Let‐7 mediated airway remodelling in chronic obstructive pulmonary disease via the regulation of IL‐6

Abstract

Background

Myofibroblast differentiation and extracellular matrix (ECM) deposition are observed in chronic obstructive pulmonary disease (COPD). However, the mechanisms of regulation of myofibroblast differentiation remain unclear.

Materials and methods

We detected let‐7 levels in peripheral lung tissues, serum and primary bronchial epithelial cells of COPD patients and cigarette smoke (CS)‐exposed mice. IL‐6 mRNA was explored in lung tissues of COPD patients and CS‐exposed mice. IL‐6 protein was detected in cell supernatant from primary epithelial cells by ELISA. We confirmed the regulatory effect of let‐7 on IL‐6 by luciferase reporter assay. Western blotting assay was used to determine the expression of α‐SMA, E‐cadherin and collagen I. In vitro, cell study was performed to demonstrate the role of let‐7 in myofibroblast differentiation and ECM deposition.

Results

Low expression of let‐7 was observed in COPD patients, CS‐exposed mice and CS extract (CSE)‐treated human bronchial epithelial (HBE) cells. Increased IL‐6 was found in COPD patients, CS‐exposed mice and CSE‐treated HBE cells. Let‐7 targets and silences IL‐6 protein coding genes through binding to 3’ untranslated region (UTR) of IL‐6. Normal or CSE‐treated HBE cells were co‐cultured with human embryonic lung fibroblasts (MRC‐5 cells). Reduction of let‐7 in HBE cells caused myofibroblast differentiation and ECM deposition, while increase of let‐7 mimics decreased myofibroblast differentiation phenotype and ECM deposition.

Conclusion

We demonstrate that CS reduced let‐7 expression in COPD and, further, identify let‐7 as a regulator of myofibroblast differentiation through the regulation of IL‐6, which has potential value for diagnosis and treatment of COPD.

1. INTRODUCTION

COPD, a prevalent lung disease worldwide, is a chronic inflammatory airways disease. ¹ , ² Airway remodelling, which constitutes the major pathological changes in COPD, can lead to pulmonary function decline, irreversible airflow limitation and airway obstruction. Myofibroblast differentiation, one of the primary molecular mechanisms of airway remodelling in COPD, is characterized by the production of ECM, expression of α‐smooth muscle actin and an enhanced capacity to migrate. ³ , ⁴ , ⁵ However, the mechanisms of myofibroblast differentiation and ECM deposition in COPD remain poorly understood but involve aberrant inflammation and dysregulated cellular responses to CS exposure. ⁶ , ⁷

Let‐7, one of the first‐discovered microRNAs, has an important role in respiratory diseases, including cancer, fibrosis and asthma. ⁸ , ⁹ , ¹⁰ MicroRNAs are short non‐coding RNAs that bind to the 3′ untranslated regions of messenger RNAs (mRNAs), ¹¹ and involved in many biological processes. ¹² , ¹³ , ¹⁴ Down‐regulation of let‐7 is common in many cancer types, and its replacement for normal expression has been found to prevent cancer growth. ¹⁵ Lack of let‐7 leads to a gain of profibrotic phenotype in lung epithelial cells in vitro and changes consistent with early fibrotic changes in vivo. ¹⁶ It is reported that let‐7 microRNAs represent a major regulatory mechanism for modulating IL‐13 secretion in IL‐13‐producing cell types and, thereby, Th2 inflammation in asthma. ¹⁷ Let‐7 family, along with their potential target genes, functions as potential key microRNA‐mRNAs in regulating chronic mucus hypersecretion in COPD. ¹⁸ Although let‐7 is involved in the pathogenic processes of COPD, its role in mediating the dysfunction of myofibroblast differentiation and ECM deposition in the context of CS exposure is undefined.

IL‐6 is a multifunctional cytokine that has a role in fibrosis. It is demonstrated that overexpression of IL‐6 is sufficient to induce myofibroblastic proliferation, differentiation and fibrosis, probably via increased TGF‐β1‐mediated MMP2/MMP3 signalling in ischaemic myocardial remodelling. ¹⁹ In addition, studies show that IL‐6 has a central role in cardiomyocyte hypertrophy and myocardial fibrosis that is mediated by activating the MAPK and CaMKII‐STAT3 pathways and that neutralizing IL‐6 prevented cardiac fibroblasts activation. ²⁰ IL‐6‐deficient mice display significantly delayed cutaneous wound closure, and expression of α‐SMA mRNA was found to be increased in wounds of IL‐6‐deficient mice. ²¹ In the Spyros study, high level of IL‐6 characterizes early‐on idiopathic pulmonary fibrosis acute exacerbations (IPF‐AEs), and an increase in the level of IL‐6 associates with worse outcome in all patients. ²² In vitro activation of IL‐6 trans‐signalling enhanced fibroblast proliferation and extracellular matrix protein production, effects relevant in the progression of pulmonary fibrosis. ²³ IL‐6 is considered a cardinal stimulator of the production of most acute‐phase proteins in response to varied stimuli. ²⁴ IL‐6 can be produced by several cell types, and HBE cells secrete much more IL‐6 by the stimulation of CSE. ²⁵ , ²⁶

Here, we hypothesized that down‐regulation of let‐7 in bronchial epithelial cells disturbs the communication between bronchial epithelial cells and fibroblasts via the regulation of IL‐6 and mediates myofibroblast differentiation and ECM deposition. Therefore, we comprehensively investigated the expression variation of let‐7 family in COPD and the effect of IL‐6 on myofibroblast differentiation and ECM deposition. Better understanding of the molecular mechanisms underlying myofibroblast differentiation and ECM deposition is, thus, relevant to the prevention regimens targeting COPD pathogenesis. It is of great significance to seek new therapeutic targets for COPD.

2. MATERIALS AND METHODS

2.1. Cell culture and treatment

Study subjects were patients scheduled for bronchoscopies in WuXi People's Hospital. After using 20 mL saline to lavage the second and third generation of bronchi, five consecutive brushing samples were collected from the bronchial mucosa. Cells were harvested into a tube containing 5 mL RPMI1640 (HyClone, USA) after each brushing. About 25 mL liquid was filtered with a cell strainer (Falcon, USA). After centrifuging at 1000 rpm for 5 min, the cell pellet was resuspended in BEGM (Lonza, USA). Primary bronchial epithelial cells were harvested after seven to 25 days (Figure S2).

HBE cells, an SV40‐transformed, normal HBE cell line and MRC‐5 cells were all obtained from Chi Scientific (Jiangsu, China). HBE cells were cultured in a humidified incubator containing 95% air and 5% CO2 at 37℃ in Dulbecco's modified Eagle's medium (DMEM), supplemented with 10% foetal bovine serum (FBS) (Biological Industries, Italy), 100 U/mL penicillin and 100 μg/mL streptomycin (Thermo Fisher Scientific, USA). MRC‐5 cells were cultured in a humidified incubator containing 95% air and 5% CO2 at 37℃ in minimum essential medium (MEM) Eagle supplemented with 10% FBS (Biological Industries, Italy) and nonessential amino acids (NEAA) (Gibco, USA). MRC‐5 cells were used for experiments at the third to fifth passage. After reaching 70% to 80% confluence, the cells were seeded into cell culture plates using 0.25% trypsin (Gibco, CA, USA) and exposed to 5% CSE for 24 h.

In a co‐culture model, normal, CSE‐treated or let‐7 mimics transfected HBE cells were seeded onto 6‐well plates, with MRC‐5 cells co‐cultured on 0.4 μm pore, 24‐mm‐diameter insert (#3412, Corning, USA). HBE cells were treated with IL‐6 antibody (MAB 206, R＆D system, USA) and 5% CSE before they were placed in co‐culture with MRC‐5 cells. HBE cells were transfected with let‐7 mimic for 48 h and treated with 5% CSE before they were placed in co‐culture with MRC‐5 cells.

2.2. Human sample collection

Peripheral lung tissues were collected from COPD patients undergoing lung transplantation and patients scheduled for pulmonary lobectomy in Wuxi People's Hospital. All peripheral lung tissue donations were voluntary, with full written informed consents, and in compliance with the Declaration of Istanbul. Peripheral lung tissues were placed into five to six cryogenic vials, frozen quickly in liquid nitrogen and then stored at −80°C for later use.

Serum samples were obtained from COPD patients who were admitted to the Wuxi People's Hospital between 2019 and 2020. Control serum samples were obtained from healthy volunteers who came to the hospital for a medical examination. All serum sample donations were voluntary, with full written informed consents, and in compliance with the Declaration of Istanbul. All serum samples were stored at −80°C.

All COPD patients met the diagnosis of GOLD 2019. Lung function and medical history of subjects participating in the study are reported in Table 2, Table 3 and Table 4. As shown in the tables, median age and sex ratio were similar in nonsmokers (Control‐NS), smokers (Control‐S) and COPD subjects.

Table 2.

Characteristics of peripheral lung tissues in the study

	Nonsmoker without COPD(control‐NS)	Smokers without COPD(control‐S)	COPD patients
Number	8	6	11
Male, n (%)	4（50.0%）	4（63.67%）	7（63.64%）
Age (years)	56.50 ± 13.15	62.17 ± 2.4	61.64 ± 4.37
Smoking (pack‐years)	0	43.33 ± 9.43	32.05 ± 21.18
FEV1% pred	95.06 ± 8.49	92.53 ± 4.75	27.27 ± 10.57
FEV1/FVC(%)	88.52 ± 4.39	79.68 ± 2.16	39.36 ± 6.44

Abbreviations: COPD, chronic obstructive pulmonary disease; pack‐year, number of cigarettes smoked per day/20 (pack) × duration of smoking (year); FEV1, forced expiratory volume in one second; FVC, forced vital capacity; FEV1% pred, forced expiratory volume in one second per cent predicted. Data presented as mean ± SD.

Table 3.

Characteristics of bronchial epithelial cells in the study

	Nonsmokers without COPD (control‐NS)	Smokers without COPD (control‐S)	COPD patients
Number	6	6	6
Male, n (%)	4（63.67%）	4（63.67%）	4（63.67%）
Age (years)	46.67 ± 7.37	56.33 ± 7.54	59.0 ± 8.64
Smoking(pack‐years)	0	20.0 ± 8.66	35.0 ± 28.14
FEV1% pred	95.17 ± 13.8	86.76 ± 4.79	62.43 ± 15.27
FEV1/FVC(%)	88.67 ± 4.88	78.66 ± 4.48	57.68 ± 4.93

Abbreviations: COPD, chronic obstructive pulmonary disease; pack‐year, number of cigarettes smoked per day/20 (pack) × duration of smoking (year); FEV1, forced expiratory volume in one second; FVC, forced vital capacity; FEV1% pred, forced expiratory volume in one second per cent predicted. Data presented as mean ± SD.

Table 4.

Characteristics of bronchial epithelial cells in the study

	Control	COPD patients
Number	6	12
Male, n (%)	4（63.67%）	8（63.67%）
Age (years)	50.67 ± 6.07	65.67 ± 11.03
Smoking(pack‐years)	NA	24.83 ± 23.33
FEV1% pred	NA	42.13 ± 16.33
FEV1/FVC(%)	＜70	51.1 ± 13.45

Abbreviations: COPD, chronic obstructive pulmonary disease; pack‐year, number of cigarettes smoked per day/20 (pack) × duration of smoking (year); FEV1, forced expiratory volume in one second; FVC, forced vital capacity; FEV1% pred, forced expiratory volume in one second per cent predicted. NA, not acquired. Data presented as mean ± SD.

This study was approved by the Ethics Committee of Wuxi People's Hospital Affiliated to Nanjing Medical University. This study was conducted in accordance with the Declaration of Helsinki, and written informed consents were received from all participants. Reporting of the study conforms to the broad EQUATOR guidelines (Simera et al January 2010 issue of EJCI).

2.3. Preparation of CSE

CSE was prepared as previously reported with some modifications. ²⁷ , ²⁸ Briefly, the smoke of a Da Qian Men (10 mg tar and 0.8 mg nicotine/cigarette, Shanghai, China) was bubbled through 10 mL of serum‐free DMEM. The resulting suspension was adjusted to pH 7.4 and then filtered through a 0.22‐μm pore filter (Merck Millipore, USA) to remove bacteria and large particles. The CSE was standardized by monitoring the absorbance at 320 nm and defined as 100% CSE. The CSE was diluted to the desired concentration with medium and used in experiments within 30 min.

2.4. RNA extraction and real‐time PCR

Total RNA was isolated by use of RNAiso Plus (9108/9109, Takara, Japan). For microRNA and mRNA detection, total RNA (1 μg) was transcribed into cDNA by use of PrimeScript^TM RT reagent kit with gDNA eraser (RR047A, Takara, Japan) according to the manufacturer's recommendations. The sequences of mature microRNAs were from miRDB database. All of the primers were synthesized by Sangon Biotech (Shanghai, China). Primers used are listed in Table 1. The RT‐PCR assay was performed with TB Green™ Premix Ex Taq™ II (RR820A, Takara, Japan) and ABI 9600 real‐time PCR detection system (Applied Biosystems). U6 was used as internal control for microRNA. GAPDH served as internal control for mRNA. Fold changes in expression of each gene were calculated by a comparative threshold cycle (Ct) method using the formula 2^{—(△△Ct)}. Three independent experiments were carried out.

Table 1.

Primers used in the study

Genes	Sequence（5’ to 3’）
Let‐7a‐RT	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTATAC
Let‐7a‐F	CCAGCTGGGTGAGGTAGTAGGTTGT
Let‐7a‐R	CTGGTGTCGTGGAGTCGGCAATT
Let‐7c‐RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCAT
Let‐7c‐F	CCAGCTGGGTGAGGTAGTAGGTTGT
Let‐7c‐R	TCCAGTGCAGGGTCCGAGGTA
Let‐7d‐RT	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTATGC
Let‐7d‐F	CCAGCTGGGAGAGGTAGTAGGTTGC
Let‐7d‐R	CTGGTGTCGTGGAGTCGGCAATT
U6‐RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATA
U6‐F	AGAGAAGATTAGCATGGCCCCTG
U6‐R	ATCCAGTGCAGGGTCCGAGG
H‐IL‐6‐F	CACTGGTCTTTTGGAGTTTGAG
H‐IL‐6‐R	GGACTTTTGTACTCATCTGCAC
M‐IL‐6‐F	CTCCCAACAGACCTGTCTATAC
M‐IL‐6‐R	CCATTGCACAACTCTTTTCTCA

Abbreviations: F, forward; R, reverse; RT, reverse transcription.

2.5. Western blot

Total lysates were prepared according to the manufacturer's recommendations (Beyotime Institute of Biotechnology, Shanghai, China). Protein concentrations were measured with the BCA protein assay according to the manufacturer's manual (Beyotime Institute of Biotechnology, Shanghai, China). Equal amounts (30 μg) of protein were separated by 10% sodium dodecyl sulphate–polyacrylamide gel electrophoresis and were transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA). Membranes were incubated overnight at 4°C with mouse anti‐GAPDH antibody (ab8245, Abcam), mouse anti‐β‐actin antibody (66009‐1‐Ig, Proteintech), rabbit anti‐E‐cadherin antibody (#3195, Cell Signaling Technology), rabbit anti‐alpha smooth muscle actin antibody (α‐SMA) (ab32575, Abcam) and rabbit anti‐collagen I antibody (ab138492, Abcam). After several washing steps, the membrane was incubated with secondary horseradish peroxidase (HRP)‐conjugated antibody at room temperature for one hour. Detection was performed with the Immobilon ECL system (Millipore, S.p.A., Italy). Three independent experiments were carried out. The densitometric analyses of the bands were performed with ImageJ software.

2.6. ELISA assay

Cell supernatant was centrifuged at 3000 rpm for 5 min, and then, the supernatant was collected and stored at −80℃ until analyses. IL‐6 protein level was evaluated with human IL‐6 ELISA kit (R & D Systems, USA) according to the manufacturer's instructions.

2.7. Transfection of let‐7c mimics

Let‐7c mimics and negative control (NC) mimics were purchased from Jikai Gene (Shanghai, China). The cells were seeded in a six‐well plate at a density of 0.5 × 10⁶ per well. After the cells reached 70% confluence, the transfection experiment was conducted using Lipofectamine 2000 reagent (Thermo Fisher Scientific, USA), according to the manufacturer's protocol. For the increases in let‐7c mimics of HBE cells, the cells were transfected with 2 μg let‐7c mimics and NC mimics in each well, respectively. After transfection for 48 h, the cells were exposed to 5% CSE for 24 h, and then, all group cells were harvested for the subsequent assays.

2.8. Luciferase reporter assay

Luciferase activity was assessed as previously reported. To investigate the effect of let‐7c on the 3’UTR of IL‐6, which was predicted to combine with the let‐7c region (GAGGUA), IL‐6 was inserted into the XbaI/Xbal sites of the GV272 (Figure S1). These were named IL‐6‐wt (TACCTC) and IL‐6‐mut (ATGGAG), respectively (Designed by Jikai Gene, Shanghai, China). Confluent (70% to 80%) 293T cells were co‐transfected with wild‐type or mutant IL‐6 3’UTR luciferase mimics and let‐7c mimics or NC mimics using Lipofectamine 2000 (Thermo Fisher Scientific, USA). After 48 h of transfection, the cells were harvested for detection using the Dual‐Luciferase Reporter assay system (Promega, USA) with an Infinite 200 PRO multimode microplate reader (Tecan Group, Ltd., Switzerland). Renilla luciferase activities were used to normalize the transfection efficiency.

2.9. Establishment of murine COPD model

Male C57BL6J mice at 6 to 8 weeks of age were purchased from Changzhou Kawensi Experimental Animal Co., Ltd. (China) and housed in animal facilities at Wuxi People's Hospital, Jiangsu Province. Animals were treated humanely and with regard for alleviation of suffering according to a protocol approved by Wuxi People's Hospital, Jiangsu Province Institutional Animal Care and Use Committee, in compliance with law of Jiangsu Province on the administration of experimental animals. Mice were exposed to smoke from Da Qian Men (10 mg tar and 0.8 mg nicotine/cigarette, Shanghai, China) as described previously. Briefly, mice were exposed to CS in a whole‐body exposure system in tempered glass box for 2 h twice a day, 4 h apart, 7 days a week for a total of 12 weeks. Age‐matched mice kept in a similar environment without exposure to CS served as controls.

2.10. Lung function measurement

Lung function of the mice was measured in Jiangsu Provincial Center for Disease Control and Prevention by use of whole‐body plethysmography (Buxco Electronics, Ltd., USA) as previously reported. Briefly, mice were placed unrestrained in a chamber connecting a sensitive pressure transducer to measure pressure changes inside the chamber. Enhanced pause (Penh) was recorded using FinePointe software (Buxco Electronics, Ltd., USA) when the mice were quiet. Penh generally reflects pulmonary resistance in all recorded respiratory parameters. Values were averaged and expressed as absolute Penh values.

2.11. Collection of bronchoalveolar lavage fluid (BALF)

In anaesthetized mice, the skin and muscles of the anterior neck were incised to expose the trachea. The puncture needle was fixed in the trachea at an angle of 30 degrees. The right mainstem bronchus was clamped with an arterial clip, and then a syringe was attached to the arterial puncture needle. Then 0.4 mL of ice‐cold, sterile phosphate‐buffered saline solution was injected into the left lung and slowly aspirated back. The recovery rate was not less than 90%.

2.12. Histopathology and Masson's staining

Mouse middle lobe of right lung and human lung tissues were fixed with 4% neutral paraformaldehyde for 24h. Tissues were embedded in paraffin, then sectioned (4 μm). For the detection of collagen deposition, the sample slides were stained with trichrome stain (Masson's) kits (G1345, Solarbio, China) according to the manufacturer's instructions. After staining, the slides were examined under a light microscope by a photograph documentation facility (Olympus, Tokyo, Japan). Collagen content was determined by the ratio of collagen surface area (blue) to total surface area (red) with ImageJ software.

2.13. Statistical analysis

All the relevant data are expressed as mean ± SD of three independent experiments. Differences between mean values of normally distributed data were analysed using one‐way ANOVA (Dunnett's t test), two‐tailed Student's t test and Kruskal‐Wallis test. The statistical analyses were conducted using SPSS 20 software, and values of P < .05 were considered to be statistically significant.

3. RESULTS

3.1. Airway remodelling in COPD patients

Masson's staining evidenced more collagen deposition in COPD patients compared with that in nonsmokers and smokers without COPD (Figure 1A,B). E‐cadherin was down‐regulated and α‐SMA was up‐regulated in the peripheral lung tissue of COPD patients (Figure 1C,D).

Figure 1.

Collagen, α‐SMA and E‐cadherin in COPD patients. Con‐NS, nonsmokers without COPD; Con‐S, smokers without COPD; COPD, COPD patients. (A) Lung morphology was assessed by Masson's staining of lung sections. Scale bars, 200μm. Collagen: blue; nuclei: black; cytoplasm/epithelial: red. (B) Quantification of Masson's staining for collagen content from nonsmokers, smokers and COPD patients. (C) Western blots. (D) Relative protein levels of α‐SMA and E‐cadherin in lung were determined. Data are mean ± SD (n = 3)

3.2. Decreased let‐7 and increased IL‐6 in COPD patients

To determine whether let‐7 is a mediator for COPD, the let‐7 expression was explored in peripheral lung tissues (Table 2 and Table S1), primary bronchial epithelial cells (Table 3 and Table S2) and serum (Table 4 and Table S3). Let‐7 in COPD patients’ lung tissues was lower than that in nonsmokers and smokers (Figure 2A). As the peripheral lung contains many different types of cells, we examined the expression of let‐7 in primary bronchial epithelial cells isolated from subjects with or without COPD. As shown in Figure 2B, let‐7 in the primary cells was decreased compared with that in nonsmokers and smokers. What’ more, Let‐7 in COPD patients’ serum was lower than that in control group (Figure 2C). We also detected IL‐6 mRNA expression in peripheral lung tissues and primary bronchial epithelial cells. IL‐6 mRNA in COPD patients’ lung tissues and primary bronchial epithelial cells was higher than both that in nonsmokers and smokers (Figure 2D,E). IL‐6 in the cell supernatant from primary epithelial cells was increased compared with that in nonsmokers and smokers (Figure 2F).

Figure 2.

Expression of let‐7 and IL‐6 in COPD patients. Con‐NS, nonsmokers without COPD; Con‐S, smokers without COPD; COPD, COPD patients. (A) Levels of let‐7 in peripheral lung tissues of Con‐NS (n = 8), Con‐S (n = 6), and COPD (n = 11) were determined by RT‐PCR. (B) Levels of let‐7 in human primary bronchial epithelial cells (n = 6) were determined by RT‐PCR. (C) Levels of let‐7 in serum of control group (n = 6) and COPD patients (n = 12) were determined by RT‐PCR. (D) Relative expression of IL‐6 mRNA in peripheral lung tissues was detected by RT‐PCR. (E) Relative expression of IL‐6 mRNA in human primary bronchial epithelial cells (n = 6) was detected by RT‐PCR. (F) IL‐6 derived from human primary bronchial epithelial cells (n = 6) was explored by ELISA. Data are mean ± SD

3.3. Increased inflammation cells and airway remodelling in CS‐exposed mice

After 12 weeks’ exposure to CS, the mice developed COPD, showing inflammation and airway remodelling. Penh increased in CS‐exposed mice compared to that in controls (Figure 3A). An increase in total cell number in the BALF was detected in mice exposed to CS compared with that in controls (Figure 3B). Furthermore, the CS‐exposed mice developed an airway remodelling phenotype, showing airway thickening and collagen deposition. Masson's staining showed more collagen deposition in CS‐exposed mice (Figure 3C,D). Western blot also revealed that E‐cadherin was decreased and α‐SMA was increased in lung tissue of CS‐exposed mice (Figure 3E,F).

Figure 3.

CS‐exposed mice. Male C57BL6J mice at 6‐8 weeks of age were exposed to CS for 12 weeks. Pulmonary function was represented as Penh (A) in air‐exposed mice and CS‐exposed mice. (B) Total inflammatory cell count of BALF from air‐exposed mice and CS‐exposed mice. (C) Lung morphology was assessed by Masson's staining of lung sections. Collagen: blue; nuclei: black; cytoplasm/epithelial: red. Scale bars, 200μm. (D) Quantification of Masson's staining for collagen content. (E) Western blots were performed, and (F) relative protein levels of α‐SMA and E‐cadherin in lung were determined. All data are shown as mean ± SD (n = 6)

3.4. Decreased let‐7 and increased IL‐6 in CS‐exposed mice and CSE‐treated HBE cells

There were lower expressions of let‐7 in the peripheral lung tissue of CS‐exposed mice compared to that in air groups (Figure 4A and Table S4). Significant differences in the expressions of let‐7a, let‐7c and let‐7d were observed in CS‐exposed mice compared to controls. We detected IL‐6 mRNA in CS‐exposed mice higher than in control groups (Figure 4B). We confirmed that let‐7 expression correlated with CSE concentration. The 5% CSE‐treated HBE cells showed lower expression in let‐7a, let‐7c and let‐7d than the 2% CSE‐treated HBE cells (Figure 4C and Table S5). IL‐6 mRNA levels were obviously increased at 2% and 5% CSE concentrations compared with that in control groups (Figure 4D). Secreted IL‐6 in cell supernatant was increased at 24 h, 48 h and 72 h after CSE exposure (Figure 4E).

Figure 4.

Expression of let‐7 and IL‐6 in CS‐exposed mice and CSE‐treated HBE cells. Con, control; 2% CSE, HBE cells treated with 2% CSE for 24 h; 5% CSE, HBE cells treated with 5% CSE for 24 h. (A) Levels of let‐7 in CS‐exposed mice compared with air‐exposed mice were determined by RT‐PCR. (B) Relative expression of IL‐6 mRNA in lung tissue of CS‐exposed mice and air‐exposed mice revealed by RT‐PCR. (C) Levels of let‐7 in HBE cells treated with 2% CSE and 5% CSE detected by RT‐PCR. (D) Relative expression of IL‐6 mRNA in HBE cells by RT‐PCR. (E) IL‐6 derived from 5% CSE‐treated HBE cells induced with different times was explored by ELISA. All data are shown as mean ± SD (n = 6 in mice, n = 3 in HBE cells)

3.5. Let‐7 down‐regulated IL‐6 in CSE‐treated HBE cells

Through the analysis of three different databases (TargetScan, miRDB and miRBase), we found that all the members of let‐7 family (GAGGUA) had the same potential binding site to the 3’UTR of IL‐6 (TACCTC). Among 12 microRNAs of let‐7 family, RT‐PCR results confirmed let‐7a, let‐7c and let‐7d were significantly down‐regulated in both peripheral lung tissue of COPD patients and CSE‐treated HBE cells in comparison with controls. By consulting related articles, we chose let‐7c for subsequent experiments. Luciferase reporter assays were conducted using mimics of wild‐type and mutant IL‐6 that contained let‐7c binding sites in 3’UTR (Figure 5C). Following co‐transfected mimics of wild‐type IL‐6 and let‐7c in 293T cells, there was low luciferase activity. However, co‐transfected mimics of let‐7c with mutated IL‐6 resulted in no appreciable change in luciferase activity (Figure 5D,E). RT‐PCR and ELISA analysis showed that IL‐6 was decreased in let‐7c transfected HBE cells (Figure 5A,B).

Figure 5.

Let‐7 can regulate IL‐6 in HBE cells. NC, HBE cells treated with NC mimic for 48 h. Let‐7c, HBE cells treated with let‐7c mimic for 48 h. NC + 5% CSE, HBE cells treated with NC mimic for 48 h, then induced by 5% CSE for 24 h. Let‐7c + 5% CSE, HBE cells treated with let‐7c mimic for 48 h, then induced by 5% CSE for 24 h. (A) RT‐PCR was performed to detect expression of IL‐6 mRNA in HBE cells. (B) ELISA was performed to determine IL‐6 secreted by HBE cells. (C) Schematic of let‐7c putative target sites in the 3’UTR of IL‐6 and sequences of mutant UTRs. (D) Luciferase reporter assay was performed after co‐transfected with let‐7c mimic or NC mimic and IL‐6‐wt mimic or IL‐6‐mut mimic. Data are mean ± SD (n = 3)

3.6. Let‐7 promoted myofibroblast differentiation of human lung fibroblasts by regulating IL‐6 secretion

Collagen I and α‐SMA were up‐regulated in MRC‐5 cells co‐cultured with CSE‐treated HBE cells (Figure 6A,B). Additionally, antibody against IL‐6 was added to the co‑culture system, and protein levels in the MRC‐5 cells were detected by western blot analysis. The neutralizing antibody decreased the expression of Collagen I and α‐SMA in MRC‐5 cells (Figure 6C,D). For validation, let‐7c mimic was transfected in HBE cells. RT‐PCR and ELISA analysis showed that IL‐6 expression was decreased in let‐7c mimic transfected HBE cells (Figure 5A,B). Western blotting revealed that, in the MRC‐5 cells co‐cultured with CHBE cells which were transfected with let‐7c mimic, collagen I and α‐SMA were decreased more than in CSE‐treated HBE cells (Figure 6E,F).

Figure 6.

Let‐7 in HBE cells can promote myofibroblast differentiation of MRC‐5 cells. CHBE, HBE treated with 5% CSE; let‐7c‐CHBE, HBE cells transfected with let‐7c mimic, then treated with 5% CSE; NC‐CHBE, HBE cells transfected with NC mimic, then treated with 5% CSE. MRC‐5 cells were co‐cultured with HBE, CHBE, let‐7c‐CHBE and NC‐CHBE. Densities of bands were quantified by ImageJ software. GAPDH levels, measured in parallel, served as controls. (A, B) MRC‐5 cells were co‐cultured with HBE, CHBE, and the levels of α‐SMA and collagen I were determined using Western blot. (C, D) MRC‐5 cells were co‐cultured with HBE, CHBE. IL‐6 (1μg/ml and 4μg/ml) antibodies were added and levels of α‐SMA and collagen I were detected by Western blots. MRC‐5 cells were co‐cultured with CHBE, let‐7c‐CHBE, NC‐CHBE. (E) Western blots were performed, and (F) protein levels of α‐SMA and collagen I were determined. Data are mean ± SD (n = 3)

4. DISCUSSION

COPD is a worldwide public health challenge because of its high prevalence, disability and mortality. ²⁹ Cigarette smoking is known to cause airway remodelling, leading to irreversible loss of lung function in COPD. The overly enhanced activity of myofibroblasts leads to airway fibrosis in general with aberrant ECM deposition and remodelling in COPD. Our study presented that IL‐6 exerted a positive role in regulating the differentiation of fibroblasts to myofibroblasts in airway remodelling. We proposed that, as an underlying mechanism, down‐regulation of let‐7 induced by cigarette smoke played an important role in this process.

Airway remodelling in COPD involves mucous glandular metaplasia, myofibroblast proliferation and ECM deposition. ³⁰ Remodelling of the airways contributes to progressive and largely irreversible airflow limitation. ³¹ We did find airway remodelling in COPD patients and CS‐exposed mice, manifesting as collagen deposition and epithelial‐mesenchymal transition (EMT). These findings are in accordance with previous observations. ³² , ³³ During this process, myofibroblasts, which originate directly from lung bronchial fibroblasts, are involved in the formation of airway fibrosis. ³⁴ The differentiation of fibroblasts to myofibroblasts not only contributes to fibrosis by releasing collagens, but also stimulates the epithelium to release more cytokines and inflammatory factors, which may form a vicious cycle for small airway narrowing and airflow obstruction. ³⁵ Multiple observers have noted the presence of abnormal myofibroblast differentiation and ECM deposition in COPD, but the regulatory mechanisms have not been fully elucidated. In the present study, we found that CS‐exposed mice not only showed airway remodelling phenotype, but also demonstrated increased inflammation. The total inflammatory cell count in BALF was increased. These findings suggest that inflammatory factors and inflammatory cells may play an important role in airway remodelling of COPD as well.

Inflammatory cells and structural cells involved in airway remodelling of COPD secrete a variety of proinflammatory mediators, including cytokines, chemokines and growth factors. ³⁶ Among all the cytokines and chemokines, robustly increased IL‐6 levels were found in BALF of COPD patients and CS‐exposed mice. ³⁷ , ³⁸ Our study provided additional evidence that increased IL‐6 was found in the cell supernatant of primary HBE cells of COPD patients as well as CSE‐treated HBE cells, and IL‐6 mRNA was increased in COPD patients, CS‐exposed mice and CSE‐treated HBE cells. IL‐6 is involved in the pathogenesis of COPD, including features of chronic airway inflammation and airway remodelling, through a variety of signalling pathways. ³⁹ , ⁴⁰ , ⁴¹ Previous studies have reported that IL‐6 is released from fibroblasts, endothelial cells and epithelial cells in COPD and could induce collagen synthesis. ⁴² , ⁴³ In order to confirm the effects of IL‐6 on differentiation of bronchial fibroblasts to myofibroblasts, we co‐cultured MRC‐5 cells with CSE‐treated HBE cells. The results revealed that CSE‐treated HBE cells increased IL‐6 secretion and promoted the differentiation of bronchial fibroblasts to myofibroblasts, manifested as up‐regulation of α‐SMA and collagen I in MRC‐5 cells.

The mechanism of up‐regulation of IL‐6 in COPD is not completely understood. There is increasing evidence that let‐7 directly targets IL‐6 to suppress the IL‐6 signalling pathway. ⁴⁴ , ⁴⁵ Let‐7, one of the first‐discovered microRNA families, has 12 members (from let‐7a to let‐7i, and miR‐98) and is located at eight different chromosomes. ⁴⁶ In 2009, the possibility that a positive feedback loop of inflammation was formed by let‐7, Lin28, NF‐kB, and IL‐6 was first raised. ⁴⁷ Recently, another report also showed that the down‐regulation of let‐7 enhanced the production of IL‐6 by diesel exhaust particle exposure in mice. ⁴⁸ Let‐7 levels negatively correlated with aberrant inflammation. In our study, we validated IL‐6 as a direct target of let‐7 by using a luciferase reporter assay. Our results provide further evidence for the let‐7/IL‐6 signalling pathway. To further demonstrate the role of the Iet‐7 in regulation of IL‐6 expression, we treated HBE cells with the let‐7 mimics and found IL‐6 expression was significantly down‐regulated. Let‐7 mimic significantly inhibited the secretion of IL‐6 as well as the differentiation of bronchial fibroblasts to myofibroblasts. These results suggest that IL‐6 might act as a mediator of let‐7 regulation of myofibroblast differentiation and ECM deposition.

Abnormal expression of let‐7 family members is related to numerous diseases, including cancer and pulmonary fibrosis. ⁸ , ⁴⁹ , ⁵⁰ Let‐7 family members act as tumour suppressors because they not only are down‐regulated in a variety of cancers, but also effect the expression of many oncogenes, including HMGA2 and RAS. ⁵¹ It is reported that let‐7d was significantly decreased in pulmonary fibrosis lungs, and this miRNA activity has also been reported to show a negative association with markers of fibrosis and fibroblast proliferation. ⁵² A previous study, through gene set enrichment analysis and search tool for retrieving interacting genes/proteins (STRING) of bronchial biopsies from COPD patients reported that the let‐7 family along with their potential target gene EDN1 may serve as potential key microRNA‐mRNA for chronic mucus hypersecretion in COPD. Our results showed that let‐7a, let‐7c and let‐7d were down‐regulated in COPD patients. This result is in agreement with and extends the findings from that recent report. ⁵³ Additionally, in this present work, we analysed the expression of let‐7 in CS‐exposed mice. Compared to air‐exposed mice, CS‐exposed mice that developed airway remodelling phenotype showed lower levels of let‐7a, let‐7c and let‐7d. Furthermore, we confirmed that let‐7 expression was decreased in CSE‐treated HBE cells. These studies established the important function of let‐7 in COPD.

Our study has some limitations. First, IL‐6 protein levels were not studied in CS‐exposed mice due to the lack of material. Additionally, the role of let‐7 and its regulation of IL‐6 was not investigated with in vivo models. Follow‐up studies using in vivo models are encouraged to provide further mechanistic insights.

In conclusion, our results reveal that let‐7a, let‐7c and let‐7d are involved in airway remodelling in COPD. IL‐6, as the key mediator, participates in the crosstalk between bronchial epithelial cells and fibroblast cells. For bronchial epithelial cells, cigarette smoke exposure induces the decrease of let‐7, which up‐regulates the secretion of IL‐6. In bronchial fibroblast cells, IL‐6 elevates the expression of α‐SMA and collagen I, inducing the differentiation of fibroblasts to myofibroblasts (Figure 7). These results indicate that let‐7 has potential investigative value in the diagnosis and treatment of COPD.

Figure 7.

Schematic representation of the potential role of let‐7 in COPD. Let‐7 is negatively regulated in bronchial epithelial cells and functions to secrete more IL‐6, which normally promotes differentiation of bronchial fibroblasts to myofibroblasts. Myofibroblasts can promote ECM protein deposition, leading to airway remodelling in COPD

CONFLICT OF INTEREST

The authors declare that there are no conflicts of interest.

Supporting information

Supplementary Material

Di T, Yang Y, Fu C, et al. Let‐7 mediated airway remodeling in chronic obstructive pulmonary disease via the regulation of IL‐6. Eur J Clin Invest. 2021;51:e13425. 10.1111/eci.13425