putative FeMV recombination between a Japan isolate (ChJ073) with Hong Kong isolate (776 U) involving fusion (F) and hemagglutinin (H) genes has been documented for a Japanese strain (MiJP003) [12]. This type of recombination may occur when two different virus strains infect the same cats, which also raise a speculation of the possibility that the FeMV strain closely related to 776 U may also be circulating in Japan.

Since the discovery of this novel virus, a number of publications describe utilizing conventional PCR assays to screen FeMV [68, 13]. However, the screening of FeMV by conventional PCR assays can be hampered by the low quantity of RNA in the samples [13, 14]. Furthermore, screening large number of samples and performing quantitative analysis are either laborious or impossible to be performed with conventional PCR assays. A previous study has detected 82 FeMV-positive cats out of 208 cats in Malaysia via conventional PCR [15]. Furthermore, a high range of 85–99% nucleotide similarities were obtained from the analysis of partial nucleocapsid (N) gene from these FeMV-positive cats. To the best of the author’s knowledge, there were only two published studies describing the development of quantitative-based assay to detect FeMV targeting the L and P/V/C gene [14, 16].

As the genetic diversity of FeMV is evidenced in other Asian countries such as Japan, hence, there is a need for a robust diagnostic molecular tool to detect the genetically heterogenous viral strains [17]. This research aims to develop TaqMan real-time RT-PCR (qRT-PCR) assay based on the N gene. N gene is an ideal target gene because it is a well-conserved gene and a major viral protein that folds and protects the viral RNA, playing a key role in virus replication [18]. The N gene sequence was used to design the primers and probe sequences to develop TaqMan-based real-time PCR assay. Both specificity and sensitivity of the assay were assessed and further evaluated with clinical samples alongside the conventional RT-PCR. Ultimately, developing this specific and sensitive assay for FeMV will galvanize the subsequent detailed examination on the significance of this virus in domestic cat populations.

Results

Optimization of the TaqMan-based real-time RT-PCR (qRT-PCR) targeting N gene of FeMV

The TaqMan-based qRT-PCR was optimized by determining the optimal primers and probe concentration, in which 0.8 μL of 10 μM primers and 0.2 μL of 10 μM probe were used.

Sensitivity of TaqMan-based real-time RT-PCR (qRT-PCR) targeting N gene of FeMV

The concentration of the cRNA was 12 ng/μL, which was equivalent to 1.74 × 1011 copies/μL. A series of 10-fold dilution of the cRNA ranging from 1.74 × 101 to 1.74 × 1011 was reverse transcribed and subsequently used to determine the sensitivity of the real-time PCR assay. The lower detection limit based on the cRNA copy number was achieved at 1.74 × 104 copies/μL, with a corresponding Cq value of 34.32 ± 0.5 (Fig. 1a). The standard curve of the qRT-PCR assay based on the cRNA copy number was plotted in linear with the coefficient of determination (R2) of 0.999, the slope of − 3.402 and the efficiency of 96.8% (Fig. 1b).

Fig. 1.

Fig. 1

a The detection limit of qRT-PCR assay based on cRNA copy number. Amplification plot of 10-fold serial diluted cRNA ranging from 1.74 × 1011 to 1.74 × 104 copies/μL. b Standard curve of qRT-PCR assay. Ten-fold dilutions of control cRNA were assessed with the qRT-PCR assay. Log copies per μL and quantitation cycle (Cq) are plotted on the x-axis and y-axis, respectively

Specificity of TaqMan-based real-time RT-PCR (qRT-PCR) targeting N gene of FeMV

Specificity of the qRT-PCR assay was assessed against the viral strains from the same family Paramyxoviridae, which were the Newcastle disease virus (NDV), canine distemper virus (CDV), measles virus (MeV), and other feline viruses, such as feline leukemia virus (FeLV) and feline coronavirus (FCoV). None of the RNA viruses showed amplification signals, proving the high specificity of the assay (Fig. 2). Besides that, the no-template control did not show any amplification signal.

Fig. 2.

Fig. 2

Specificity of N gene based on the qRT-PCR assay. Amplification plot detection of FeMV, FCoV, FeLV, CDV, MeV, NDV, and no-template control (NTC). Amplification curve was only detected for FeMV (positive control)

Reproducibility of TaqMan-based real-time RT-PCR (qRT-PCR) targeting the N gene of FeMV

The reproducibility of the qRT-PCR was determined by the intra- and inter-assay evaluation of the Cq value using RNAs from three different positive samples: UPM23, UPM52, and UPM202. The intra-assay was analyzed by using the RNAs from these three samples in triplicates per run; whereas for the inter-assay assessment, the RNAs were amplified in triplicates in three different consecutive runs. The calculated SD and CV values for the intra-assay variations ranged from 0.10 to 0.17 and from 0.34 to 0.53%, respectively (Table 1). Meanwhile, for the inter-assay evaluation, the calculated SD and CV values ranged from 0.45 to 0.66 and 1.38 to 2.03%, respectively (Table 2).

Table 1.

Intra-assay variation

Sample Cq value Mean Cq S.D. CV%
Replicate 1 Replicate 2 Replicate 3
UPM23 28.00 28.01 27.83 27.95 0.1 0.36
UPM52 32.92 32.77 32.71 32.80 0.11 0.34
UPM202 32.17 32.26 32.49 32.31 0.17 0.53

Table 2.

Inter-assay variation

Sample Cq value Mean Cq S.D. CV%
Assay 1 Assay 2 Assay 3
UPM23 27.42 27.66 28.42 27.83 0.52 1.87
UPM52 32.33 32.57 33.20 32.70 0.45 1.38
UPM202 31.90 32.44 33.21 32.51 0.66 2.03

Clinical samples evaluation using TaqMan-based qRT-PCR and comparison with conventional RT-PCR assay

Urine samples (n = 55) and kidney samples (n = 16) were evaluated to determine the performance of the newly developed qRT-PCR assay (Table 3). Among these 71 samples, 22/55 (40.0%) urine and 3/16 (18.8%) kidney samples were positive for FeMV with log copy number ranging from 3.54 ± 0.01 to 6.60 ± 0.12. Besides that, among the 16 cats that had both kidney and urine samples collected, none of these cats had detectable FeMV RNA in both samples concurrently. For example, the three cats showing FeMV-positive kidney samples (UPM304, UPM312, and UPM321) had no detectable FeMV RNA in their urine samples. Conversely, one of the cats (UPM305) that showed detectable FeMV RNA in its urine sample had no FeMV RNA in its kidney sample. In order to determine the sensitivity of TaqMan qRT-PCR assay in detecting FeMV from the clinical samples, conventional RT-PCR using two different sets of published primers targeting N gene [12] was conducted on all 71 samples, in which only 11/55 (20%) urine samples were positive, while no (0/16; 0%) kidney samples were detected positive.

Table 3.

Detection of FeMV using conventional RT-PCR and qRT-PCR quantification from clinical samples

Sample Sample ID RT-PCR
(N gene)
Log copy number (mean ± S.D.) Source of cat Health status
Urine UPM23 + 6.60 ± 0.12 Client-owned Healthy
Urine UPM52 + 4.94 ± 0.02 Client-owned Healthy
Urine UPM53 + 4.93 ± 0.02 Client-owned Healthy
Urine UPM202 + 4.77 ± 0.02 Client-owned Healthy
Urine UPM203 BLD Client-owned Healthy
Urine UPM204 4.86 ± 0.06 Client-owned Healthy
Urine UPM205 4.55 ± 0.03 Client-owned Healthy
Urine UPM207 4.67 ± 0.02 Client-owned Healthy
Urine UPM210 + 3.66 ± 0.08 Client-owned Healthy
Urine UPM219 3.80 ± 0.14 Client-owned CKD stage IV
Urine UPM220 + 4.11 ± 0.05 Client-owned N/A
Urine UPM221 3.66 ± 0.02 Client-owned Healthy
Urine UPM224 BLD Client-owned Healthy
Urine UPM225 3.54 ± 0.01 Client-owned Healthy
Urine UPM226 3.71 ± 0.11 Client-owned Healthy
Urine UPM227 BLD Client-owned N/A
Urine UPM228 BLD Client-owned N/A
Urine UPM229 BLD Client-owned N/A
Urine UPM231 + 4.29 ± 0.23 Client-owned Healthy
Urine UPM232 BLD Client-owned CKD Stage II
Urine UPM240 BLD Client-owned Healthy
Urine UPM241 BLD Client-owned Healthy
Urine UPM271 BLD Client-owned Heart disease
Urine UPM272 BLD Client-owned CKD Stage II
Urine UPM273 BLD Client-owned N/A
Urine UPM274 BLD Client-owned Suspected CKD
Urine UPM275 BLD Client-owned FURD
Urine UPM276 + 4.05 ± 0.08 Client-owned Healthy
Urine UPM277 BLD Client-owned Healthy
Urine UPM278 BLD Client-owned N/A
Urine UPM279 BLD Client-owned N/A
Urine UPM280 BLD Client-owned Suspected CKD
Urine UPM281 BLD Client-owned N/A
Urine UPM282 4.63 ± 0.05 Client-owned FLUTD
Urine UPM283 BLD Client-owned Healthy
Urine UPM284 BLD Client-owned Healthy
Urine UPM285 3.74 ± 0.02 Client-owned N/A
Urine UPM286 3.88 ± 0.18 Client-owned Obstructive FLUTD
Urine UPM287 BLD Client-owned Suspected CKD
Urine UPM304 BLD Shelter N/A
Urine UPM305 + 4.34 ± 0.10 Shelter Platynosomum sp.
Urine UPM306 3.76 ± 0.26 Shelter N/A
Urine UPM307 BLD Shelter N/A
Urine UPM308 BLD Shelter Platynosomum sp.
Urine UPM310 BLD Shelter N/A
Urine UPM311 BLD Shelter Platynosomum sp.
Urine UPM312 BLD Shelter Platynosomum sp.
Urine UPM313 BLD Shelter N/A
Urine UPM314 + 4.45 ± 0.07 Shelter Platynosomum sp.
Urine UPM315 + 4.92 ± 0.07 Shelter Platynosomum sp.
Urine UPM316 BLD Shelter Platynosomum sp.
Urine UPM317 BLD Shelter N/A
Urine UPM318 BLD Shelter N/A
Urine UPM320 BLD Shelter N/A
Urine UPM321 BLD Shelter N/A
Kidney UPM304 3.80 ± 0.03 Shelter N/A
Kidney UPM305 BLD Shelter Platynosomum sp.
Kidney UPM306 BLD Shelter N/A
Kidney UPM307 BLD Shelter N/A
Kidney UPM308 BLD Shelter Platynosomum sp.
Kidney UPM310 BLD Shelter N/A
Kidney UPM311 BLD Shelter Platynosomum sp.
Kidney UPM312 3.70 ± 0.10 Shelter Platynosomum sp.
Kidney UPM313 BLD Shelter N/A
Kidney UPM314 BLD Shelter Platynosomum sp.
Kidney UPM315 BLD Shelter Platynosomum sp.
Kidney UPM316 BLD Shelter Platynosomum sp.
Kidney UPM317 BLD Shelter N/A
Kidney UPM318 BLD Shelter N/A
Kidney UPM320 BLD Shelter N/A
Kidney UPM321 3.89 ± 0.08 Shelter N/A

BLD denotes below limit of detection of qRT-PCR; and

N/A denotes not available

Interestingly, the cats that were deemed healthy with their health status available had a higher positive rate of detection (13/20) compared to the cats diagnosed with a disease (3/10). The source of which the cats was collected from, be it from the shelters or were originally pet cats, may also be an important factor in the FeMV-positive detection rate. A higher percentage of positive detection rate was observed among client-owned cats (46%; 18/39) compared to the shelter cats (43%; 7/16).

Biological samples taken from the cats in shelters were also part of another study that assessed the presence of Platynosomum sp., a hepatic trematode found in the gall bladder and biliary ducts of cats. Incidentally, Platynosomum sp. was detected in 7 out of 16 (43.8%) shelter cats, of which 4 (57.1%) of them were also FeMV-positive.

Discussion

Feline morbillivirus (FeMV) has been speculated to cause chronic kidney disease (CKD) and it is commonly detected in urine and kidney tissue samples. Previously, conventional assays, such as RT-PCR and reverse transcription loop-mediated isothermal amplification (RT-LAMP), have been developed for targeting the L gene of FeMV [5, 7, 8, 19, 20]. However, these conventional assays were qualitative and required additional step of gel electrophoresis to visualize the PCR product. In this study, a two-step TaqMan-based qRT-PCR diagnostic assay for the detection of FeMV-N gene was developed. This quantitative assay was designed to detect the N gene, one of the most conserved regions in morbilliviruses. Other quantitative-based assays, specifically qRT-PCR, has also been developed to detect FeMV, but all were designed to either target the L gene or the P/V/C gene [14, 16]. Moreover, these qRT-PCR assays had low positive rate of detection, which could be due to the limited availability of FeMV sequences at the time, thereby resulting in a less inclusive assay. Hence, it is crucial to design the primers and probe based on the latest sequences available. In addition, P gene has been shown to have the highest rates of nucleotide polymorphisms, ranging from 88.6 to 99.3% [12]. Besides that, a study conducted on peste des petits ruminants virus (PPRV), another morbillivirus member, revealed that the L gene had the highest evolution rate at 9.75 × 10− 4 site per year, while the N gene showed the lowest evolution rate at 1.1 × 10− 3 site per year [21].

Nucleoprotein (N) comprises two regions: core domain (NCORE) and C-terminal domain (also known as NTAIL) [22]. NCORE covers the first 400 amino acids of the N protein and it is responsible for the RNA encapsidation prior to viral replication and translation. This core domain also consists of three previously identified conserved motifs. N protein also possesses nuclear export signal, nuclear localization signal (NLS), and RNA binding motifs. Both nuclear export signal and NLS are believed to transport the N protein to the nucleus of the host cell, while the RNA binding site is considered to be involved in N-N self-interaction and interaction of N-N RNA monomers during genomic RNA binding. N-TAIL region comprises structurally variable region of approximately 120 to 150 amino acids, which mediate the interaction with P gene [23]. Besides that, N gene is integral during the initial infection, as the RNA synthesis by RdRp complex will only recognize and synthesize the viral RNA encapsidated by N protein as a template [10]. Given that the N gene is conserved compared to other genes of FeMV and detectable during the early phase of infection, a quantitative assay targeting the N gene of FeMV was developed in this study. In order to develop this assay, a partial sequence of ~ 1.5 kb N gene was obtained from seven local isolates. Upon obtaining the ~ 1.5 kb of FeMV-N gene sequences of these isolates, the primers and probe for TaqMan-based qRT-PCR assay were designed specifically to target 122 bp of N gene.

For the development of TaqMan-based real-time RT-PCR (qRT-PCR), a standard curve was generated to accurately quantify the FeMV. The sensitivity of the developed assay was done by quantifying 10-fold serial dilutions of standard complementary RNA (cRNA). The results showed that the assay could detect up to 10,000 copy number of FeMV. Even though the resulting sensitivity of this newly developed qRT-PCR assay was low, this assay has done none of the other established assays had to date, which was utilizing newly designed primers and probe set targeting N gene. The specificity test of the assay was performed by running the assay against other viral strains from the same family, which were NDV, CDV, MeV, and two feline viruses: FeLV and FCoV. The absence of cross-reaction proved high specificity of the developed assay. In addition to that, the low sensitivity reported for this assay could be due to the highly specific designed primers based on stringent parameters, as evident by the absence of amplification in other tested viruses. In a diagnostic test, a highly specific assay may compromise the sensitivity of the assay, resulting in an inverse relationship [24]. Furthermore, incorporating probe known for its specificity in this assay might also contribute to a highly specific qRT-PCR assay, thus compromising its sensitivity. In order to evaluate the reproducibility of the assay, intra- and inter-assay assessments were done by testing three different positive samples: UPM23, UPM52, and UPM202. The value of standard deviation calculated for both intra- and inter-assay indicated that the developed qRT-PCR assay was low in variability but high in reproducibility. Besides that, comparing the coefficient of variation (CV) of both intra- and inter-assay with a previously reported study indicated that the value of CV recorded in this work was relatively low, confirming the reproducibility of this assay [16].

In order to further evaluate the sensitivity of the qRT-PCR assay, clinical samples (n = 71) were tested to detect FeMV by targeting the N gene and compared with conventional RT-PCR assay. All samples that were detected positive by conventional RT-PCR (11/71) were also detected by the qRT-PCR assay. However, there were 15 qRT-PCR FeMV-positive samples that were not detected via conventional RT-PCR. Some of these samples had a copy number of ~ 1000. Based on the standard curve, even though the lowest result of limit of detection was ~ 10,000 copy number, the quantification on clinical samples proved that the newly designed qRT-PCR assay was able to amplify samples which had a lower copy number.

Evaluation of the clinical samples showed that healthy cats had a higher positive rate compared to cats diagnosed with a disease. Since this research was a cross-sectional study, it was difficult to interpret whether or not this finding was significant. Nevertheless, a prospective follow-up of these cats may provide an insight on the clinical relationship of the cats with FeMV infection. Besides that, a higher rate of detection was observed among client-owned cats compared to shelter cats, which was consistent with a previous study although it was contradictory to other studies [2, 15]. This observation could be due to the differences in the shelter management among different countries. Shelter cats are usually placed in an enclosed area, limiting their interactions with free-roaming cats, hence, reducing the transmission from one cat to another. Furthermore, the transmission among client-owned cats may occur if the cats are living outdoors or if they are semi-roamer cats, as they can interact with other free-roaming cats [25]. Additionally, a multi-cat household may have a higher chance to transmit the virus to other healthy cats already living within the household or newly introduced animals [3]. It was also noted that all cats were not detected positive for both urine and kidney samples, as observed by many studies as well [4, 26]. This observation may be caused by the early-stage infection, whereby the virus has yet to travel to the kidney. Consequently, this finding would suggest for a further study to observe the viral shedding and specifically, the viral load over time, accompanied with serum urea and creatinine level among FeMV-positive cats to determine the relationship of the severity of kidney disease and FeMV pathogenesis.

The cats recruited in this study were also part of a study to detect the presence of Platynosomum sp., a fluke living in pancreatic ducts, bile ducts, and gall bladder [27]. This parasite requires two intermediate hosts, a snail, followed by a second intermediate host such as skink, gecko, lizard, or toad. A cat can be infected with Platynosomum sp. after ingesting an infected second intermediate host. The clinical signs of Platynosomum sp. infection vary from asymptomatic to progressive disease, and it can also cause death due to hepatic failure and biliary tract obstruction. Biological samples of the liver, bile ducts, and feces were obtained from the shelter cats in this study, in which Platynosomum sp. was detected in 4 out of 7 FeMV-positive cats. Although this finding was incidental, co-infection of FeMV and Platynosomum sp. should be further explored, especially in shelter cat populations, given that this cohort of cats could potentially harbor many pathogens.

The developed qRT-PCR assay can be utilized for field samples given its high specificity and novelty of targeting the N gene of FeMV. Although there has yet a clear indication on whether or not this virus is involved in the pathogenesis of chronic kidney disease in cats, further studies are needed to determine the extent of infection among cats and its clinical significance.

Conclusion

In conclusion, a probe-based qRT-PCR assay targeting the N gene of FeMV has been successfully optimized and validated. This study is the first quantitative assay targeting the FeMV-N gene, which is integral in RNA synthesis by RdRp complex. Even though the developed assay demonstrated a lower sensitivity compared to the previously designed qRT-PCR assay targeting L and P/V/C gene; in comparison to the conventional RT-PCR, it can detect samples with low viral load. Hence, the developed qRT-PCR assay can be applied in diagnostic and quantification of the FeMV viral load, especially during the early stage of infection.

Materials and methods

Total RNA extraction and cDNA synthesis

The total RNA extraction for collected samples was performed by using Direct-zol™ RNA MiniPrep Plus kit (Zymo Research, California, United States) following the manufacturer’s guidelines. Extracted RNA was first subjected to cDNA synthesis prior to conventional RT-PCR and qRT-PCR assays. cDNA synthesis was performed by using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK) with 20 μL reaction consisting of 10 μL purified RNA, 4 μL of 5x TransAmp Buffer, 1 μL of reverse transcriptase, and 5 μL of nuclease-free water. The reaction was carried out at 25 °C for 10 min, 42 °C for 15 min, 48 °C for 15 min, and 85 °C for 5 min. The cDNA was stored at − 20 °C until use.

TaqMan-based real-time RT-PCR (qRT-PCR) assay

Primer set and probe were designed based on partial N gene sequences of FeMV-Malaysia isolates (UPM23, UPM52, UPM53, UPM210, UPM231, UPM305, and UPM315) using Integrated DNA Technologies (IDT) software (Table 4). The designed probe and primer set were then compared with the alignment of closely related FeMV from other countries’ isolates: Japan (SS3, MiJP003, ChJP073), China (M252A), and Thailand (Thai-U16) (Table 4). Specific sequences for primers and probe used to yield 122 bp PCR amplicons are as follows: forward primer, GGTCAAGAGATGGTGAGAAGAT; reverse primer, CCAGATTCACCTCCCGAATTA; and probe, TTTGCGCGAGAACTTGGGCTATCT. The FeMV TaqMan probe was labeled with 6-FAM at 5′-end, and fluorescence quencher, ZEN and IBFQ at an internal site and 3′-end, respectively. Real-time RT PCR was performed using CFX96 machine (Bio-Rad, California, USA) utilizing SensiFAST™ Probe NO-ROX Kit (Bioline, London, UK) following the manufacturer’s suggestion. Briefly, each reaction well consisted of 4 μL cDNA, 10 μL of 2x SensiFAST Probe No-ROX Mix, a final concentration of 400 nM for each forward and reverse FeMV primers, 100 nM probe, and nuclease-free water up to the final volume of 20 μL. The assay was performed at 95 °C for 2 min, followed by 35 cycles at 95 °C for 15 s and 54 °C for 45 s, where each sample was run in triplicates.

Table 4.

GenBank accession number

Isolate Accession Number
SS3 LC036587
MiJP003 AB924121
ChJP073 AB924122
M252A JQ411016
Thai-U16 MF627832
UPM23 MN264638
UPM52 MN264639
UPM53 MN264640
UPM210 MN264641
UPM231 MN264642
UPM305 MN792827
UPM315 MN792828

Standard RNA preparation

Generation of standard RNA was prepared by subcloning the partial sequence of ~ 1.5 kb FeMV-N gene into a pSC-A-amp/kan plasmid vector by using StrataClone PCR cloning kit (Agilent Technologies, California, United States) according to the manufacturer’s instruction. After linearization, RNA transcription was performed using the Riboprobe® in vitro Transcription Systems (Promega, Wisconsin, United States) with the T7 RNA polymerase promoter site available in vector pSC-A-amp/kan following the manufacturer’s direction. After DNase treatment, the transcript was purified by phenol-chloroform purification and quantified by using spectrophotometer (Bio-Rad, California, USA). The copy number of cRNA calculated was 1.74 × 1011 copies/μL. cRNA was diluted in 10-fold serial dilution and converted into cDNA prior to standard curve generation.

Specificity and sensitivity

The specificity of the developed assay was assessed by testing on viral RNA from same genus, which were canine distemper virus (CDV) and measles virus (MeV), from the same family, Newcastle disease virus (NDV), and from other feline viruses, which were feline leukemia virus (FeLV) and feline coronavirus (FCoV) (Table 5).

Table 5.

List of viruses used in this study and its sources

Virus Source
Canine distemper virus (CDV) Nobivac Puppy DP, Intervet
Measles virus (MeV) Serum Institute of India LTD, Pune
Newcastle disease virus (NDV) Department of Vet. Pathology and Microbiology, UPM
Feline leukemia virus (FeLV) Department of Vet. Pathology and Microbiology, UPM
Feline coronavirus (FCoV) Department of Vet. Pathology and Microbiology, UPM

The sensitivity of qRT-PCR assay was assessed by running 10-fold serial dilution of cRNA standard (from 1.74 × 1011 to 1.74 × 102 copies/μL) to detect the threshold limit of the assay. Ten different 10-fold serial dilutions were performed by adding 1 μL of RNA into 9 μL of nuclease-free water. The mixture was then vortexed for at least 10 s before the same step was repeated for the next dilution. Each of the diluted RNA, along with the stock RNA control, was converted into cDNA and subjected for qRT-PCR in triplicates.

Reproducibility

In order to assess reproducibility of the developed assay, three different positive samples were selected, which were then subjected for intra- and inter-assay. Three different positive samples (UPM23, UPM52, UPM202) were assayed in the same run in triplicates to evaluate the intra-assay variations. In order to assess for inter-assay variations, the same three samples were subjected for three different consecutive runs in triplicates. Values for mean, standard deviation (SD), and coefficient of variations (CV) for both variation assays were calculated by using Microsoft Excel Software (version 2016, USA).

Clinical samples collection

Animal ethics application was approved by the Institutional Animal Care and Use Committee (IACUC) of Universiti Putra Malaysia (UPM/IACUC/AUP-R037/2018). Convenient sampling was performed, whereby urine (n = 55) and kidney samples (n = 16) of cats were collected from veterinary hospital, private veterinary clinics and animal shelters around Klang Valley, Malaysia. The cats presented to the veterinary hospital or private veterinary clinics were either presented for annual health examination, neutering procedure, or due to health-related issues, such as kidney-related and heart diseases. Samples of cats with their serum urea-creatinine data available were further sub-grouped into cats with the presence or absence of kidney-related disease based on the International Renal Interest Society (IRIS) Guidelines. The owner’s consent was requested prior to sample collection. When available, kidney samples (n = 16) from post-mortem and corresponding urine samples (n = 16) were collected from animal shelters.

Sample processing

A urine sample was collected into a sterile sample collection bottle either by cystocentesis or manual compression. The supernatant of urine was obtained after a centrifugation step at 2320×g for 5 min. Then, the supernatant was mixed with RNAlater® solution (Ambion, Texas, United States) at a ratio of 1:1 and stored at − 20 °C prior to the RNA extraction. During postmortem, the collected kidney samples were immediately transferred into a sterile collection bottle containing RNAlater® solution. For sample processing, kidney tissues of approximately 1 g were cut into small pieces and crushed by using the pestle and mortar along with sterile sand. Phosphate-buffer saline solution (Gibco, Massachusetts, United States) of 1 g/mL was added into the homogenized kidney. Next, the mixture was transferred into a 15-mL tube to be centrifuged at 2320×g for 5 min to remove any large debris and sand. The kidney lysate was then subjected for total RNA extraction.

Clinical samples evaluation using TaqMan-based qRT-PCR and conventional RT-PCR

Converted cDNA clinical samples were assessed by conventional RT-PCR using published primers (Table 6) with cDNA of UPM52 as a positive control, together with no-template control following a modified protocol (Table 7).

Table 6.

Primer sequences used to amplify two different regions of N gene

Region Primer Sequence (5′-3′) Product size (bp) Source
Middle region FN-2F GTTAGCTTAGGATTTGAGAACCC 680 bp [12]
FN-2R CACCATCTCTTGACCAAGTCT
End region FN-3F GCTATGGAGTTATGCCATGGG 637 bp
FN-3R GTTGTGAACCTTGAGGTCCTAAG

Table 7.

PCR protocol applied for two different primer sets of N gene

Step Temperature Time Cycle
Initial denaturation 95 °C 1 min 1x
Denaturation 95 °C 15 s
Annealing 58 °C 1 min 35x
Extension 72 °C 1 min
Final extension 72 °C 5 min 1x
Hold 12 °C 1x

TaqMan-based qRT-PCR was performed according to the developed protocol described above with each sample ran in triplicates along with NTC and cDNA of positive control (UPM52). Nuclease-free water (Promega, Wisconsin, United States) was used as template in NTC in both conventional RT-PCR and qRT-PCR assays.

Platynosomum sp. detection from postmortem of shelter cats

Liver, bile duct, and feces samples in rectum were collected in the postmortem investigation of shelter cats to detect the presence of Platynosomum sp. Liver samples were used to collect adult fluke, while bile duct and feces samples were used to detect ova. In order to allow for activation and collection of mature flukes, liver samples were extracted and immersed in warm water (38 °C–40 °C). Parasitic burden was calculated using the formula described in a previous study by applying the number of adult flukes collected per sample [28]. For ova collection from bile juice and feces samples, any ova isolated from these clinical samples were pipetted into microcentrifuge tubes with normal saline and they were stored in − 20 °C for further analysis. In fecal examination, two different methods were performed to detect fluke eggs: the simple floatation technique and centrifugal fecal sedimentation test in formal-ether solution [29, 30]. Adult fluke and ova were identified based on a previous study [31].

Acknowledgments

We would like to thank Drs. Hemadevy, Khor Kuan Hua and Salehatul Khuzaimah for the assistance in collecting samples. We are deeply grateful for the technical assistance and troubleshooting provided by Dr. Zarirah Mohamed Zulperi on the plasmid cloning and standard RNA preparation work. We would also like to thank all participating veterinary clinics, veterinary hospital, and animal shelters, especially the cats and their owners for allowing us to perform sample collection for the purposes of this research.

Abbreviations

qRT-PCR

Quantitative reverse transcription polymerase chain reaction

FeMV

Feline morbillivirus

CDV

Canine distemper virus

NDV

Newcastle disease

MeV

Measles virus

FCoV

Feline coronavirus

FeLV

Feline leukemia virus

RT-PCR

Reverse transcription polymerase chain reaction

N

Nucleocapsid protein

L

Large protein

P

Phosphoprotein

RdRp

RNA-dependent RNA polymerase

F

Fusion protein

H

Hemagglutinin protein

M

Matrix protein

RNP

Ribonucleoprotein

FURD

Feline upper respiratory disease

FLUTD

Feline lower urinary tract disease

IDT

Integrated DNA technologies

IACUC

Institutional animal care and use committee

UVH

University veterinary hospital

IRIS

International renal interest society

Authors’ contributions

FMK contributed to the conception, designing, and revising the manuscript. STM contributed to the data collection, laboratory work, drafting, and writing the manuscript. ARO and TSW contributed to the conception, data analyses, and revision of the manuscript. NAAA and NAN contributed to the data collection, laboratory work, and revising the manuscript. All authors have read and approved the manuscript.

Funding

This study was supported by the Universiti Putra Malaysia internal grant (Grant No: GP-IPS/2017/9536900). The funding body has no specific role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Availability of data and materials

All data generated or analyzed in this study can be obtained within the tables and figures of the manuscript.

Declarations

Ethics approval and consent to participate

Animal ethics application was approved from the Institutional Animal Care and Use Committee (IACUC) of Universiti Putra Malaysia (UPM/IACUC/AUP-R037/2018) prior to sample collection. Informed consent was obtained from the cat owners prior to sample collection. Hence, the use of cats in this study met the criteria of animal welfare regulations in Malaysia.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Siti Tasnim Makhtar, Email: tasnimakhtar82@gmail.com.

Sheau Wei Tan, Email: tansheauwei@gmail.com.

Nur Amalina Nasruddin, Email: malinanasruddin.nan@gmail.com.

Nor Azlina Abdul Aziz, Email: azlinaaziz@upm.edu.my.

Abdul Rahman Omar, Email: aro@upm.edu.my.

Farina Mustaffa-Kamal, Email: farina@upm.edu.my.

References

  • 1.Rima B, Balkema-Buschmann A, Dundon WG, Duprex P, Easton A, Fouchier R, Kurath G, Lamb R, Lee B, Rota P, Wang L, ICTV Report Consortium ICTV virus taxonomy profile: Paramyxoviridae. J Gen Virol. 2019;100(12):1593–1594. doi: 10.1099/jgv.0.001328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.SCaS T. First evidence of feline morbillivirus detected in sheltered cats in Thailand. Thai J Vet Med Suppl. 2017;47:127–128. [Google Scholar]
  • 3.Darold GM, Alfieri AA, Muraro LS, Amude AM, Zanatta R, Yamauchi KC, Alfieri AF, Lunardi M. First report of feline morbillivirus in South America. Arch Virol. 2017;162(2):469–475. doi: 10.1007/s00705-016-3124-0. [DOI] [PubMed] [Google Scholar]
  • 4.Yilmaz H, Tekelioglu BK, Gurel A, Bamac OE, Ozturk GY, Cizmecigil UY, Altan E, Aydin O, Yilmaz A, Berriatua E, Helps CR, Richt JA, Turan N. Frequency, clinicopathological features and phylogenetic analysis of feline morbillivirus in cats in Istanbul, Turkey. J Feline Med Surg. 2017;19(12):1206–1214. doi: 10.1177/1098612X16686728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sharp CR, Nambulli S, Acciardo AS, Rennick LJ, Drexler JF, Rima BK, Williams T, Duprex WP. Chronic infection of domestic cats with feline morbillivirus, United States. Emerg Infect Dis. 2016;22(4):760–762. doi: 10.3201/eid2204.151921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lorusso A, Di Tommaso M, Di Felice E, Zaccaria G, Luciani A, Marcacci M, Aste G, Boari A, Savini G. First report of feline morbillivirus in Europe. Vet Ital. 2015;51(3):235–237. doi: 10.12834/VetIt.833.4136.2. [DOI] [PubMed] [Google Scholar]
  • 7.Furuya T, Sassa Y, Omatsu T, Nagai M, Fukushima R, Shibutani M, Yamaguchi T, Uematsu Y, Shirota K, Mizutani T. Existence of feline morbillivirus infection in Japanese cat populations. Arch Virol. 2014;159(2):371–373. doi: 10.1007/s00705-013-1813-5. [DOI] [PubMed] [Google Scholar]
  • 8.Woo PC, Lau SK, Wong BH, Fan RY, Wong AY, Zhang AJ, Wu Y, Choi GK, Li KS, Hui J, et al. Feline morbillivirus, a previously undescribed paramyxovirus associated with tubulointerstitial nephritis in domestic cats. Proc Natl Acad Sci U S A. 2012;109(14):5435–5440. doi: 10.1073/pnas.1119972109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cox R, Plemper RK. The paramyxovirus polymerase complex as a target for next-generation anti-paramyxovirus therapeutics. Front Microbiol. 2015;6:459. doi: 10.3389/fmicb.2015.00459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sourimant J, Plemper RK. Organization, function, and therapeutic targeting of the morbillivirus RNA-Dependent RNA polymerase complex. Viruses. 2016;8(9):251. [DOI] [PMC free article] [PubMed]
  • 11.Baron MD: The Molecular Biology of Peste des Petits Ruminants Virus. In: Peste des Petits Ruminants Virus. edn.; 2015: 11–38.
  • 12.Park ES, Suzuki M, Kimura M, Maruyama K, Mizutani H, Saito R, Kubota N, Furuya T, Mizutani T, Imaoka K, Morikawa S. Identification of a natural recombination in the F and H genes of feline morbillivirus. Virology. 2014;468-470:524–531. doi: 10.1016/j.virol.2014.09.003. [DOI] [PubMed] [Google Scholar]
  • 13.Sieg M, Heenemann K, Ruckner A, Burgener I, Oechtering G, Vahlenkamp TW. Discovery of new feline paramyxoviruses in domestic cats with chronic kidney disease. Virus Genes. 2015;51(2):294–297. doi: 10.1007/s11262-015-1232-7. [DOI] [PubMed] [Google Scholar]
  • 14.Furuya T, Wachi A, Sassa Y, Omatsu T, Nagai M, Fukushima R, Shibutani M, Yamaguchi T, Uematsu Y, Shirota K, Mizutani T. Quantitative PCR detection of feline morbillivirus in cat urine samples. J Vet Med Sci. 2016;77(12):1701–1703. doi: 10.1292/jvms.15-0112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mohd Isa NH, Selvarajah GT, Khor KH, Tan SW, Manoraj H, Omar NH, Omar AR, Mustaffa-Kamal F. Molecular detection and characterisation of feline morbillivirus in domestic cats in Malaysia. Vet Microbiol. 2019;236:108382. doi: 10.1016/j.vetmic.2019.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.De Luca E, Crisi PE, Di Domenico M, Malatesta D, Vincifori G, Di Tommaso M, Di Guardo G, Di Francesco G, Petrini A, Savini G, et al. A real-time RT-PCR assay for molecular identification and quantitation of feline morbillivirus RNA from biological specimens. J Virol Methods. 2018;258:24–28. doi: 10.1016/j.jviromet.2018.05.002. [DOI] [PubMed] [Google Scholar]
  • 17.Sakaguchi S, Nakagawa S, Yoshikawa R, Kuwahara C, Hagiwara H, Asai KI, Kawakami K, Yamamoto Y, Ogawa M, Miyazawa T. Genetic diversity of feline morbilliviruses isolated in Japan. J Gen Virol. 2014;95(Pt 7):1464–1468. doi: 10.1099/vir.0.065029-0. [DOI] [PubMed] [Google Scholar]
  • 18.Diallo A. Morbillivirus group genome organisation and protein.Pdf>. Vet Microbiol. 1990;23(1-4):155–163. doi: 10.1016/0378-1135(90)90145-L. [DOI] [PubMed] [Google Scholar]
  • 19.De Luca E, Crisi PE, Marcacci M, Malatesta D, Di Sabatino D, Cito F, D'Alterio N, Puglia I, Berjaoui S, Colaianni ML, et al. Epidemiology, pathological aspects and genome heterogeneity of feline morbillivirus in Italy. Vet Microbiol. 2020;240:108484. doi: 10.1016/j.vetmic.2019.108484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Koide R, Sakaguchi S, Ogawa M, Miyazawa T. Rapid detection of feline morbillivirus by a reverse transcription loop-mediated isothermal amplification. J Vet Med Sci. 2016;78(1):105–108. doi: 10.1292/jvms.15-0239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Shabbir MZ, Rahman AU, Munir M. A comprehensive global perspective on phylogenomics and evolutionary dynamics of small ruminant morbillivirus. Sci Rep. 2020;10(1):17. doi: 10.1038/s41598-019-54714-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Thakkar VD, Cox RM, Sawatsky B, da Fontoura BR, Sourimant J, Wabbel K, Makhsous N, Greninger AL, von Messling V, Plemper RK. The unstructured paramyxovirus nucleocapsid protein tail domain modulates viral pathogenesis through regulation of transcriptase activity. J Virol. 2018;92(8):e02064-17.   [DOI] [PMC free article] [PubMed]
  • 23.Communie G, Ruigrok RW, Jensen MR, Blackledge M. Intrinsically disordered proteins implicated in paramyxoviral replication machinery. Curr Opin Virol. 2014;5:72–81. doi: 10.1016/j.coviro.2014.02.001. [DOI] [PubMed] [Google Scholar]
  • 24.Vetter TR, Schober P, Mascha EJ. Diagnostic testing and decision-making: beauty is not just in the eye of the beholder. Anesth Analg. 2018;127(4):1085–1091. doi: 10.1213/ANE.0000000000003698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Park ES, Suzuki M, Kimura M, Mizutani H, Saito R, Kubota N, Hasuike Y, Okajima J, Kasai H, Sato Y, Nakajima N, Maruyama K, Imaoka K, Morikawa S. Epidemiological and pathological study of feline morbillivirus infection in domestic cats in Japan. BMC Vet Res. 2016;12(1):228. doi: 10.1186/s12917-016-0853-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Stranieri A, Lauzi S, Dallari A, Gelain ME, Bonsembiante F, Ferro S, Paltrinieri S. Feline morbillivirus in northern Italy: prevalence in urine and kidneys with and without renal disease. Vet Microbiol. 2019;233:133–139. doi: 10.1016/j.vetmic.2019.04.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Javinsky E. Chapter 23 - Digestive System, Liver, and Abdominal Cavity. In: Little SE, editor. The Cat. Saint Louis: W.B. Saunders; 2012. pp. 425–546. [Google Scholar]
  • 28.Margolis L, Esch GW, Holmes JC, Kuris AM, Schad GA. The use of ecological terms in parasitology (report of an ad hoc Committee of the American Society of Parasitologists) J Parasitol. 1982;68(1):131–133. doi: 10.2307/3281335. [DOI] [Google Scholar]
  • 29.AMZaGA C. Veterinary clinical parasitology. 8. Ames, Iowa: Blackwell Publishing Professional; 2012. [Google Scholar]
  • 30.Ritchie LS. An ether sedimentation technique for routine stool examinations. Bull U S Army Med Dep. 1948;8(4):326. [PubMed] [Google Scholar]
  • 31.Bray RA, Gibson DI, Jones A. Wallingford, UK and the Natural History Museum. London: CABI Publishing; 2008. Keys to the Trematode. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed in this study can be obtained within the tables and figures of the manuscript.


Articles from BMC Veterinary Research are provided here courtesy of BMC

RESOURCES