A faster and less costly alternative for RNA extraction of SARS-CoV-2 using proteinase k treatment followed by thermal shock

Adolfo Marcelo Ñique; Fiorella Coronado-Marquina; Jairo Andrés Mendez Rico; María Paquita García Mendoza; Nancy Rojas-Serrano; Paulo Vitor Marques Simas; Cesar Cabezas Sanchez; Jan Felix Drexler

doi:10.1371/journal.pone.0248885

. 2021 Mar 24;16(3):e0248885. doi: 10.1371/journal.pone.0248885

A faster and less costly alternative for RNA extraction of SARS-CoV-2 using proteinase k treatment followed by thermal shock

Adolfo Marcelo Ñique ^1,^*, Fiorella Coronado-Marquina ¹, Jairo Andrés Mendez Rico ², María Paquita García Mendoza ¹, Nancy Rojas-Serrano ¹, Paulo Vitor Marques Simas ^1,³, Cesar Cabezas Sanchez ¹, Jan Felix Drexler ⁴

Editor: Shawky M Aboelhadid⁵

PMCID: PMC7990203 PMID: 33760876

Abstract

One of the biggest challenges during the pandemic has been obtaining and maintaining critical material to conduct the increasing demand for molecular tests. Sometimes, the lack of suppliers and the global shortage of these reagents, a consequence of the high demand, make it difficult to detect and diagnose patients with suspected SARS-CoV-2 infection, negatively impacting the control of virus spread. Many alternatives have enabled the continuous processing of samples and have presented a decrease in time and cost. These measures thus allow broad testing of the population and should be ideal for controlling the disease. In this sense, we compared the SARS-CoV-2 molecular detection effectiveness by Real time RT-PCR using two different protocols for RNA extraction. The experiments were conducted in the National Institute of Health (INS) from Peru. We compared Ct values average (experimental triplicate) results from two different targets, a viral and internal control. All samples were extracted in parallel using a commercial kit and our alternative protocol–samples submitted to proteinase K treatment (3 μg/μL, 56°C for 10 minutes) followed by thermal shock (98°C for 5 minutes followed by 4°C for 2 minutes); the agreement between results was 100% in the samples tested. In addition, we compared the COVID-19 positivity between six epidemiological weeks: the initial two in that the Real time RT-PCR reactions were conducted using RNA extracted by commercial kit, followed by two other using RNA obtained by our kit-free method, and the last two using kit once again; they did not differ significantly. We concluded that our in-house method is an easy, fast, and cost-effective alternative method for extracting RNA and conducing molecular diagnosis of COVID-19.

Introduction

The Severe Acute Respiratory Syndrome 2 (SARS-CoV-2), the causative agent of Coronavirus Disease 2019 (COVID-19), has been classified as part of the Coronaviridae family. These viruses have a phospholipid envelope derived from the host membrane, containing the proteins that give it the crown shape [1]. Coronaviruses, as other enveloped viruses, are generally more vulnerable to heating because the heat denatures the envelope and makes them incapable of infection.

According to data available by World Health Organization (WHO), the SARS-CoV-2 can survive for up to 72 hours on plastic and stainless steel, less than 4 hours on copper, and less than 24 hours on cardboard [2]. However, the virus can be detected in environments after this time [3–5], indicating that environmental conditions like temperature, for example, can inactivate the viral particles but, in the meantime, is not able to completely degrade viral genetic material, making it possible to detect it.

SARS-CoV-2 can be inactivated at 60°C, 80°C, and 100°C for approximately 32.5, 3.7, and 0.5 minutes, respectively, and these times and temperatures held enough to reduce the infectivity in five logs [6]. These temperatures are also used during amplification by real time RT-PCR, indicating that the genetic material’s quality is not compromised. Furthermore, using an internal control for Real time RT-PCR reaction can confirm the samples’ integrity, decreasing the probability of false-negative results.

Based on this knowledge, physical methods like heating and specific chemical reagents like proteinase K are widely used in genetic material extraction protocols to optimize viral purification. Proteinase K is critical because it digests proteins eliminating contamination from nucleic acid preparations, in addition to inactivating the nucleases that could degrade DNA or RNA during purification.

With all of this, we established a protocol using proteinase K treatment of nasopharyngeal samples in Universal Transport Medium (UTM) followed by thermal shock for a faster and low-cost RNA extraction for COVID-19 diagnosis. We compared our new method’s effectiveness based on Ct values obtained by Real time RT-PCR specific for SARS-CoV-2 using a constitutive human gene as an internal control.

Material and methods

Ethical considerations

The study was conducted at the INS, Peruvian Ministry of Health. The INS contains several reference laboratories that are in authority for epidemiological surveillance in human health in Peru. This article reported results obtained in the standardization process of an alternative method for RNA extraction and the retrospective study using this new protocol. All procedures were performed according to Pan American Health Organization (PAHO) and WHO guidelines, which is required for the implementation of a new protocol in any reference laboratory. The retrospective medical records and the archived samples were completely anonymous before accessing.

All patients voluntarily allowed the collection of a nasal and pharyngeal swab in search of a molecular diagnosis of COVID-19. All sample collection procedures were performed according to standards established by WHO, CDC, and mainly following the guidelines of the Declaration of Helsinki for the diagnosis of infectious diseases of the respiratory tract [7–9].

All experiments carried out for molecular diagnostics at the INS of Peru related to COVID-19 were authorized by a chieftain resolution under file number 00006918 provided in emergency decree 0064-2020-OGA/INS of April 7th, 2020 and the note information 0055–2020 "Plan de acción del Instituto Nacional de Salud para prevención, diagnóstico y control del COVID-19, en el marco del decreto supremo n° 008-2020-SA".

The retrospective study was not sent for evaluation by the ethics committee because it was included in INS’s action plan from Peru. This supreme decree determined that the National Reference Laboratory of Respiratory Viruses, local where the experiments presented in the paper were conducted, must be responsible for "Diagnóstico Molecular de Muestras de Casos Sospechosos de COVID-19".

Experimental design

Our alternative protocol for RNA extraction was reasoned in the proteinase K properties and the SARS-CoV-2 biological characteristics. The low resistance to the temperature increases of both viruses and hosting cells and the enzyme’s ability to destroy all proteins in the envelope, capsid, and the ones associated with viral RNA, provide the ideal mechanisms for stripping and solubilizing viral RNA.

The nasopharyngeal swabs were preserved in Universal Transport Medium (UTM), in which 100 μL was treated with 30 μg of proteinase K. The solution was incubated in a dry bath (56°C, 10 minutes) followed by thermal shock (98°C, 5 minutes; 4°C, 2 minutes).

The SARS-CoV-2 molecular detection was conducted using real time RT-PCR multiplex to detect a viral-specific, RNA polymerase RNA dependent gene (RdRp) and a human transcript gene as internal control, Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH). The Ct values obtained in both channels were compared between protocols of the RNA purification and statistically analyzed. The acceptance criterion for validation of this new RNA extraction proceeding was 100% concordant compared to the extractions performed using a commercial kit. All these proceedings, from RNA extraction to amplification reactions, were performed by the same operator under the same conditions (environment, equipment, samples).

Clinical samples

Seventy-eight samples were simultaneously submitted to both RNA extraction methods, using the commercial kit, according to manufacturers’ instructions (Qiagen), and another using proteinase k treatment and thermal shock protocol.

After this standardization step and considering that there were no RNA extraction commercial kits available during the period between June 3rd and 25th at INS from Peru, all COVID-19 molecular diagnosis using Real time RT-PCR were made using RNA purified using proteinase k and thermal shock. To establish a real comparison of positivity obtained in this period, we compared the Real time RT-PCR results obtained in two complete epidemiological weeks (EW) before June 3rd (EW 21 and 22) and the other two after June 25th (EW 28 and 29). The EW 27 represented the quarantine ending on June 30th. The quarantine ending allowed more circulation of people, increasing the probability of virus transmission. Thus, this week was omitted because it could offer a bias in these results. The positivity between these six epidemiological weeks was compared, including 148,396 clinical samples evaluated by Real time RT-PCR from cases with suspected signs for COVID-19.

SARS-CoV-2 detection by Real time RT-PCR multiplex

The real time RT-PCR multiplex used to detect SARS-CoV-2 in clinical samples swabs were standardized using primers and specific probes for SARS-CoV-2 RdRp gene [10] and included primers and probe for the constitutive human transcript for the enzyme GAPDH (Table 1) on the same reaction.

Table 1. Genes and probes used in the Real time RT-PCR multiplex to detect SARS-CoV-2 using GAPDH as an internal control.

Target gene	Primer / Probe	Sequence 5’ → 3’
RdRp	RdRp_SARSr-F	`GTGARATGGTCATGTGTGGCGG`
	RdRp_SARSr-P2	FAM-`CAGGTGGAACCTCATCAGGAGATGC`-BBQ
	RdRp_SARSr-R	`CARATGTTAAASACACTATTAGCATA`
GAPDH	GAPDH-F	`GTGAAGGTCGGAGTCAACGG`
	GAPDH-P	ROX-`CGCCTGGTCAACAGGGTCGC`-BBQ
	GAPDH-R	`TCAATGAAGGGGTCATTGATG`

Open in a new tab

The reagents and conditions of Real time RT-PCR multiplex were summarized in Table 2. The plots for RdRP were evaluated in the Green channel (470 nm for excitation, 510 nm for detection, fluorescent FAM labeled probe). The plots for GAPDH were evaluated in the Orange channel (585 nm for excitation, 610 nm for detection, fluorescent ROX labeled probe). The results were analyzed considering the cycle threshold (Ct) values. Samples presenting Ct values lower than 37 and 40 in the green and orange channels, respectively, were reported as "positive".

Table 2. Real time RT-PCR multiplex for SARS-CoV-2 using GAPDH as internal control: Conditions and thermal cycling reactions using biotechrabbit reagents.

Phases	Temperature	Time	Cycles
Reverse transcription	50°C	10 minutes	1
Initial denaturation	95°C	3 minutes	1
PCR amplification	95°C	10 seconds	45
	58°C	30 seconds
	40°C	30 seconds

Open in a new tab

All reactions were conducted using positive and negative controls, including those related to RNA extraction. The RNA from the original sample 28549 used to isolate and titer the Peruvian strain in the Vero cell line at the National Reference Laboratory of Respiratory Viruses was used as a positive control. The RNA from SARS-CoV-2 negative samples, whose results were obtained according to the standard protocol suggested by WHO, was used as a negative control. The PCR water was used as negative reaction control.

Statistical analysis

The Ct values obtained from Real time RT-PCR reactions performed with both RNA extraction methods during the standardization proceeding and related to the comparison of six epidemiological weeks were submitted to Normality Test and submitted to ANOVA in both channels, RdRp and GAPDH. The p values < 0.05 and F values > F critic were considered significant differences.

Results and discussion

The Real time RT-PCR reactions using both RNA extraction methods are shown in S1 Table, containing the sample code, Ct values for RdRp and GAPDH channels, average, and standard deviation. The standard deviation observed on the GAPDH channel was higher than the RdRp channel. The statistical analysis of variance was conducted from Ct values obtained in each channel. In the RdRp channel, the p and F values indicated that there was no significant difference between both RNA extraction methods, commercial kit versus in-house proteinase K, followed by thermal shock (F = 0.653970542; p = 0.421036775; F critic = 3.957388322; summary of these analyzes available in S1 Table). However, in the GAPDH channel, the p and F values presented a significant difference (F = 15.27288168; p = 0.000139023; F critic = 3.902553068; summary of these analyzes available in S1 Table). The F value represents how much the variability between the means can exceeds the expected value due the chance; in this sense, F values superior the F critical values is analogous to a p value less than alpha, indicating the rejection of the null hypothesis (that there is no significant difference between averages) [11].

Our biggest challenge after establishing the communitarian transmission of SARS-CoV-2 in Peru during the COVID-19 pandemic has been obtaining reagents and critical material to conduct and maintain the molecular testing. The privation of specific reagents’ suppliers, for example, made it necessary to implement and validate protocols to guarantee the continuity of tests. Furthermore, establishing optimizations in the diagnostic tools for cost and processing time reduction is essential to make it possible to process sufficient samples in developing countries.

The COVID-19 molecular diagnosis can be biased by the samples’ quality, the RNA extraction process, and factors related to the amplification protocol. To overcome these difficulties, the INS has conducted and validated several protocols from sample collection until final diagnosis (in house viral transport medium, saliva, diagnostic methods–molecular, serological, among others). In many countries, particularly in Latin America, the COVID-19 pandemic placed in evidence a flawed health system and a low response capacity for timely diagnosis that effectively contributes to surveillance and control. The WHO recommended molecular tests, but they were very scarce at the beginning, there were not enough laboratories, and the external market for diagnostic supplies was closed. In this context, there was a need to implement alternative techniques or adapt existing ones to make them more viable and reduce processing times and costs, and thus it was achieved by using thermal shock as part of the Real time RT-PCR processing for the diagnosis of SARS-CoV- 2 in Peru and can be extended to other countries with limited resources.

Technically, the RNA molecule, the genetic material of coronaviruses, is overly sensitive to the rise and drastic temperature variation used in our protocol. On the other hand, the results obtained by us and other researchers using protocols of kit-free RNA extraction have presented yielded promising results. Many of these have been made considering physic-chemistry characteristics commonly used in step from kit-based protocols. Kriegova et al. (2020) [12], for example, considered the temperature increase as physic tool and described the Direct-One-Step-RT-qPCR (DIOS-RT-qPCR) protocol for SARS-CoV-2 detection using 14 μL of the medium used to transport the swab previously submitted to virus inactivation at 75°C at 10 minutes; they obtained an efficient analytical sensibility, being able to detect virtually 550 virus copies/mL. Wozniak et al. (2020) [13], in contrast, also published a kit-free procedure for RNA extraction but based in chemistry principle, the pH change, presenting results scientifically acceptable.

Considering these shared physical-chemistry parameters associated in an unique protocol, Michel et al. (2020) [14] described the “COVID-quick-DET”, in which the dry swab should be submitted to elution in 1 mL of normal saline, mixed using vortex during 5 seconds and treated with the same concentration of proteinase K used in our procedure. The main differences are related to an additional step, the centrifugation step (8,000 rpm, 2–5 seconds) and the absence of thermal shock (incubation in a dry thermal block: 56°C, 3 min; 95°C, 3 min). Other studies, many of them usually denominated “direct detection of SARS-CoV-2” via a RT-qPCR assay [15–17], have used steps pre-PCR similar to our protocol; they also have identified a high percentage of agreement in paired analysis in that the tested methods were compared with standard commercial kit protocols. In general, the dissonant dataset of samples has been associated with low viral load (high Ct), and which was not observed in our study. The pre-PCR protocol of Smirlak et al. [18] is based on heat-inactivated or lysed samples; they displayed the effectiveness of heat inactivation by plaque assay and the use of alternative buffers as a transport medium for direct Real time RT-PCR; their results were significant and comparable to ours by saving time and cost in molecular testing for COVID-19.

We performed comparative experiments in triplicate, in the laboratory standardization, and performed the statistical analysis using the averages, finding 100% agreement in our results. In addition, our statistical analyses showed no significant difference between Ct values obtained when the same sample was processed in parallel by both RNA extraction methods in the green channel, e.g., for RdRp detection (SARS-CoV-2 specific). Nevertheless, there was significant difference between RNA extracted using our method compared to the one that used the commercial kit in the orange channel, e.g., GAPDH channel (internal control), in which the variance of Ct values was higher in samples submitted to extraction using commercial kit than that extracted using our method. Common RNA purification kits have, in contrast, a step for the removal of genomic DNA. Our non-kit-purified protocol does not contain any DNase step, resulting in higher amounts of cellular debris and contaminating DNA in the solution. The extra material is not a problem for the viral targets but can explain significant variations in GAPDH detection.

Last and not least, we performed a comparison of positivity between epidemiological weeks (EW) in June-2020. In that moment, the INS of Peru processed 148,396 clinical samples during the EW 21, 22, 24, 25, 28, and 29. In this period, the samples had their RNA extracted using commercial kits on 21, 22, 28, and 29 EW and using exclusively proteinase K treatment followed by thermal shock on 24 and 25 epidemiological weeks. The total of samples processed, and the positivity presented normal distribution. The comparison was established from the positivity average between these weeks, and there was no significant difference, and the data were showed in Table 3.

Table 3. Comparison of COVID-19 positivity obtained by Real time RT-PCR multiplex for SARS-CoV-2 using GAPDH as internal control from two RNA extraction methods in six epidemiological weeks, four using commercial kits (EW 21, 22, 28 and 29) and two using proteinase k treatment followed by thermal shock (EW 24 and 25).

Epidemiological week	Samples processed	Positive (n)	Positivity (%)	Average (%)	SD
21	17,212	5,275	30.65	31.59	1.329361
22	20,287	6,599	32.53	31.59	1.329361
24	26,160	8,042	30.74	30.955	0.304056
25	23,238	7,243	31.17	30.955	0.304056
28	25,134	8,343	33.19	32.8	0.551543
29	36,365	11,787	32.41	32.8	0.551543
Total	148,396	47,289	31.78

Open in a new tab

The more significant number of samples processed in the last two (EW 28 and 29) and the increase in positivity may be associated with the quarantine ending on 30th June. However, this change in behavior in the population did not lead to a significant increase in positivity. Even that several protocols have been published about molecular testing for COVID-19, and all of them have similar principles and methods, involving heating for viral inactivation, buffer solutions for samples transporting and optimizations of PCR protocols, we did not find any research describing a screening in the population. Our findings can be unconclusive but similarly could suggest that our protocol kit-free presented analogous yield with the reference protocol kit-based.

All these findings have indicated that alternative methods present adequate sensitivity to detect positive patients potentially spreaders. Besides, the processing time was faster using our protocol in which the time of extraction was optimized to be done in almost 30 minutes, including hand pipetting. This point also could be an imperative feature because consequently more people were tested simultaneously. Additionally, these proceeding of RNA extraction could be tested using other enveloped viruses and could be a feasible option to be implemented in the diagnostic routine in public-health surveillance of infectious diseases.

Conclusions

We concluded that our in-house method is an easy, fast, and cost-effective alternative method for extracting RNA and conducing molecular diagnosis of COVID-19.

Supporting information

S1 Appendix. Real time RT-PCR multiplex for SARS-CoV-2 using GAPDH as internal control.

(DOCX)

Click here for additional data file.^{(22.3KB, docx)}

S1 File

(DOCX)

Click here for additional data file.^{(70KB, docx)}

S1 Table. Comparative COVID-19 molecular diagnosis by Real time RT-PCR multiplex for SARS-CoV-2 using GAPDH as internal control from two RNA extraction methods.

The comparison was established from Ct values of two channels, RdRp specific for SARS-CoV-2 and GAPDH, obtained in each sample extracted by both RNA extraction methods.

(XLSX)

Click here for additional data file.^{(90.1KB, xlsx)}

Acknowledgments

We are thankful to all the Microbiology and Biomedicine Laboratory workers of INS, who were involved in obtaining, handling, and processing the samples for COVID-19 molecular diagnosis.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This study was supported by Nacional Institute of Health (NIH), state Institution associated whit Ministry of Health from Peru. We thank the Pan American Health Organization (PAHO) for providing primers, probes and referential controls and the initial protocol for RNA extraction using thermal shock.

References

1.Lu R, Zhao X, Li J, Niu P, Yang B, Wu H et al. Genomic characterization and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020. 22;395(10224):565–574. 10.1016/S0140-6736(20)30251-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.who.int [Internet]. World Health Organization. Emergency Coronavirus disease (COVID-19). [cited 2020 Sep 14]. Available from: https://www.who.int/emergencies/diseases/novel-coronavirus-2019
3.La Rosa G, Iaconelli M, Mancini P, Bonanno Ferraro G, Veneri C, Bonadonna L, et al. First detection of SARS-CoV-2 in untreated wastewaters in Italy. Sci Total Environ. 2020. 20;736:139652. 10.1016/j.scitotenv.2020.139652 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Wang J, Feng H, Zhang S, Ni Z, Ni L, Chen Y et al. SARS-CoV-2 RNA detection of hospital isolation wards hygiene monitoring during the Coronavirus Disease 2019 outbreak in a Chinese hospital. Int J Infect Dis. 2020. 94:103–106. 10.1016/j.ijid.2020.04.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Chia PY, Coleman KK, Tan YK, Ong SWX, Gum M, Lau SK et al. Singapore 2019 Novel Coronavirus Outbreak Research Team. Detection of air and surface contamination by SARS-CoV-2 in hospital rooms of infected patients. Nat Commun. 2020. 29;11(1):2800. 10.1038/s41467-020-16670-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Hessling M, Hoenes K, Lingenfelder C. Selection of parameters for thermal coronavirus inactivation–a data-based recommendation. GMS Hyg Infect Control. 2020. 13;15:Doc16. 10.3205/dgkh000351 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.who.int [Internet]. WHO guidelines for the collection of human specimens for laboratory diagnosis of avian influenza infection. [cited 2020 Sep 14]. Available from: https://www.who.int/influenza/human_animal_interface/virology_laboratories_and_vaccines/guidelines_collection_h5n1_humans/en/.
8.cdc.gov. [Internet]. Interim Guidelines for Collecting, Handling, and Testing Clinical Specimens for COVID-19. [cited 2020 Sep 14]. Available from: https://www.cdc.gov/coronavirus/2019-ncov/lab/guidelines-clinical-specimens.html.
9.wma.net. [Internet]. WMA Declaration of Helsinki–ethical principles for medical research involving human subjects. [cited 2020 Sep 14]. Available from: https://www.wma.net/policies-post/wma-declaration-of-helsinki-ethical-principles-for-medical-research-involving-human-subjects/
10.Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveillance. 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Sawilowsky S. (2002). Fermat, Schubert, Einstein, and Behrens–Fisher: The Probable Difference Between Two Means When σ12 ≠ σ22. Journal of Modern Applied Statistical Methods. 1 (2): 461–472. [Google Scholar]
12.Fraczek MG, Zhao C, Dineen L, Lebedinec R, Bowyer P, Bromley M et al. Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction. Curr Protoc Microbiol. 2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Michel D, Danzer KM, Groß R, Conzelmann C, Müller JA, Freischmidt A, et al. Rapid, convenient and efficient kit-independent detection of SARS-CoV-2 RNA. J Virol Methods. 2020. December; 286: 113965. 10.1016/j.jviromet.2020.113965 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Kriegova E, Fillerova R, Kvapil P. Direct-RT-qPCR Detection of SARS-CoV-2 without RNA Extraction as Part of a COVID-19 Testing Strategy: From Sample to Result in One Hour. Diagnostics (Basel). 2020. August 18;10(8):605. 10.3390/diagnostics10080605 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Wozniak A, Cerda A, Ibarra-Henríquez C, Sebastian V, Armijo G, Lamig L, et al. A simple RNA preparation method for SARS-CoV-2 detection by RT-qPCR. Sci Rep. 2020. October 6;10(1):16608. 10.1038/s41598-020-73616-w [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Bruce EA, Huang ML, Perchetti GA, Tighe S, Laaguiby P, Hoffman JJ, et al. Direct RT-qPCR detection of SARS-CoV-2 RNA from patient nasopharyngeal swabs without an RNA extraction step. PLoS Biol. 2020. October 2;18(10):e3000896. 10.1371/journal.pbio.3000896 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Merindol N, Pépin G, Marchand C, Rheault M, Peterson C, Poirier A, et al. SARS-CoV-2 detection by direct rRT-PCR without RNA extraction. J Clin Virol. 2020. July;128:104423. 10.1016/j.jcv.2020.104423 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Smyrlaki I, Ekman M, Lentini A, Rufino de Sousa N, Papanicolaou N, Vondracek M, et al. Massive and rapid COVID-19 testing is feasible by extraction-free SARS-CoV-2 RT-PCR. Nat Commun. 2020. September 23;11(1):4812. 10.1038/s41467-020-18611-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0248885.r001

Decision Letter 0

Shawky M Aboelhadid

3 Nov 2020

PONE-D-20-28949

Proteinase K treatment followed by thermal shock as faster, feasible and low cost RNA extraction alternative for molecular detection of SARS-CoV-2

PLOS ONE

Dear Dr. Paulo V Marques Simas,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Dec 18 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Shawky M. Aboelhadid, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables should be uploaded as separate "supporting information" files.

3. We noted in your submission details that a portion of your manuscript may have been presented or published elsewhere.

"The article contains informations related to "RT-qPCR Multiplex using GAPDH as internal control to detect SARS-CoV-2" submitted to Infectious Diseases and Therapy; this paper is being evaluated by Editor-in-chief."

Please clarify whether this [conference proceeding or publication] was peer-reviewed and formally published. If this work was previously peer-reviewed and published, in the cover letter please provide the reason that this work does not constitute dual publication and should be included in the current manuscript.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

Reviewer #3: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this study, the authors compared the performance of proteinase K treatment followed by thermal shock with commercial extraction methods, which provides an alternative way to test SARS-CoV-2 in low income regions. The comments discussed below are provided for consideration.

1. The authors used three different enzymes and reagents to perform PCR, but didn’t mention the differences between these reagents. Could the discrepancy between results be due to the reagents used?

2. Table 3: How many times was each sample repeated? Where does average and SD come from?

3. As seen in Table 3, although the statistical analysis of variance showed no significant difference, the CT value of several samples is largely different in commercial kits group and PK+TS group. Such as 84667, 84677, 85480, 85481…

4. As for testing RNA virus, RNaseP might be better than GAPDH as internal control.

5. Line 283, is it possible that proteinase K treatment caused false positive result? The inconsistent results should be confirmed with a more sensitive reagent. Also, the successful amplification of GAPDH cannot guarantee that there were no false negative results.

6. Table 4, the positive rate of week 24 and 25 is slightly lower than other weeks.

Reviewer #2: This article is timely in the current pandemic, with many readers likely keen to learn as much about COVID-19 as possible. However, there are some major issues with this article.

Title: suitable

Abstract: The abstract should contain a mention of the specific study design and at the end should contain a sentence on implication of this study.

Background: The background is adequate

Methods: The methods section should be revisited. Is this indeed a retrospective study? In a retrospective study of how the two methods were compared. How was the sample compared before and after archiving? What is the commercial kit used in this study?

Results: The results are adequate for a retrospective study

Discussion: There is need to discuss these findings to reflect the objectives of the study. Authors should focus on these and compare their results critically with other similar studies and derive a valid inference based on their findings.

Conclusion: adequate for a retrospective study

References: inadequate

General comments: The whole manuscript needs copy-editing and should preferably be edited by an English expert or native English speaker

Reviewer #3: The presented manuscript by Ñique and colleagues presents a helpful addition to the growing list of publications describing alternatives to kit-based RNA isolation for SARS-CoV-2 diagnostics, which is of continuing importance considering increasing case numbers in secondary waves of infection in countries with limited resources. Their side-by-side comparison of kit-based and kit-free RNA preparation with SARS-CoV-2 and endogenous control target detection is sound and shows that ProtK + Heat shock is a suitable alternative to RNA purification if resources are limited. However, the article suffers from poor English in some places, making it less comprehensible. The presented method should also be compared to already published kit-free protocols for SARS-CoV-2 qPCR rather than unrelated protocols for DNA processing. Some conclusions need to be revised – there cannot be 100% concordance between the protocols if at least 1/72 samples is positive in one protocol but not the other, as discussed. Comparing epidemiological weeks when kit-based and kit-free detection was performed based on positivity rates is interesting, but it should be added that this cannot be proof of whether the method is superior/equivalent or not, as there is no direct comparison for the same samples. A revised version would be suitable for publication in PLOS ONE.

Typo in financial disclosure “associated whit Ministry of Health”

Language - in competing interests “declare none” – should be “no”

Line 1: Title “faster” – than what? Change to fast or include “kit-based” or something like this

Line 26: Change sentence structure “Sometimes, even with the funds and resources available to purchase them, the lack of suppliers and the global shortage of material as consequence of the high demand, makes timely detection and diagnosis of the virus carrier difficult.”

Line 34: Concordance was 100% and then RT-qPCR was performed” – concordance with test samples? Add this, otherwise confusing.

Line 37: This sentence is confusing and only made sense after reading the entire manuscript, so it should be formulated more clearly. I would suggest the following: “We compared the SARS-CoV-2 positivity obtained using our kit-free method within two complete epidemiological weeks to the two weeks prior and after, where RNA was extracted using commercial kits. There was no significant difference between positivity rates, suggesting the use of a kit-free RNA preparation method did not significantly alter detection rates.”

Line 41: Language – “there was no significant difference”. Also, what does “positive results average” mean?

Line 49: “type” is not part of the name of the virus, it’s just “Severe acute respiratory syndrome coronavirus 2”

Line 54: Language – change to “and makes them”

Line 65: 5-log reduction in what – infectivity? Please add.

Line 66: Language – change to “are also used during amplification by RT-qPCR”

Line 67: Language – change to “Furthermore, using an internal control for RT-qPCR reaction can confirm integrity of the samples, decreasing the probability of false-negative results” (“exponentially” is odd here)

Line 70: There’s something missing in this sentence. I assume it should be something like “… physical methods like heating and specific chemical reagents like proteinase K widely used in genetic material extraction protocols may be used to optimize viral purification”

Line 76: Remove “assay” – a purification is not an assay.

Line 77: Spelling “stablished” – change to “established”

Line 79: Language – change to “We compared to efficiency of the new method based on Ct values obtained by…”

Line 91: Language – I assumed “people suspected” should just be “patients”

Line 92: Language – change to “sample collection”

Line 132-147: This paragraph is confusing. You tested 72 samples with both methods. Also, during June 3-25, all diagnostics was done with the presented ProtK/thermal shock method because no kits were available. Was this before or after the 72 samples were tested with both methods? Then you’re comparing positivity obtained in the period where kit-less methods were used to other periods where kit-based methods were used – on the assumption that numbers would be similar based on progression (or rather non-progression) of the pandemic? This is interesting, but should not be over-interpreted and treated with caution.

Line 181: Language – “in both channels”

Line 198: Here you write that ANOVA was used on Ct values, while in the methods section (line 181) you write that “qualitative results of RT-qPCR were submitted to ANOVA”. Ct is a quantitative result.

Line 202: You should discuss why GAPDH is significantly more abundant in the non-kit samples. The differences is quite substantial – I would suspect this is from cellular debris that may be more abundant in the non-kit-purified samples.

Line 223: Language/confusing – there was an increase in cases (and testing), likely due to the lockdown being lifted but the increase was not significant compared to previous weeks? If so, rephrase to “this change in behaviour in the population apparently didn’t lead to a significant increase in positivity”.

Line 226: Spelling “stablishing” – change to establishing.

Line 229: Language – change “provided” to “made it necessary to implement and validate protocols in house…”

Line 232: Language – change to “is essential to make it possible to process sufficient samples in underdeveloped countries”

Line 234: Language – “sample quality”

Line 239: It’s okay to mention this but DNA from spores and RNA from viruses are hardly comparable, so I would remove some of the details that don’t add anyhting to this manuscript.

Line 254: Language – “since the samples are processed in 96 well plate format”. Also, especially since this is a crucial point, just state the time/sample. Currently it sounds odd that 5.5h is “8 times higher” than “less than 1h”.

Line 257: Similar to the spores, not really relevant to compare environmental DNA to viral RNA.

Line 264: It is also okay to cite preprints. Besides there are multiple published manuscripts describing “kit-free” RNA preparation for qPCR of SARS-CoV-2 that should be discussed.

10.1016/j.jviromet.2020.113965

10.3390/diagnostics10080605

https://doi.org/10.1038/s41598-020-73616-w

https://doi.org/10.1371/journal.pbio.3000896

https://doi.org/10.1371/journal.pone.0236564

https://doi.org/10.1038/s41467-020-18611-5

https://doi.org/10.1016/j.jcv.2020.104423

Line 274: Language – “since these variables”

Line 276: Why the quotation marks? Also its rather what makes this “purification” possible, not an advantage.

Line 283: Earlier in the manscript you write about “100% concordance”, yet here is a sample where this is not the case. I would also caution the interpretation that a sample negative by definition of Cut-off when purified with the commercial kit but positive when treated with ProtK/thermal shock was “false-negative” with the commercial kits – both values are very high and I would be cautious about higher background signal in non-purified samples.

Line 291: But the advantage of multiplexed detection of SARS-CoV-2 and an endogenous control would be the case for both the commercial kit and your in-house method. And you cannot exclude false-positives by your method compared to commercial kits based on higher background.

Line 292: ”Our results showed no significant difference between Ct values obtained when the same sample were processed in parallel by both RNA extraction” – what about sample 84677 mentioned just in the above paragraph?

Line 294: “Ct values of positive control have always been in agreement” – but this is already isolated RNA. Did you also subject the sample sample to your in-house method of ProtK/Heat?

Line 301: Would be highly cautious calling something a “better yield” based on one sample where this happened (see above comment)

Table 2: Add the actual product used somewhere (catalogue ID).

Table 3: It would be helpful if this was also displayed graphically. Also please state what the averages are derived from – commercial kit and PK + TS?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Mar 24;16(3):e0248885. doi: 10.1371/journal.pone.0248885.r002

Author response to Decision Letter 0

14 Dec 2020

REPONSE TO THE EDITOR AND REVIEWERS

PONE-D-20-28949

#EDITOR:

R: The data related to the standardization of RT-qPCR cited in our paper is from the INS and only was used as a useful tool to test our RNA extraction method. Since these data are from INS, this does not constitute a dual publication.

R: The enzymes and reagents mentioned were used in the preliminary tests, considering the standard procedures for implementing a new INS protocol (data not relevant). The Biotech Rabbit was used in the RT-qPCR reactions to compare only the extraction methods. Since we conducted new RT-qPCR reactions for replicates, we only used a type of enzyme, the Biotech Rabbit, to standardize the reactions and consider only the comparison between the RNA extraction methods.

2. Table 3: How many times was each sample repeated? Where does average and SD come from?

R: We conducted new RT-qPCR reactions in triplicate. The new data were updated and submitted as table S1.

R: The new statistical analysis showed a significant difference between RNA extracted using our method compared to that used commercial kit. Also, we identified higher variance between samples when extracted by commercial kit than that extracted using our method. This point could be justified by the column method that uses solid phase and can saturate. Since the internal control is more abundant than viral RNA and our method considers total RNA in the solution, the saturation does not occur, and the RT-qPCR reactions can detect the GAPDH RNA more easily (this material is widely available).

4. As for testing RNA virus, RNaseP might be better than GAPDH as internal control.

R: We agree with this point. The GAPDH gene was already used as an internal control for the detection of SARS COV2. Besides, the supplies were available, and their cost is lower compared to commercial RT-PCR kits.

R: We performed the RNA extraction from the same sample using both methods, and the results were 100% in agreement. In this sense, the samples with low viral load should present disagreement results between the methods (the commercial kit should be more sensible), which was not valid. We understood that our protocol presented the same efficiency as that commercial kit to extract the SARS-CoV-2 RNA.

6. Table 4, the positive rate of week 24 and 25 is slightly lower than other weeks.

R: Even the positivity data presented in the epidemiological weeks 24 and 25 was slightly lower than the others. There was none significant difference between them.

Reviewer #2: This article is timely in the current pandemic, with many readers likely keen to learn as much about COVID-19 as possible. However, there are some major issues with this article.

Title: suitable

Abstract: The abstract should contain a mention of the specific study design and at the end should contain a sentence on implication of this study.

Background: The background is adequate

Results: The results are adequate for a retrospective study

Conclusion: adequate for a retrospective study

References: inadequate

General comments: The whole manuscript needs copy-editing and should preferably be edited by an English expert or native English speaker

Reviewer #3: The presented manuscript by Ñique and colleagues presents a helpful addition to the growing list of publications describing alternatives to kit-based RNA isolation for SARS-CoV-2 diagnostics, which is of continuing importance considering increasing case numbers in secondary waves of infection in countries with limited resources. Their side-by-side comparison of kit-based and kit-free RNA preparation with SARS-CoV-2 and endogenous control target detection is sound and shows that ProtK + Heat shock is a suitable alternative to RNA purification if resources are limited. However, the article suffers from poor English in some places, making it less comprehensible. The presented method should also be compared to already published kit-free protocols for SARS-CoV-2 qPCR rather than unrelated protocols for DNA processing. Some conclusions need to be revised – there cannot be 100% concordance between the protocols if at least 1/72 samples are positive in one protocol but not the other, as discussed. Comparing epidemiological weeks when kit-based and kit-free detection was performed based on positivity rates is interesting, but it should be added that this cannot be proof of whether the method is superior/equivalent or not, as there is no direct comparison for the same samples. A revised version would be suitable for publication in PLOS ONE.

Typo in financial disclosure “associated whit Ministry of Health”

Language - in competing interests “declare none” – should be “no”

Line 1: Title “faster” – than what? Change to fast or include “kit-based” or something like this

R: The title was updated according to your suggestion.

R: Sometimes, the lack of suppliers and the global shortage of material due to the high demand make it difficult for timely detection and diagnosis of the virus carrier even with the funds and resources available to purchase the reagents.

Line 34: Concordance was 100% and then RT-qPCR was performed” – concordance with test samples? Add this, otherwise confusing.

R: The concordance between results obtained by RT-qPCR from both RNA extraction methods was 100% in the samples tested. In the data presented in table 3, there was a disagreement related to only one sample. Since one of the reviewers suggested that we present results obtained from average, we executed new rounds of experiments, considering experimental triplicate and including other six samples more (from 72 samples to 78 samples; from unique running to triplicate running). The new results presented a 100% in agreement.

We make all changes according to the suggestions.

Line 41: Language – “there was no significant difference”. Also, what does “positive results’ average” mean?

Line 49: “type” is not part of the name of the virus, it’s just “Severe acute respiratory syndrome coronavirus 2”

Line 54: Language – change to “and makes them”

Line 65: 5-log reduction in what – infectivity? Please add.

R: The information was added.

Line 66: Language – change to “are also used during amplification by RT-qPCR”

Line 76: Remove “assay” – a purification is not an assay.

R: The word was removed.

Line 77: Spelling “stablished” – change to “established”

Line 79: Language – change to “We compared to efficiency of the new method based on Ct values obtained by…”

Line 91: Language – I assumed “people suspected” should just be “patients”

Line 92: Language – change to “sample collection”

1. Was this before or after the 72 samples were tested with both methods?

R: These proceedings for COVID-19 molecular diagnosis using RNA extracted using heat shock and proteinase k were conducted after validation using the 78 samples.

2. Then you’re comparing positivity obtained in the period where kit-less methods were used to other periods where kit-based methods were used – on the assumption that numbers would be similar based on progression (or rather non-progression) of the pandemic? This is interesting, but should not be over-interpreted and treated with caution.

R: The sentence was rewritten considering this caution.

Line 181: Language – “in both channels”

R: We conducted experiments without using a standard curve. In our case, the Ct values were only indirect measures of viral load.

Line 202: You should discuss why GAPDH is significantly more abundant in the non-kit samples. The differences are quite substantial – I would suspect this is from cellular debris that may be more abundant in the non-kit-purified samples.

Line 223: Language/confusing – there was an increase in cases (and testing), likely due to the lockdown being lifted but the increase was not significant compared to previous weeks? If so, rephrase to “this change in behavior in the population apparently didn’t lead to a significant increase in positivity”.

Line 226: Spelling “stablishing” – change to establishing.

Line 229: Language – change “provided” to “made it necessary to implement and validate protocols in house…”

Line 232: Language – change to “is essential to make it possible to process sufficient samples in underdeveloped countries”

Line 234: Language – “sample quality”

Line 239: It’s okay to mention this but DNA from spores and RNA from viruses are hardly comparable, so I would remove some of the details that don’t add anything to this manuscript.

Line 257: Similar to the spores, not really relevant to compare environmental DNA to viral RNA.

Line 264: It is also okay to cite preprints. Besides there are multiple published manuscripts describing “kit-free” RNA preparation for qPCR of SARS-CoV-2 that should be discussed.

These papers should be included in the discussion.

https://doi.org/10.1016/j.jviromet.2020.113965

https://doi.org/10.3390/diagnostics10080605

https://doi.org/10.1038/s41598-020-73616-w

https://doi.org/10.1371/journal.pbio.3000896

https://doi.org/10.1371/journal.pone.0236564

https://doi.org/10.1038/s41467-020-18611-5

https://doi.org/10.1016/j.jcv.2020.104423

R: All these papers suggested were included in the discussion section.

Line 274: Language – “since these variables”

Line 276: Why the quotation marks? Also its rather what makes this “purification” possible, not an advantage.

R: The quotation marks was removed.

Line 283: Earlier in the manuscript you write about “100% concordance”, yet here is a sample where this is not the case. I would also caution the interpretation that a sample negative by definition of Cut-off when purified with the commercial kit but positive when treated with ProtK/thermal shock was “false-negative” with the commercial kits – both values are very high and I would be cautious about higher background signal in non-purified samples.

R: Here we can explain that the RT-qPCR protocol used in our study was submitted to the validation process, and the positivity was measured from this point, e.g., from the cut-off obtained in that validation. There was no relation to the results presented in our paper about heat shock and proteinase k for RNA extraction.

Line 292: “Our results showed no significant difference between Ct values obtained when the same sample were processed in parallel by both RNA extraction” – what about sample 84677 mentioned just in the above paragraph?

Line 294: “Ct values of positive control have always been in agreement” – but this is already isolated RNA. Did you also subject the sample to your in-house method of ProtK/Heat?

R: In this case, we think this point is not necessary because positive control is a standard. Many researchers use g-block or other synthetic genetic material as a positive control in their RT-qPCR reactions. Furthermore, the experiments were conducted using clinical samples, which should be considered more critical.

Line 301: Would be highly cautious calling something a “better yield” based on one sample where this happened (see above comment)

R: The expression was removed.

Table 2: Add the actual product used somewhere (catalogue ID).

R: This information was updated.

Table 3: It would be helpful if this was also displayed graphically. Also please state what the averages are derived from – commercial kit and PK + TS?

R: This table was removed and submitted as support material (table S1).

Attachment

Submitted filename: Reponse to the editor and reviewers.docx

Click here for additional data file.^{(27.9KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0248885.r003

Decision Letter 1

Shawky M Aboelhadid

24 Dec 2020

PONE-D-20-28949R1

Proteinase k treatment followed by thermal shock as faster, more feasible, and lower cost than RNA extraction kit-based as an alternative for molecular detection of SARS-CoV-2

PLOS ONE

Dear Dr. Paulo Vitor Marques Simas,

==============================

ACADEMIC EDITOR: Please authors, you must be replied to the reviewer comments. The manuscript should be revised by expertise in English language.

==============================

Please submit your revised manuscript by Feb 07 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Shawky M. Aboelhadid, PhD

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Partly

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

Reviewer #3: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: No

Reviewer #3: No

**********

6. Review Comments to the Author

Reviewer #2: Dear Editor

Unfortunately, the author did not answer the questions properly

Reviewer #3: The revised manuscript is improved in several areas, but there are still many language problems. The manuscript needs proof-reading by someone proficient in English. I will only point out the major language problems specifically here. Scientifically, the discussion is greatly improved but would benefit from more careful examination of the cited literature and less exaggerated conclusions regarding superiority of the presented method.

The title already has odd sentence structure.

Change: “Proteinase k treatment followed by thermal shock as faster, more feasible, and lower cost than RNA extraction kit-based as an alternative for molecular detection of SARS- CoV-2“ to “Proteinase K treatment followed by thermal shock as a faster, more feasible and lower-cost alternative to RNA extraction kit-based purification for molecular detection of SARS-CoV-2.

Line 54: “the variance was higher in the samples extracted by commercial kit than that used the alternative protocol,suggesting indirectly that our protocol was more efficient to total RNA extraction” – this is the least likely explanation for this observation. Much more likely, this is from cellular debris present in the non-kit samples (possibly even DNA).

Line 306: This is incorrect, Michel et al. did use clinical samples; SARS-CoV-2 virus stocks were only applied to differentiate sensitivity of the methods.

Line 313: “was really good” is a not very scientific term

Line 408: “This point could be justified by the column method uses solid phase and can saturate” – I think I know what you mean but this sentence is poorly phrased. I would also doubt the binding capacity of RNA purification columns is a realistic problem for swab material. Typical RNA mini columns (Qiagen) can bind 100 μg RNA. This is equivalent to millions of cells, which are certainly not present in swab material. The more likely explanation is that the non-kit-purified samples contain higher amounts of cellular debris and contaminating DNA. Unless I’m missing it, your protocol does not contain any DNase step that would get rid of cellular DNA contamination. Obviously this is not a problem for the viral targets, but can explain variations in GAPDH detection. Common RNA purification kits have, in contrast, a step for removal of genomic DNA.

Line 445: “Our protocol, additionally to solve our temporary” – is something missing here?

Line 448: “More than a new method, our protocol seems to be a large vantage as a public health approach” - I assume you meant to write advantage, but that’s a pretty strong statement regardless, especially with many similar protocols published.

Response to rebuttal:

Line 34: Concordance was 100% and then RT-qPCR was performed” – concordance with test samples? Add this, otherwise confusing.

Reviewer response: Are these new samples? Why is the numbering different than in the initial manuscript? I was curious what happened to sample 84677, which was positive in the PK+TS method and negative in the commercial kit method in the original manuscript. I would suggest showing the comparison of Ct obtained by both kits as a dot plot with regression line, so one can immediately see how similar it looks (for both the viral and control target).

R: The sentence was rewritten considering this caution.

Reviewer response: I don’t see any changes reducing the conclusions on this. The manuscript submitted is also not fully change-tracked, as there are changes here but none changing the conclusions.

R: We conducted experiments without using a standard curve. In our case, the Ct values were only indirect measures of viral load.

Reviewer response: This is fine, but Ct is still a quantitative measurement. You’re not comparing “positive vs. negative” in the ANOVA, so it’s still a comparison of quantiative data.

Line 301: Would be highly cautious calling something a “better yield” based on one sample where this happened (see above comment) R: The expression was removed.

Reviewer response: Not really, you’re still making the same point in Line 408 as mentioned above. I will believe this if you show it’s not DNA contamination; but you can also just tone down this conclusion.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Reviewer #3: No

PLoS One. 2021 Mar 24;16(3):e0248885. doi: 10.1371/journal.pone.0248885.r004

Author response to Decision Letter 1

5 Feb 2021

Response to Reviewers

Please authors, you must be replied to the reviewer comments. The manuscript should be revised by expertise in English language.

R: The authors carefully replied to all questions from the reviewers. In addition, the protocol is now available in https://doi.org/10.17504/protocols.io.br6bm9an.

Response to the Reviewer #3:

1. The revised manuscript is improved in several areas, but there are still many language problems. The manuscript needs proof-reading by someone proficient in English. I will only point out the major language problems specifically here. Scientifically, the discussion is greatly improved but would benefit from more careful examination of the cited literature and less exaggerated conclusions regarding superiority of the presented method.

R: The paper was submitted to a careful review by a native English professor, and the discussion and the conclusions were restructured accordingly, suggested by the reviewer.

2. The title already has odd sentence structure.

R: The paper title was changed to “A faster and less costly alternative for RNA extraction of SARS-CoV-2 using Proteinase k treatment followed by thermal shock”.

3. Abstract:

“the variance was higher in the samples extracted by commercial kit than that used the alternative protocol, suggesting indirectly that our protocol was more efficient to total RNA extraction”.

R: This sentence was deleted.

4. The misinformation about the experimental design of Michel and collaborators (2020) was eliminated.

5. The term “was really good” was deleted.

6. The sentence “Common RNA purification kits have, in contrast, a step for the removal of genomic DNA. Our non-kit-purified protocol does not contain any DNase step, resulting in higher amounts of cellular debris and contaminating DNA in the solution. The extra material is not a problem for the viral targets but can explain significant variations in GAPDH detection", according to the reviewer's suggestion.

7. The sentence “Our protocol, additionally to solve our temporary” was deleted.

8. The sentence “More than a new method, our protocol seems to be a large vantage as a public health approach” was deleted.

Response to the Reviewer #2:

1. Questions and answers related to the new round of experiments.

a) Are these new samples?

R: The experiments were repeated under the same conditions, using the same range of Ct values and in experimental triplicate, but using a new round of samples. This change occurred because either the original samples were no longer available in our sample-bank or the RNA was degraded, preventing the new experiments, according to the reviewer's suggestion.

b) Why is the numbering different than in the initial manuscript?

R: Seeing we had to conduct new experiments for guaranteeing our protocol yield and considering the discordant result presented in sample 84677, we included six more samples (almost 10% increase). Unfortunately, sample 84677 was no longer available and therefore not included in the experimental replicates. I would suggest showing the comparison of Ct obtained by both kits as a dot plot with regression line, so one can immediately see how similar it looks (for both the viral and control target).

R: The dot plot with the regression line related to the comparison of the Ct values (viral target – RdRp gene: RNA extracted by our protocol versus RNA extracted using commercial kit; internal control – GAPDH gene: extracted by our protocol versus RNA extracted using the commercial kit) was produced and is now available bellow.

2. Then you’re comparing positivity obtained in the period where kit-less methods were used to other periods where kit-based methods were used – on the assumption that numbers would be similar based on progression (or rather non-progression) of the pandemic? This is interesting but should not be over-interpreted and treated with caution.

R: The sentence was rewritten considering this caution.

3. I don’t see any changes reducing the conclusions on this. The manuscript submitted is also not fully change-tracked, as there are changes here but none changing the conclusions.

R: The conclusion was rewritten according to both reviewers' suggestions, and the file was carefully change-tracked.

4. This is fine, but Ct is still a quantitative measurement. You’re not comparing “positive vs. negative” in the ANOVA, so it’s still a comparison of quantitative data.

R: The word “qualitatively” was deleted.

5. Would be highly cautious calling something a “better yield” based on one sample where this happened (see above comment) R: The expression was removed. Reviewer response: Not really, you’re still making the same point in Line 408 as mentioned above. I will believe this if you show it’s not DNA contamination; but you can also just tone down this conclusion.

R: The idea was restructured in all the papers, and these cautious were carefully considered by the authors.

Attachment

Submitted filename: Response to Reviewers-Alternative method for RNA extraction.docx

Click here for additional data file.^{(39.6KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0248885.r005

Decision Letter 2

Shawky M Aboelhadid

17 Feb 2021

PONE-D-20-28949R2

A faster and less costly alternative for RNA extraction of SARS-CoV-2 using proteinase K treatment followed by thermal shock

PLOS ONE

Dear Dr. Paulo Vitor Marques Simas,

Please submit your revised manuscript by Apr 03 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Shawky M. Aboelhadid, PhD

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: I Don't Know

Reviewer #3: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

Reviewer #3: No

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Reviewer #2: (No Response)

Reviewer #3: I appreciate the author’s effors in rewriting the manuscript and re-plotting the data. The manuscript is greatly improved also regarding language and only minor points remain to be corrected, mainly related to phrasing.

Some minor typos/language errors appear in this version that were absent in the previous version, yet are not change tracked – I assume the authors are doing this manually. For future work, I suggest using the “Compare Documents” feature of MS Word or something similar (in Word: Review > Compare > Compare two versions of a document) – this way, changes are tracked automatically and completely.

Line 23: “during pandemic” > “during the pandemic”

Line 26 “diagnose the virus carrier” > “diagnose patients with suspected SARS-CoV-2 infection”

Line 35 “using a commercial kit with an alternative protocol” – but the alternative protocol exactly *doesn’t* use a commercial kit?

Line 42 “did not find significantly differ between them” – please rephrase, I assume you mean “did not differ significantly”

Line 50 “Thess viruses” > these viruses (This was also not change-tracked again, but appeared within the newest version while being correct in the previous one).

Line 189 “Was more significant” this implies a statistical test, if not done rephrase to “was higher”

Line 195: “p and F values represented a significant difference” – please explain what these values mean here

Line 222: “May be a challenge not accepted by other researchers” – sounds odd, rephrase or remove.

Line 224: “sucessful results” – rephrase, maybe “yielded promising results”

Line 246: “this was not denoted by us” – meaning your protocol didn’t have issues with low Ct? If yes, rephrase, e.g. “which was not observed in our study”

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Reviewer #3: No

PLoS One. 2021 Mar 24;16(3):e0248885. doi: 10.1371/journal.pone.0248885.r006

Author response to Decision Letter 2

1 Mar 2021

Response to the Editor and Reviewers

Please authors, you must be replied to the reviewer comments. The manuscript should be revised by expertise in English language.

R: The authors carefully replied to all questions from the reviewers. In addition, the protocol is now available in https://doi.org/10.17504/protocols.io.br6bm9an.

Responses or comments related to section “Comments to the Author”

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict-of-interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: (No Response)

Reviewer #3: (No Response)

Authors: No comment.

________________________________________

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Yes

Reviewer #3: Yes

Authors: No comment.

________________________________________

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: I Don't Know

Reviewer #3: I Don't Know

Authors: No comment.

________________________________________

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data – e.g. participant privacy or use of data from a third party – those must be specified.

Reviewer #2: Yes

Reviewer #3: No

Authors: We made available all data, or in the manuscript or in the supplementary material. Nevertheless, if we must submit other information, please, let us know what material we must sharing, and we unquestionably will provide it instantly.

________________________________________

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

Reviewer #3: Yes

Authors: No comment.

________________________________________

6. Review Comments to the Author

Reviewer #2: (No Response)

Reviewer #3: I appreciate the author’s efforts in rewriting the manuscript and re-plotting the data. The manuscript is greatly improved also regarding language and only minor points remain to be corrected, mainly related to phrasing.

Some minor typos/language errors appear in this version that were absent in the previous version yet are not change tracked – I assume the authors are doing this manually. For future work, I suggest using the “Compare Documents” feature of MS Word or something similar (in Word: Review > Compare > Compare two versions of a document) – this way, changes are tracked automatically and completely.

Line 23: “during pandemic” > “during the pandemic”

Authors: This sentence was reformulated according suggested by the reviewer.

Line 26 “diagnose the virus carrier” > “diagnose patients with suspected SARS-CoV-2 infection”

Authors: This sentence was reformulated according suggested by the reviewer.

Line 35 “using a commercial kit with an alternative protocol” – but the alternative protocol exactly *doesn’t* use a commercial kit?

Authors: This sentence was reformulated to eliminate this misunderstanding, according suggested by the reviewer.

Line 42 “did not find significantly differ between them” – please rephrase, I assume you mean “did not differ significantly”

Authors: This sentence was reformulated to eliminate this misunderstanding, according suggested by the reviewer.

Line 50 “Thess viruses” > these viruses (This was also not change-tracked again, but appeared within the newest version while being correct in the previous one).

Authors: This sentence was reformulated according suggested by the reviewer.

Line 189 “Was more significant” this implies a statistical test, if not done rephrase to “was higher”

Authors: This sentence was reformulated according suggested by the reviewer.

Line 195: “p and F values represented a significant difference” – please explain what these values mean here.

Authors: This sentence was reformulated adding this information, according suggested by the reviewer.

Line 222: “May be a challenge not accepted by other researchers” – sounds odd, rephrase or remove.

Authors: This sentence was deleted, according suggested by the reviewer.

Line 224: “sucessful results” – rephrase, maybe “yielded promising results”

Authors: This sentence was reformulated according suggested by the reviewer.

Line 246: “this was not denoted by us” – meaning your protocol didn’t have issues with low Ct? If yes, rephrase, e.g. “which was not observed in our study”

Authors: This sentence was reformulated according suggested by the reviewer.

________________________________________

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Reviewer #3: No

Authors: No comment.

PLoS One. doi: 10.1371/journal.pone.0248885.r007

Decision Letter 3

Shawky M Aboelhadid

4 Mar 2021

PONE-D-20-28949R3

A faster and less costly alternative for RNA extraction of SARS-CoV-2 using proteinase K treatment followed by thermal shock

PLOS ONE

Dear Dr. Paulo Vitor ,

==============================

ACADEMIC EDITOR:

Please, submit the correct version of the revised manuscript.

==============================

Please submit your revised manuscript by Apr 18 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Shawky M. Aboelhadid, PhD

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

PLoS One. 2021 Mar 24;16(3):e0248885. doi: 10.1371/journal.pone.0248885.r008

Author response to Decision Letter 3