Generation of six induced pluripotent stem cell lines from patients with amyotrophic lateral sclerosis with associated genetic mutations in either FUS or ANXA11

Highlights

• •Induced pluripotent stem cell models of amyotrophic lateral sclerosis are lacking.
• •Genetic mutations in FUS and ANXA11 cause amyotrophic lateral sclerosis.
• •Six new patient iPSC lines with mutations in FUS or ANXA11 have been characterised.

Abstract

Amyotrophic lateral sclerosis (ALS) is characterized by degeneration of upper and lower motor neurons, causing gradual paralysis, and resulting in death 3–5 years from diagnosis. ALS causative mutations have been identified in multiple genes, including Fused in sarcoma (FUS), and recently characterized Annexin A11 (ANXA11). We have derived induced pluripotent stem cell (iPSC) lines from six ALS patient lymphoblastoid cell lines, three with mutations in FUS (Q519E, R521H, R522G), and three with mutations in ANXA11 (G38R, D40G, R235Q). These lines have been characterized and provide a novel resource for investigation into ALS pathology.

Resource Table:

Unique stem cell lines identifier	KCLi008-A KCLi009-A KCLi010-A KCLi011-A KCLi012-A KCLi013-A
Alternative names of stem cell lines	N/A
Institution	UK Dementia Research Institute, Basic & Clinical Neuroscience, Maurice Wohl Clinical Neuroscience Institute, King’s College London, London, UK
Contact information of distributor	Motor Neurone Disease Association: mndcollections@mndassociation.org Agnes Nishimura: agnes.nishimura@kcl.ac.uk Erin Hedges: erin.hedges@kcl.ac.uk Chris Shaw: chris.shaw@kcl.ac.uk
Type of cell lines	iPSC
Origin	Human
Cell Source	Lymphoblastoid cell line
Clonality	Clonal
Method of reprogramming	Non-integrating episomal plasmids containing Oct3/4, Sox2, KLF4, L-myc, LIN28, and shRNA against p53 (KCLi008-A, KCLi009-A, KCLi010-A, KCLi012-A, KCLi013-A) Sendai Virus containing KLF4, Oct3/4, Sox2, and c-Myc (KCLi011-A)
Multiline rationale	All lines were derived from patients with a positive diagnosis for amyotrophic lateral sclerosis, and were derived from lymphoblastoid cell lines from the MND Collections
Gene modification	Yes
Type of modification	Hereditary
Associated disease	N/A
Gene/locus	N/A
Method of modification	N/A
Name of transgene or resistance	N/A
Inducible/constitutive system	N/A
Date archived/stock date	KCLi008-A – 18/05/2018 KCLi009-A – 18/05/2018 KCLi010-A – 18/05/2018 KCLi011-A – 18/05/2018 KCLi012-A – 18/05/2018 KCLi013-A – 18/05/2018
Cell line repository/bank	These lines constitute part of the MND Collections https://www.mndassociation.org/research/for-researchers/resources-for-researchers/ukmndcollections/
Ethical approval	National Research Ethics Service (NRES) RES 14/EM/1088

1. Resource utility

Amyotrophic lateral sclerosis (ALS) is a highly heterogeneous disease, and stem cell models for many ALS associated genes are lacking (Hedges et al., 2016). We therefore reprogrammed MND Collections lymphoblastoid cell lines (LCLs) from six patients, with mutations in either Fused in sarcoma (FUS) or Annexin A11 (ANXA11), into iPSCs.

2. Resource details

The MND Collections is home to many ALS patient and control blood derived cell lines, initially established for ALS DNA and gene hunting studies. We have repurposed some of these lines by utilising the resource to produce iPSCs. We aimed to establish iPSC lines with rare ALS associated mutations to increase availability of these models to the research community. Lines were selected for reprogramming based on positive ALS diagnosis alongside a confirmed ALS associated mutation in either FUS or ANXA11. Specific details about the mutations and cell line donors are included in Table 1.

Table 1.

Summary of lines.

iPSC line names	Abbreviation in figures	Gender	Age	Ethnicity	Genotype of locus	Disease
KCLi008-A	N/A	Male	52	Chinese	NM_004960: c.1549C > G	Familial ALS
KCLi009-A	N/A	Female	44	Caucasian	NM_004960: c.1562G > A	Familial ALS
KCLi010-A	N/A	Male	29	Caucasian	NM_004960: c.1564A > G	Familial ALS
KCLi011-A	N/A	Male	51	Caucasian	NM_001157: c.112G > A	Familial ALS
KCLi012-A	N/A	Female	75	Caucasian	NM_001157: c.119A > G	Familial ALS
KCLi013-A	N/A	Female	66	Caucasian	NM_001157: c.704G > A	Sporadic ALS

iPSCs were derived from LCLs with either episomal plasmids (KCLi008-A, KCLi009-A, KCLi010-A, KCLi012-A, KCLi013-A) or Sendai Virus (KCLi011-A); both non-integrating methods of reprogramming. Once iPSC lines were established, clones evidencing typical iPSC morphology and colony formation were selected and expanded. Colonies of small round cells with large nuclei, indicating normal iPSC morphology, were observed after multiple passages (passage 21 – passage 29) as represented by phase contrast images of iPSCs (Fig. 1a, scale bars represent 400 µM). Protein expression of the pluripotency markers Oct3/4 and Nanog was confirmed by immunocytochemistry (Fig. 1a, scale bars represent 30 µM). Quantitative RT-PCR was performed to measure expression levels of the pluripotency genes KLF4, LIN28, and c-Myc in iPSCs. Data was normalised to housekeeping genes SDHA and GAPDH and calculated as fold change compared to LCL (ΔΔCt), with wild-type iPSC RNA included as a positive control (Fig. 1b). Spontaneous differentiation of iPSCs in the context of the embryoid body assay was used to evidence differentiation potential. Detection of cells from the mesoderm (smooth muscle actin; SMA), endoderm (alpha-fetoprotein; AFP), and ectoderm (β3-Tubulin) confirmed tri-lineage differentiation potential (Fig. 1c, co-stained with DAPI (blue), scale bars represent 30 µM).

Fig. 1.

Induced pluripotent stem cell characterisation.

STR profiling was completed to confirm iPSC lineage from parent LCL lines (data not shown, submitted with journal for archive), and G-band karyotype analysis was performed to confirm the absence of major chromosomal abnormalities (Fig. 1d, Supplementary Fig. 1ai-av). Analysis of up to 20 metaphases was attempted for each cell line, however technical difficulties meant that fewer metaphases were suitable for analysis (KCLi008-A, 18 metaphases; KCLi009-A, 18 metaphases; KCLi010-A, 15 metaphases; KCLi011-A, 17 metaphases; KCLi012-A, 9 metaphases; KCLi013-A, 14 metaphases). Presence of ALS associated genetic mutations in established iPSC lines was confirmed by Sanger sequencing (Fig. 1f, Supplementary Fig. 1ci-cv).

Lymphoblastoids are generated by transduction of B-lymphocytes with Epstein Barr Virus (EBV) genes. This results in immortalisation, allowing the cells to continuously proliferate under specific cell culture conditions. To confirm the absence of EBV genes in iPSCs, newly selected iPSC clones were serially passaged to induce loss of EBV genes. PCR was performed against EBV elements EBNA2, LMP1, BZLF, and OriP, and the housekeeping gene SDHA was amplified as a positive control. iPSCs were characterised and cryopreserved when EBV genes were no longer detected, which occurred between passage 7–26 (Fig. 1e, Supplementary Fig. 1bi-bv). Stock iPSCs were routinely subject to mycoplasma screening to confirm the absence of contamination in banked cells (Supplementary Table 1). A summary of the characterization and validation experiments is included in Table 2.

Table 2.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Phase contrast images of iPSCs in culture	Colonies of small, rounded cells with large nuclei observed	Fig. 1a
Phenotype	Immunocytochemistry to detect Oct3/4 and Nanog	Positive staining observed	Fig. 1a
	RT-qPCR for expression levels of KLF4, LIN28 and c-Myc	Upregulated expression of pluripotency markers in iPSCs compared to LCLs	Fig. 1b
Genotype	G-band karyotype analysis (330-440bphs)	Normal karyotype identified	Fig. 1d, Supplementary Fig. 1ai-av
Identity	STR analysis	Sixteen loci assessed and aligned across LCL and iPSC DNA	Submitted in archive with journal
Mutation analysis	Sanger sequencing	Confirmation of ALS associated mutation in iPSC DNA	Fig. 1f, Supplementary Fig. 1ci-cv
Microbiology and virology	MycoAlertTM Mycoplasma Detection Kit	Negative	Supplementary Table 1
Differentiation potential	Embryoid body formation	Positive detection of trilineage potential through ICC probing for smooth muscle actin (SMA), β3-tubulin, and alpha-fetoprotein (AFP)	Fig. 1c
Donor screening	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

3. Materials and methods

All reagents were purchased from Thermo Fisher Scientific, unless otherwise stated.

3.1. Generation of human iPSCs with episomal plasmids

Generation of iPSCs from LCLs was achieved via nucleofection with plasmids containing pluripotency genes and shRNA targeting p53, as previously reported (Rajesh et al., 2011). Nucleofection was performed following the Amaxa™ Human B Cell Nucleofector™ kit (Lonza, #VPA-1001). One million LCLs were nucleofected with 1.5 µg of each plasmid (addgene codes: #20927, #27077, #27080, #27078), and LCLs were plated directly onto mouse embryonic fibroblasts (MEF) (Merck Millipore, #PMEF-CLF-C) that had been inactivated with 10 µg/mL mitomycin C (Sigma-Aldrich, #M4287). These were maintained in LCL media (RMPI 1640 (#21875034), 10% fetal bovine serum (#10270106)), for 5 days, then media was transitioned to reprograming media (RM) (DMEM/F12 with GlutaMAX (#31331028), 1x non-essential amino acids (NEAA) (#11140035), 1xN2 (#17502001), 1xB27 (#17504044), 0.1 µM β-mercaptoethanol (#31350010), 100 ng/mL bFGF (PeproTech, #100-18B), 1000 units/mL hLIF (Merck Millipore, #LIF1010), 0.5 µM PD-0325901 (BioVision, #1990–1), 3 µM CHIR99021 (Cayman Chemical, #13122), 10 µM HA-100 (Santa-Cruz, #SC-203072), 0.5 µM A83-01 (BioVision, #1989-1). RM was then replaced every 1–2 days. Approximately 15 days after nucleofection, small iPSC colonies were identified, and media was transitioned to Essential 8™ Flex medium (#A2858501) until colonies were large enough for manual picking. Once collected, new iPSC colonies were transferred to Geltrex™ (#A1413202) coated plates in Essential 8™ Flex medium (#A2858501) supplemented with 10 µM Rock inhibitor (BioVision, #1596).

3.2. Generation of human iPSCs with Sendai Virus

iPSCs were generated from LCLs with Sendai virus using the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (#A16517). On day one, 150,000 cells were transduced as per manufacturer instructions, with an additional centrifugation step of 2250 RPM for 90 min in a large benchtop centrifuge, immediately after the virus was added to LCLs. LCLs were maintained in LCL media (RMPI 1640 (#21875034), 10% fetal bovine serum (#10270106)) for 48 h, with a media change at 24 h. LCLs were transferred onto MEF (Merck Millipore, #PMEF-CLF-C) that had been previously inactivated with 10µg/mL mitomycin C (Sigma-Aldrich, #M4287), and were maintained in LCL media until day 5. Transition to reprogramming media (RM) and selection of colonies was then completed as described in 3.1.

3.3. iPSC maintenance

iPSCs were maintained in Essential 8™ Flex medium (#A2858501) as per manufacture instructions, on Geltrex™ (#A1413302) coated culture-ware in 5% O_2, 5% CO_2, 37 °C incubators. Established lines were routinely passaged with Versene (Lonza, #BE17-711E) approximately once every 7 days. iPSCs were cryopreserved in freezing media consisting of Essential 8™ Flex with 10uM Rock inhibitor (BioVision, #1596) and 10% DMSO (Sigma-Aldrich, #D2650). Vials of cryopreserved cells were transferred to liquid nitrogen for long term storage. iPSC stocks were tested for absence of mycoplasma infection using the MycoAlert™ Detection Kit (Lonza, #LT07-118).

3.4. Loss of EBV genes

DNA was extracted from serially passaged iPSCs using the DNeasy Blood & Tissue Kit (Qiagen, #69504). PCR was performed using primers targeting EBV specific genes EBNA2, LMP1, BZLF and oriP, and the housekeeping gene SDHA (Table 3), using Q5® High-Fidelity 2X Master Mix (NEB, #M0492S) with 35 cycles of 95 °C for 30 s, 61 °C for 30 s, and 72 °C for 30 s. PCR products were separated by gel electrophoresis in 4% agarose gels with 1% ethidium bromide, then visualized and photographed inside a UV transilumiator.

Table 3.

Reagents details.

Antibodies used for immunocytochemistry
	Antibody	Dilution	Company Cat # and RRID
Pluripotency markers	Goat anti-Oct3/4	1:200	Santa Cruz; sc-8628; RRID:AB_653551
	Rabbit anti-Nanog	1:200	Abcam; ab80892; RRID:AB_2150114
Embryoid body markers	Mouse anti-β3-tubulin	1:400	Sigma Aldrich; T8660; RRID:AB_477590
	Rabbit anti-smooth muscle actin	1:200	Abcam; ab5694; RRID:AB_2223021
	Goat anti-alpha fetoprotein	1:200	Santa Cruz; sc-8108; RRID:AB_633815
Secondary antibodies	Dylight 488 Donkey anti-Mouse IgG	1:400	Thermo Fisher Scientific; SA5-10166; RRID:AB_2556746
	Dylight 488 Donkey anti-goat IgG	1:400	Thermo Fisher Scientific; SA5-10086; RRID:AB_2556666
	Dylight 550 Donkey anti-goat IgG	1:400	Thermo Fisher Scientific; SA5-10087; RRID:AB_2556667
	Dylight 550 Donkey anti-rabbit IgG	1:400	Thermo Fisher Scientific; SA5-10039; RRID:AB_2556619
	Dylight 650 Donkey anti-mouse IgG	1:400	Thermo Fisher Scientific; SA5-10169; RRID:AB_2556749
Primers
	Target	Forward/Reverse primer (5′-3′)
Pluripotency maker (qPCR)	KLF4	ACTTGTGTTACGCGGGCTTG, CGGGCGAATTTCCATCCACA
Pluripotency maker (qPCR)	LIN28	GAAGCGCAGATCAAAAGGAG, GCTGATGCTCTGGCAGAAGT
Pluripotency maker (qPCR)	c-Myc	AAGACTCCAGCGCCTTCTCT, TGGGCGGTGTCTCCTCATG
House-keeping gene (qPCR)	GAPDH	TGTTGCCATCAATGACCCCTT CTCCACGACGTACTCAGCG
House-keeping gene (qPCR and PCR)	SDHA	TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCATG
EBV gene (PCR)	EBNA2	CATAGAAGAAGAAGAGGATGAAGA GTAGGGATTCGAGGGAATTACTGA
EBV gene (PCR)	BZLF	CACCTCAACCTGGAGACAAT TGAAGCAGGCGTGGTTTCAA
EBV gene (PCR)	LMP1	ATGGAACACGACCTTGAGA TGAGCAGGATGAGGTCTAGG
EBV gene (PCR)	OriP	TCGGGGGTGTTAGAGACAAC TTCCACGAGGGTAGTGAACC
Genotyping	FUS R521H, R522G	TACTCGCTGGGTTAGGTAGG, CATAGCTGGGCAAATTTAGG
Genotyping	FUS Q519E	GAGCTGGGACCAAAGAATCC, CCCCTGAGTTAATTTTCCTTCC
Genotyping	ANXA11 G38R, D40G	CCTGGGAGCTCTCATCTCTG GGAAAAGTGAGACCCAGAGAG
Genotyping	ANXA11 R235Q	TGTGGACTCCTTTAGATACTCCAAC CTCCTGCTCCTTACTGTCCATC

3.5. Karyotyping

iPSCs between passages 14–16 were treated with 100 nM methotrexate for 16 h, followed by 10 µM thymidine for 5 h, then 1x KaryoMax™ Colcemid™ Solution (#15212012) for 10 min. Treated iPSCs were dissociated to single cell suspension with StemPro™ Accutase™ Cell Dissociation Reagent (#A1110501), resuspended in hypotonic KCl (#10575090), and incubated at 37 °C for 10 min. Ice cold fixative made from methanol and acetic acid in a 3:1 ratio was gently added. Cells were centrifuged at 1000 rpm for 4 min, supernatant was removed, and cells were resuspended in fresh ice-cold fixative a total of 3 times. Spread of metaphases and analysis was outsourced to TDL Genetics (London, UK), and receipt of karyotype analysis confirmed normal karyotype. Up to 20 metaphases were analysed, however fewer metaphases were assessed due to technical difficulties, and no abnormal karyotypes were identified.

3.6. Immunocytochemistry

iPSCs plated on glass coverslips coated with Geltrex were fixed with 4% paraformaldehyde for 15 min at room temperature. Fixed cells were permeabilised for 15 min with 0.25% Triton X-100 in PBS, and blocked with 10% donkey serum (Sigma-Aldrich, #D9663) for 1 h at room temperature. Cells were incubated with primary antibodies (Table 3) diluted in 5% donkey serum overnight at 4 °C. The next day, cells were rinsed with PBS and incubated with secondary antibodies (Table 3) in 5% donkey serum for 1 h at room temperature, and 0.25 μg/ml DAPI (#D1306) for 5 min. Cells were rinsed with PBS and mounted onto glass coverslips with FluorSave™ Reagent (Merck Millipore, #345789). Cells were imaged with a Leica CYR5000 light microscope.

3.7. Embryoid body assay

iPSCs were allowed to spontaneously differentiate and resulting embryoid bodies were probed using immunocytochemistry targeting proteins specific to cells originating from the three germ layers of the blastocyst. iPSCs were dissociated with Versene and transferred to low-adherence plates coated with poly-HEMA in Essential 8™ Flex medium (#A2858501) with 10uM Rock inhibitor (BioVision, #1596). The next day, media was changed to embryoid body media (EBM) (knock-out DMEM (#10829018), 10% knock-out serum replacement (#10828010), 5% FBS (#10270106), 1x NEAA (#11140035), 12 ng/mL hLIF (Merck Millipore, #LIF1010), 55 µM β-mercaptoethanol (#31350010)), and media was replaced every 2–3 days. After 8 days, embryoid bodies were transferred to glass coverslips coated with 0.1% gelatin and allowed to attach for spontaneous differentiation. These were fed every 2–3 days with EBM for ~ 20 days and then fixed with 4% paraformaldehyde and subject to immunocytochemistry as detailed in 3.6. Antibodies used are listed in Table 3.

3.8. RT-qPCR

RNA was extracted from iPSCs and LCLs with RNeasy Plus Mini Kit (Qiagen, #74134) and cDNA was produced using iScript™cDNA Synthesis Kit (Bio-Rad, #1708890) as per manufacturer instructions. qPCR was completed with PowerUp™ SYBR™ Green Master Mix (#A25741), following manufacturer instructions, with the QuantStudio™ 7 Flex Real-Time PCR System. LCL samples were included and used to calculate ΔΔCt scores for target genes KLF4, LIN28, and c-Myc in iPSCs. Expression levels of target genes were normalized to house-keeping genes SDHA and GAPDH. Primers used for qPCR reactions are included in Table 3.

3.9. STR profiling

DNA was extracted from LCLs and iPSCs using the DNeasy Blood & Tissue Kit (Qiagen, #69504). DNA was sent to Source BioScience for STR analysis, which included analysis of 16 STR loci. Lineage of iPSCs was confirmed by comparing STR profiles from iPSCs to the parent LCL lines.

3.10. Sanger sequencing

Genomic sequencing was completed to confirm the presence of ALS associated mutations in iPSC lines. DNA was extracted as described previously and amplified with primers specific to each mutation (Table 3) with Q5® High-Fidelity 2X Master Mix (NEB, #M0492S), and purified with MicroCLEAN (Microzone, #2MCL-10) following the manufacture recommendations. Purified PCR products were prepared for sequencing analysis with Big Dye V1.1 (Applied Biosystems, #4337452) following recommendation of the supplier, and the resultant PCR reaction was outsourced to Source BioScience Sanger Sequencing Service. Electropherograms were analysed using SnapGene software.

Funding

This work was funded by the Motor Neurone Disease Association (Grant ref: Shaw/Apr15/970-797).

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

Supplementary figure 1.