Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Mar 25.
Published in final edited form as: Int J Astrobiol. 2019 Jan 28;18(6):502–509. doi: 10.1017/s1473550418000502

Bacterial Growth in Saturated and Eutectic Solutions of Magnesium Sulphate and Potassium Chlorate with Relevance to Mars and the Ocean Worlds

Jonathan M Wilks 1, Fei Chen 2, Benton C Clark 3, Mark A Schneegurt 1,4
PMCID: PMC7992186  NIHMSID: NIHMS1516640  PMID: 33776587

Abstract

Liquid water on Mars might be created by deliquescence of hygroscopic salts or by permafrost melts, both potentially forming saturated brines. Freezing point depression allows these heavy brines to remain liquid in the near-surface environment for extended periods, perhaps as eutectic solutions, at the lowest temperatures and highest salt concentrations where ices and precipitates do not form. Perchlorate and chlorate salts and iron sulfate form brines with low eutectic temperatures and may persist under Mars near-surface conditions, but are chemically harsh at high concentrations and were expected to be incompatible with life, while brines of common sulfate salts on Mars may be more suitable for microbial growth. Microbial growth in saturated brines also may be relevant beyond Mars, to the oceans of Ceres, Enceladus, Europa and Pluto. We have previously shown strong growth of salinotolerant bacteria in media containing 2 M MgSO4 heptahydrate (~50% w/v) at 25 °C. Here we extend those observations to bacterial isolates from Basque Lake, BC and Hot Lake, WA, that grow well in saturated MgSO4 medium (67%) at 25 °C and in 50% MgSO4 medium at 4 °C (56% would be saturated). Psychrotolerant, salinotolerant microbes isolated from Basque Lake soils included Halomonas and Marinococcus, which were identified by 16S rRNA gene sequencing and characterized phenetically. Eutectic liquid medium constituted by 43% MgSO4 at −4 °C supported copious growth of these psychrotolerant Halomonas isolates, among others. Bacterial isolates also grew well at the eutectic for K chlorate (3% at −3 °C). Survival and growth in eutectic solutions increases the possibility that microbes contaminating spacecraft pose a contamination risk to Mars. The cold brines of sulfate and (per)chlorate salts that may form at times on Mars through deliquescence or permafrost melt have now been demonstrated to be suitable microbial habitats, should appropriate nutrients be available and dormant cells become vegetative.

Keywords: astrobiology, deliquescence, epsotolerance, extremophiles, habitability, halotolerance, Mars, planetary protection, psychrotolerant, salinotolerance

Introduction

For water to remain liquid at the frigid temperatures near the Martian surface, it must contain high concentrations of solutes. Salts, sugars, and ammonia can depress the freezing point of water dramatically (Table 1). For instance, sodium and magnesium chlorates depress the freezing point of water to −23 and −69 °C, respectively (Hanley et al. 2012). Oxyanions of chlorine have been detected in Mars soils, reaching 0.6% near the Phoenix lander and likely exist as separate hygroscopic phases (Hecht et al. 2009; Kounaves et al. 2010; Ming et al. 2014; Clark & Kounaves 2016). Ammonia at high concentrations can depress the freezing point of water to −100 °C and may be relevant to the oceans of Ceres and Pluto (Nimmo & Pappalardo 2016). Even NaCl can lower the freezing point of water to −21 °C, while MgSO4 reduces it to a modest −4 °C (Toner et al. 2014). Extremely salty and cold waters created by permafrost melt or deliquescence may be the only wet habitats for microbes near Mars’ surface (Chevrier & Altheide 2008; Davila et al. 2010; Hanley et al. 2012; Rummel et al. 2014; Clark & Kounaves 2016; Rivera-Valentin et al. 2018).

Table 1.

Chemical compositions of saturated salt solutions at their eutectic temperatures.

Salt Eutectic Conditions
Concentration (wt %) Temperature (°C)
MgSO4 17 −4
MgCl2 22 −33
NaCl 27 −21
Mg chlorate 47 −69
K chlorate 3 −3
Na chlorate 39 −23
Mg perchlorate 44 −67
Na perchlorate 52 −37
Open in a new tab

The eutectic point for a solution is the combination of the highest salt concentration and the lowest temperature at which the solution remains free of ice and free of precipitate. Adding more salt leads to precipitation, while lowering the temperature leads to ice formation. Liquid water on Mars may be found at times as saturated or eutectic solutions from permafrost melt or deliquescence. For instance, it has been hypothesized that saturated ferrous sulfate brines might be the longest-lived liquids near the surface (Chevrier & Altheide 2008). The eutectic concentrations of relevant brines are typically high, above 20 wt% salt (Table 1). The eutectic conditions for (per)chlorate salts are typically at concentrations of ~40 wt% or more. Eutectic brines could form on Mars by deliquescence when these hygroscopic salts absorb atmospheric moisture (humidity). Sufficient moisture is present at the Curiosity landing site to support this process with certain perchlorate salts (Chevrier et al. 2009; Hu et al. 2016). Modeling suggests that permafrost melt would create saturated salt solutions in pore spaces given the high salt concentrations in Mars regolith (Crisler et al. 2012). The current work demonstrates bacterial growth in extremely high salt concentrations, including the eutectic conditions for MgSO4 and K chlorate, the first demonstration of microbial growth in a brine that has a reasonable likelihood of being present on Mars at certain times.

Growth of salinotolerant (exhibit growth at high salt concentrations) microbes has been demonstrated in the presence of high concentrations of solutes, including saturated NaCl and MgSO4 solutions (Crisler et al. 2012; Schneegurt 2012; Fox-Powell & Cockell 2018). We have examined culture collections captured from these natural environments rich in salts: Great Salt Plains of Oklahoma (GSP; saturated with NaCl) and Hot Lake, WA (HL) and Basque Lake, BC (BLE) (both saturated with MgSO4) (Caton et al. 2004; Crisler et al. 2012, 2018; Kilmer et al. 2014). Halotolerance (exhibits growth at high NaCl concentrations) and epsotolerance (exhibits growth at high MgSO4 concentrations) appear to be widespread in both types of environments, those rich in monovalent ions and those rich in divalent ions. Water activities are low in both environments and ionic strength is particularly high for epsomic lakes rich in sulfates. Low water activity is associated with the inhibition of microbial growth, whether the solute be salts or sugars, due to specific solute effects, which involve interplay of several physicochemical parameters (Grant 2004; Schneegurt 2012). Salinotolerant and sucretolerant (exhibit growth at high sugar concentrations) microbes are readily found in common soils and thus are not found only in extreme environments (Echigo et al. 2005; Al Soudi et al. 2017; Fredsgaard et al. 2017). We have recovered remarkably tolerant microbes from spacecraft assembly facilities as well, suggesting that microbes contaminating spacecraft may be able to grow under the extreme chemical conditions expected at certain times near the surface of Mars (Eberl & Schneegurt 2015; Wilks et al. 2017).

While high salinities appear to be widely tolerated, microbial growth at low temperatures seems to be more restricted (Clarke et al. 2013; Bakermans 2017). Although microbial metabolism is generally slowed at low temperatures, methanogenesis has been detected in permafrost at temperatures as low as −16.5 °C (Rivkina et al. 2000, 2007). Record microbial growth is limited to about −20 °C, higher than the freezing points of many eutectic brines relevant to Mars and the ocean worlds. The suggestion is that the high salt concentrations of eutectic brines may be less inhibitory to growth than their low temperatures on frigid celestial bodies. We have reported growth of bacteria at >27% Na chlorate and survival at the eutectic concentration (Al Soudi et al. 2017; Schneegurt et al. 2018). However, growth at the Na chlorate eutectic temperature of −23 °C has yet to be demonstrated for salinotolerant bacteria.

The current study examines microbial responses to two eutectic solutions that appear suitable for growth and that are potentially found at times on Mars. We have previously demonstrated strong bacterial growth in the presence of 50% (w/v; 2 M) MgSO4, which is higher than the eutectic concentration for MgSO4 of 43% (w/v) (Crisler et al. 2012, 2018; Kilmer et al. 2014). While the eutectic temperature for MgSO4 is −3.9 °C, we had previously reported growth of salinotolerant bacteria in 10% NaCl at 4 to 7 °C (Caton et al. 2004; Litzner et al. 2006; Crisler et al. 2012, 2018). The second eutectic solution we have examined is that of K chlorate, which is unusual among the (per)chlorate salts in that its eutectic concentration of ~3% is low and its eutectic temperature is moderate, near −3 °C (Hanley et al. 2012). In the current report, we demonstrate the growth of psychrotolerant isolates from saline soils at each of these eutectics. This is the first demonstration that terrestrial microbes can grow in the densest brines potentially present at times near the surface of Mars or near the oceans of icy worlds.

Materials and Methods

Site description and sample collection

Water and lake margin soils (~100 g from top 4 cm) were collected using sterile tools and containers from Basque Lake, BC at three locations: S1 (50° 36′ 02.5” N 121° 21′ 32.2′ W), S2 (50° 35′ 59.8” N 121° 21′ 27.6” W) and S3 (50° 35′ 58.9” N 121° 21′ 27.2” W) (Fig. 1). Aliquots for live culture work were held and transported fresh at ambient temperature. The soils were predominantly gray or black fine clays and silts, often with a strong sulfidic odor, and were saturated with salts.

Fig. 1.

Fig. 1.

Open in a new tab

Contextual map of Basque Lake showing sampling sites.

Organisms and enrichment of microbial isolates

Salinotolerant bacterial isolates were obtained previously from the Great Salt Plains of Oklahoma, an environment rich in NaCl (Caton et al. 2004; Litzner et al. 2006). Two previous studies of epsomic lakes, Hot Lake, WA and Basque Lake, BC, provided bacteria tolerant to 2 M (50%) MgSO4 (Kilmer 2014; Crisler et al. 2018). Finally isolates from an existing collection of epsotolerant bacteria from the spacecraft assembly facilities (SAFs) at NASA Jet Propulsion Laboratory (JPL) were included in the current study (Eberl & Schneegurt 2015; Wilks et al. 2017). Additional psychrotolerant, salinotolerant isolates were obtained from Basque Lake for the current study. Enrichment cultures were started with fresh samples of Basque Lake soils in SP medium supplemented with 50% MgSO4. Seven isolates were obtained that grew well at salt saturation for the growth temperature, namely, 67 and 56% (w/v) MgSO4 at 25 and 4 °C, respectively, and in some cases, under eutectic conditions with 43% (w/v) MgSO4 at −4 °C.

Cultures were maintained on SP medium (Caton et al. 2004), a nutrient-rich medium containing per liter: NaCl, 1 g; KCl, 2.0 g; MgSO4·7H2O, 1.0 g; CaCl2·2H2O, 0.36 g; NaHCO3, 0.06 g; NaBr, 0.23 g; FeCl3-6H2O, 1.0 mg; trace minerals, 0.5 ml; Bacto tryptone, 5.0 g; yeast extract, 10.0 g; glucose, 1.0 g; final pH 7.0. This was prepared with various concentrations of MgSO4, K chlorate, or NaCl. Throughout this work, MgSO4 is used to represent epsomite, MgSO4 · 7 H2O.

Measurement of growth in saturated and eutectic media

Bacterial growth was tested in SP medium (Caton et al. 2004), supplemented with high concentrations of MgSO4, K chlorate, or NaCl. Note that SP medium supplemented with salts at the eutectic concentration formed brines that were near-eutectic for a single salt, but by definition were not true eutectic solutions since nutritive media components were added to support microbial growth. Cultures were maintained in saturated MgSO4 media at 4 °C before growth experiments under eutectic conditions. The temperatures of the incubators were monitored with traceable wire thermometers. There were no temperature anomalies during the course of these experiments. Culture flasks and tubes were partially buried in sand to damp the effects of temperature changes due to thermostat cycling (~2 °C range) or opening the incubator for sampling. Cultures were kept in a moist box when incubations were above 0 °C. Growth was measured by turbidity as optical density at 600 nm using a Thermo Scientific Genesys 10S UV-Vis spectrophotometer. An OD of 0.1 was chosen as the threshold for positive growth. Growth also was measured by standard plate count, with serial dilution and spread plating, to enumerate colony-forming units (CFUs). Plating was typically on SP medium supplemented with 10% NaCl, since agar with high concentrations of MgSO4 did not gel. While culture turbidity is the product of live cells, dead cells, and any materials that scatter or absorb light, the standard plate count reflects only live cells capable of forming a colony on agar. Not all replicate subcultures were successful under the most extreme conditions.

Characterization of bacterial isolates

Characterization of the bacterial isolates followed protocols described previously (Caton et al. 2004; Litzner et al. 2006). SP medium composition was modified with different concentrations of NaCl or MgSO4 to measure salinity tolerances in liquid shaketubes. A threshold of 0.1 OD units was chosen for positive growth. All isolates were Gram-stained using the Protocol Gram-staining kit (Fisher Diagnostics) following the manufacturer’s instructions. The addition of 3% hydrogen peroxide solution to confluent plates or smears of culture on slides was used to detect catalase. Oxidase testing was performed using the BBL DrySlide system according to the manufacturer’s instructions. Amylase was determined after a 5-d incubation on Starch agar (Difco), followed by flooding of plates with 25% stabilized Gram’s iodine solution. Nitrate reduction tests were done as previously described (Caton et al. 2004). Production of acid and gas from carbohydrates was tested using 0.5% (w/v) glucose, lactose, or sucrose in culture tubes containing inverted Durham tubes, using a 10% NaCl solution supplemented with Bacto tryptone (10 g l−1) and phenol red (0.018 g 1−1; pH 7.3).

Crude DNA extracts from each isolate were prepared using a freeze-thaw technique as described in Caton et al. (2004). Genomic DNA in the supernatant was the target of PCR amplification of nearly complete 16S rRNA gene fragments using universal bacterial primers (EUBPA: 5′–AGAGTTTGATCCTGGCTCAG–3′ and EUBPH: 5′–AAGGAGGTGATCCAGCCGCA–3′) (Edwards et al. 1989). PCR was performed in a thermal cycler (Eppendorf Mastercycler) as 25-μL reactions containing 0.2 μM of each primer, 1 U of ExTaq DNA polymerase and associated master mix (Takara), and 5 μL of cell extract. DNA was denatured at 95 °C for 2 min, followed by 40 cycles of 95 °C for 1 min, 50 °C for 1 min, and 72 °C for 1 min, with a final 5-min extension at 72 °C. PCR amplicons were single-pass sequenced by a commercial vendor (Eurofins Genomics, Louisville, KY) using the EUBPA primer. Initial sequences were trimmed to remove remaining vector regions. All sequences appear in GenBank with accession numbers MH286503 to MH286509 and MH503928 to MH503933, for BLE and JPL sequences, respectively. Sequences were aligned using SILVA and maximum likelihood analysis was used to build trees in MEGA v7.0 (Kumar et al. 2016). Known contextual 16S rRNA gene sequences from type organisms were identified in GenBank using BLAST.

Results

Isolation and characterization of psychrotolerant bacterial isolates

Basque Lake, Hot Lake, and Spotted Lake have been recognized as Mars analogs due to their high divalent ion concentrations and low water activities (Kilmer et al. 2014; Pontefract et al. 2017; Crisler et al. 2018). Our current bacterial collections include more than 150 isolates from epsomic lakes, but these organisms were not selected for psychrotolerance. Seven new isolates were obtained from enrichments at 4 °C in SP medium supplemented with 50% MgSO4. Designated as BLE isolates, the bacteria were identified by phylogenetic analysis of 16S rRNA gene sequences (Fig. 2). Six BLE isolates were Gram-negative Halomonas and BLE4 was a Gram-positive Marinococcus. The isolates were closely related to those obtained earlier in this laboratory from HL and the GSP.

Fig. 2.

Fig. 2.

Open in a new tab

Phylogenetic tree for psychrotolerant BLE bacterial isolates from Basque Lake based on 16S rRNA gene sequences, with GenBank accession numbers.

Biochemical, morphological, and physiological characteristics of the BLE isolates are consistent with known related organisms (Table 2). Isolates were all catalasepositive, except Halomonas sp. str. BLE2, while only Halomonas sp. str. BLE 6 and 7 also were oxidase-positive. Anaerobic nitrate respiration was observed for Halomonas sp. str. BLE 5 and 6. Carbohydrate metabolism was limited, as reflected by the absence of amylase activity, as observed previously with microbes from hypersaline environments (Caton et al. 2004; Kilmer et al. 2014; Crisler et al. 2018). It is possible that four of the isolates (Halomonas sp. str. BLE 1-3, 5) are slightly salinophilic (requiring high salt for growth), showing no growth in 0.1% NaCl, but growing at 1% NaCl. All of the isolates grew at 20% NaCl and at 50% MgSO4. All of the isolates grew at temperatures from 4 to 37 °C. None grew at 50 °C and only Halomonas sp. str. BLE2 did not grow at −4 °C, near the eutectic temperature for MgSO4 and K chlorate.

Table 2.

Phenetic characteristics of psychrotolerant, salinotolerant bacterial isolates from Basque Lake. All isolates were negative for citrate, indole, H2S, motility and phenylalanine deaminase.

Trait BLE1 BLE2 BLE3 BLE4 BLE5 BLE6 BLE7
Gram − − − + − − −
Catalase + − + + + + +
Oxidase − − − − − + +
Nitrate reduction − − − − + + −
Glucose (acid/gas) +/+ −/− +/− +/− +/− +/− +/−
Sucrose (acid/gas) −/− −/− +/− +/+ +/+ −/− +/−
Lactose (acid/gas) −/− −/− −/− −/− −/− +/− +/+
Open in a new tab

Screening of salinotolerant bacterial collections

Previous studies of salinotolerant bacteria from the GSP and HL allowed for the selection of organisms with the highest likelihood of growing under extremely salty and sub-zero eutectic conditions (Table 3). A survey of HL bacteria found that only 3 of 19 salinotolerant isolates (Halomonas sp. str. HL 12 and 51 and Marinococcus sp. str. HL70) grew well in saturated (67%) MgSO4 medium at 25 °C, with four isolates (Halomonas sp. str. HL 21, 26, and 62 and Planococcus sp. str. HL20) showing slight growth. Representative growth curves by turbidity and plate count are shown for HL12, a particularly tolerant Halomonas isolate (Fig 3). Growth is relatively rapid under these extreme salt conditions, with stationary phase reached ~4 d after inoculation. Several of the BLE isolates were positive for growth in saturated MgSO4 medium at 25 °C, including Halomonas sp. str. BLE 3 and 7 and Marinococcus sp. str. BLE4. Isolates obtained from enrichments of SAF swabs in 50% MgSO4 (Bacillus sp. str. JPL10 and Staphylococcus sp. str. JPL27) also exhibited growth in saturated MgSO4 medium at 25 °C. Doubling times ranged from 9.6 to 46.7 h and maximum culture densities were above 1 OD, similar to those of low-salt cultures. When isolates were grown at 4 °C in saturated (56%) MgSO4, doubling times increased substantially, being 300 to 700 h (12 to 29 d). Several BLE isolates (Halomonas sp. str. BLE 1, 3, 5, and 7) and a HL isolate (Nesterenkonia sp. str. HL76) grew under these conditions.

Table 3.

Growth of selected Hot Lake bacterial isolates in saturated (67%) MgSO4 at 25 °C. Cultures were grown as shake-tubes in SP medium supplemented with salt. The threshold for positive growth was 0.1 OD and qualitative scores reflect the relative robustness of growth.

Hot Lake Isolate Culture Density (OD units)
 Score
Initial Final
Marinococcus sp. str. HL3 0.047 0.031 −
Marinococcus sp. str. HL6 0.129 0.063 −
Marinococcus sp. str. HL10 0.015 0.029 −
Marinococcus sp. str. HL11 0.005 0.021 −
Halomonas sp. str. HL12 0.036 1.085 +++
Planococcus sp. str. HL20 0.109 0.276 +
Halomonas sp. str. HL21 0.063 0.171 +
Halomonas sp. str. HL26 0.094 0.157 +
Halomonas sp. str. HL51 0.053 1.234 +++
Marinococcus sp. str. HL54 0.020 0.057 −
Halomonas sp. str. HL62 0.113 0.224 +
Nesterenkonia sp. str. HL64 0.017 0.010 −
Bacillus sp. str. HL68 0.016 0.005 −
Halomonas sp. str. HL69 0.013 0.020 −
Marinococcus sp. str. HL70 0.043 0.794 ++
Nesterenkonia sp. str. HL76 0.056 0.021 −
Planococcus sp. str. HL80 0.056 0.063 −
Halomonas sp. str. HL82 0.020 0.000 −
Planococcus sp. str. HL91 0.011 0.024 −
Open in a new tab

Fig. 3.

Fig. 3.

Open in a new tab

Growth of Halomonas sp. str. HL12 as shake-tubes in SP medium with saturated MgSO4 (67%, w/v) at 25 °C. Circles, standard plate count on SP medium supplemented with 10% NaCl; squares, turbidity at 600 nm.

Growth under eutectic conditions

As cultures were transferred into environments that are closer to eutectic conditions for MgSO4, growth was slowed or stopped (Table 4). At −4 °C (its eutectic temperature) and 21 wt% MgSO4 (half of its eutectic concentration), several isolates either grew, including Bacillus sp. str. JPL17, Halomonas sp. str. BLE 1, 3, 5 and 6 and HL 12, Nesterenkonia sp. str. HL 64 and 76, and Staphylococcus sp. str. JPL16.

Table 4.

Growth of selected bacterial isolates from the Great Salt Plains, Hot Lake, Basque Lake, and JPL SAFs at −4 °C with high salts. Cultures were grown as shake-tubes in SP medium supplemented with salt. The threshold for positive growth was 0.1 OD. Note that the K chlorate trials were at eutectic conditions.

Isolate Growth at −4 °C
21% MgSO4 3% KCIO3
Halomonas sp. str. GSP3 − −
Bacillus sp. str. GSP10 − −
Halomonas sp. str. GSP21 − −
Bacillus sp. str. GSP63 − −
Marinococcus sp. str. HL11 − −
Halomonas sp. str. HL12 + −
Marinococcus sp. str. HL54 − −
Nesterenkonia sp. str. HL64 + +
Nesterenkonia sp. str. HL76 + −
Planococcus sp. str. HL91 − −
Halomonas sp. str. BLE1 + −
Halomonas sp. str. BLE2 − −
Halomonas sp. str. BLE3 + −
Halomonas sp. str. BLE5 + −
Halomonas sp. str. BLE6 + −
Halomonas sp. str. BLE7 + +
Virgibacillus sp. str. JPL9 − −
Bacillus sp. str. JPL10 + +
Bacillus sp. str. JPL14 + −
Staphylococcus sp. str. JPL16 + −
Bacillus sp. str. JPL17 + −
Staphylococcus sp. str. JPL27 + +
Open in a new tab

Growth of Halomonas sp. str. BLE 1, 3, 6 and 7 and Nesterenkonia sp. str. HL76 was observed under the eutectic conditions for MgSO4. A representative growth curve is presented for Halomonas sp. str. BLE7, which grew best, and compared with that of Marinococcus sp. str. BLE4, which did not grow at this eutectic (Fig. 4). Note that growth is substantially slowed next to that observed for saturated MgSO4 at 25 °C. In saturated MgSO4 at 25 °C, stationary phase was reached in about 4 d. However, under eutectic conditions, it took >50 d and perhaps as long as 200 d for Halomonas sp. str. BLE7 cultures to reach their maximum cell density. Cells held under these conditions for months appeared somewhat smaller than is typical and formed mucoidy flocs. The characteristic orange coloration of Nesterenkonia sp. str. HL76 was maintained even in cultures incubated under eutectic conditions for more than two years.

Fig. 4.

Fig. 4.

Open in a new tab

Bacterial growth at the MgSO4 eutectic in static liquid cultures of SP medium supplemented with 43% (w/v) MgSO4 at −4 °C. Closed, standard plate counts on SP medium supplemented with 10% NaCl; open, turbidity at 600 nm; circles, Halomonas sp. str. BLE7; squares, Marinococcus sp. str. BLE4.

The eutectic state of K chlorate is at approximately the same temperature as the MgSO4 eutectic, but at a much lower salt concentration (3% for K chlorate and 43% for MgSO4). Several isolates showed substantial growth under the eutectic conditions for K chlorate including Bacillus sp. str. JPL10, Halomonas sp. str. BLE7, Nesterenkonia sp. str. HL64, and Staphylococcus sp. str. JPL27. Representative data for BLE7 cultured at the K chlorate eutectic point (only one of three replicates grew) demonstrates that growth was slowed, as observed for eutectic MgSO4 (Fig. 5). Stationary phase was reached after 100 d and perhaps not until near 200 d after inoculation. Our previous study reported that growth of salinotolerant isolates in K chlorate up to 1 M (10%) at room temperature was much more rapid, reaching stationary phase in less than a week (Al Soudi et al. 2017).

Fig. 5.

Fig. 5.

Open in a new tab

Bacterial growth of Halomonas sp. str. BLE7 at the K chlorate eutectic as a static liquid culture in SP medium supplemented with 3% K chlorate at −4 °C.

Discussion

Natural brines on Earth are usually dominated by chloride salts. While chlorides are present in Martian soils, often sulfates are found in higher abundance, reaching 30% by weight (Vaniman et al. 2004; Gendrin et al. 2005). Dry conditions near Mars’ surface allow the preservation of (per)chlorate salts that are rare on Earth, being found in the driest soils of the Atacama Desert (Kounaves et al. 2010; Jackson et al. 2015). Several of the salts that are most relevant to soils on Mars are hygroscopic enough to form saturated brines through deliquescence. When present, cold liquid brines on Mars, rich in divalent ions and oxidants, may be most limiting for growth when near their eutectic points. Epsomic lakes of southern British Columbia and the Qaidam Basin, China, have divalent ion concentrations similar to potential Martian brines (Hammer 1978, 1986; Haynes & Hammer 1978; Kezao & Bowler 1986; Last & Slezak 1988; Last & Ginn 2005). How microbes from analog sites, such as Hot and Basque Lakes, respond to the chemical conditions on Mars informs our understanding of habitable regions, forward planetary protection, and exobiology.

Temperatures at the surface of Mars typically average below −33 °C, but can reach over −3 °C in summer (Mellon et al. 2004). Maximum daily temperatures do not fall below −68 °C. Saturated solutions of some (per)chlorate and sulfate salts would remain liquid under these conditions and could be maintained globally (Chevrier & Altheide 2008). Heavy brines not only have greatly depressed freezing points; evaporation of water also is slowed, with less potential to boil at low ambient atmospheric pressures. Brines below the surface of Mars would evaporate even more slowly and are not as affected by diurnal temperature changes at the surface. The high concentrations and low eutectic temperatures of most (per)chlorate salts seem nonpermissive for microbial growth. Cells might freeze or vitrify even within liquid brines (Fonseca et al. 2016). The high concentrations of Fe in the sulfate brines that might be the most persistent on Mars (Chevrier & Altheide 2008) also may prove to be nonpermissive for microbial growth, given the high reactivity and hence high toxicity of Fe.

Copious growth has been demonstrated in saturated (67%) MgSO4 media at 25 °C for bacteria isolated from Basque Lake (Crisler et al. 2018). We report here (and elsewhere) growth at very high MgSO4 concentrations for bacteria isolated from the Great Salt Plains, Hot Lake, and JPL spacecraft assembly facilities (Crisler et al. 2012). The isolates studied in the current report do not appear to be unique and growth at high MgSO4 concentrations is remarkably widespread, heightening planetary protection concerns. For the first time, we demonstrate that bacteria can grow in a brine that may be present at times on Mars. There has been speculation that MgSO4 brines are not suitable for life (Tosca et al. 2008), but we have observed strong microbial growth at high MgSO4 concentrations (Crisler et al. 2012, 2018; Kilmer et al. 2014). We now report that copious bacterial growth is possible in eutectic solutions of MgSO4 that may arise from permafrost melt or deliquescence at certain times. Similar eutectic brines may exist on ocean worlds such as Europa, suggesting that bacteria may be able to grow in these environments too. While K is not a major cation on Mars, it is possible that K chlorate salts could be present and create brines. We demonstrate here for the first time that bacteria can grow in eutectic K chlorate solutions.

Suitable conditions for microbial growth may well be intermittent near the surface of Mars. There could be long periods of desiccation punctuated by the formation of heavy brines through deliquescence or permafrost melt when conditions are somewhat warmer than today. Microbes may need to remain cryptobiotic, in a dormant form, for years, perhaps centuries, before revivification. Studies on the survival of microbes under nonpermissive growth conditions relevant to Mars would address this possibility, with concomitant measurement of metabolic state and DNA repair. It has been suggested that tolerance to high salt involves many of the same mechanisms leading to tolerance to other extreme environmental conditions and that DNA repair mechanisms are key to survival (Wilson et al. 2004). If microbes existed on Mars during a wetter period of its history, these may well have been deposited with the salts present today and remained viable, reviving when intermittent brines form in their vicinity.

Acknowledgements

The authors thank Timothy Eberl for isolating and characterizing JPL SAF microbial isolates and appreciate the technical support of Mark Sutton and Roshni Venagadasamy. We are grateful that Jim Britton (British Columbia Ministry of Energy and Mines) collected and documented Basque Lake samples and that Fadi Aramouni (Kansas State University) performed water activity measurements. Preliminary accounts of this work have been presented previously (Wilks et al. 2017; Schneegurt et al. 2018). This work was supported by awards from National Aeronautics and Space Administration (NASA), Research Opportunities in Space and Earth Science (ROSES), Planetary Protection Research (09-PPR09-0004 and 14-PPR14-2-0002). Additional student support was from Kansas Institutional Development Award (IDeA) Networks of Biomedical Research Excellence (KINBRE) of the National Institute of General Medical Sciences (NIGMS) of the National Institutes of Health (NIH) (P20 GM103418).

References

  1. Al Soudi AF, Farhat O, Chen F, Clark BC & Schneegurt MA (2017). Bacterial growth tolerance to concentrations of chlorate and perchlorate salts relevant to Mars. Int. J. Astrobiol 16, 229–235. [Google Scholar]
  2. Bakermans C (2017). Determining the limits of microbial life at subzero temperatures. In: Psychrophiles: From Biodiversity to Biotechnology, 2nd edn., Margesin R (ed.), Springer, Switzerland, pp. 21–38. [Google Scholar]
  3. Caton TM, Witte LR, Ngyuen HD, Buchheim JA, Buchheim MA & Schneegurt MA (2004). Halotolerant aerobic heterotrophic bacteria from the Great Salt Plains of Oklahoma. Microb. Ecol 48, 449–462. [DOI] [PubMed] [Google Scholar]
  4. Chevrier VF & Altheide TS (2008). Low temperature aqueous ferric sulfate solutions in the surface of Mars. Geophys. Res. Lett 35, L22101, doi: 10.1029/2008GL035489. [DOI] [Google Scholar]
  5. Chevrier VF, Hanley J & Altheide TS (2009). Stability of perchlorate hydrates and their liquid solutions at the Phoenix landing site, Mars. Geophys. Res. Lett 36, L10202. [Google Scholar]
  6. Clark BC & Kounaves SP (2016). Evidence for the distribution of perchlorates on Mars. Int. J. Astrobiol 15, 311–318. [Google Scholar]
  7. Clarke A, Morris GJ, Fonseca F, Murray BJ, Acton E & Price HC (2013). A low temperature limit for life on Earth. PLoS ONE 8, e66207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Crisler JD, Newville TM, Chen F, Clark BC & Schneegurt MA (2012). Bacterial growth at the high concentrations of magnesium sulfate found in Martian soils. Astrobiology 12, 98–106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Crisler JD, Chen F, Clark BC & Schneegurt MA (2018). Numerical taxonomy and phylogenetic analyses of the microbial community of epsomic Basque Lake, BC. Abstracts and Program, 118th General Meeting of the American Society for Microbiology, Atlanta, June 2018. [Google Scholar]
  10. Davila AF, Duport LG, Melchiorri R, Janchen J, Valea S, de los Rios A, Fairen AG, Möhlmann D, McKay CP, Ascaso C & Wierzchos J (2010). Hygroscopic salts and the potential for life on Mars. Astrobiology 10, 617–628. [DOI] [PubMed] [Google Scholar]
  11. Eberl TC & Schneegurt MA (2015). Isolation and characterization of bacterial communities in the clean room environment of NASA’s Jet Propulsion Laboratory-spacecraft assembly facility in Pasadena, CA. Proceedings: 11th Annual Research Symposium on Graduate Research and Scholarly Projects, Wichita, KS, April 2015. [Google Scholar]
  12. Echigo A, Hino M, Fukushima T, Mizuki T, Kamekura M & Usami R (2005). Endospores of halophilic bacteria of the family Bacillaceae isolated from non-saline Japanese soil may be transported by Kosa event (Asian dust storm). Saline Syst. 1, 8, doi: 10.1186/1746-1448-1-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Edwards U, Rogall H, Blocker H, Emde M & Böttger EC (1989). Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucl. Acids Res 17, 7843–7853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fonseca F, Meneghei J, Cenard S, Passot S & Morris GJ (2016). Determination of intracellular vitrification temperatures for unicellular micro organisms under conditions relevant for cryopreservation. PLoS ONE 11, e0152939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Fox-Powell MG & Cockell CS (2018). Building a geochemical view of microbial salt tolerance: Halophilic adaptation of Marinococcus in a natural magnesium sulfate brine. Front. Microbiol 9, 739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Fredsgaard C, Moore DB, Chen F, Clark BC & Schneegurt MA (2017). Prevalence of sucretolerant bacteria in common soils and their isolation and characterization. Antonie van Leeuwenhoek 110, 995–1005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gendrin A, Mangold N, Bibring JP & Langevin Y (2005). Sulfates in Martian layered terrains: the OMEGA/Mars express view. Science 307, 1587–1591. [DOI] [PubMed] [Google Scholar]
  18. Grant WD (2004). Life at low water activity. Phil. Trans. R. Soc. Lond. B 359, 1249–1267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hammer UT (1978). The saline lakes of Saskatchewan. III. Chemical characterization. In. Rev. Hydrobiol 63, 311–335. [Google Scholar]
  20. Hammer UT (1986). Saline Lake Ecosystems of the World. Junk, Dordrecht. [Google Scholar]
  21. Hanley J, Chevrier VF, Berget DJ & Adams RD (2012). Chlorate salts and solutions on Mars. Geophys. Res. Lett 39, L08201. [Google Scholar]
  22. Haynes RC & Hammer UT (1978). The saline lakes of Saskatchewan. IV. Primary production by phytoplankton in selected saline ecosystems. In. Rev. Hydrobiol 63, 337–351. [Google Scholar]
  23. Hecht MH, Kounaves SP, Quinn RC, West SJ, Young SMM, Ming DW, Catling DC, Clark BC, Boynton WV, Hoffman J, DeFlores LP, Gospodinova K, Kapit J & Smith PH (2009). Detection of perchlorate and the soluble chemistry of Martian soil at the Phoenix Lander site. Science 325, 64–67. [DOI] [PubMed] [Google Scholar]
  24. Hu R, Bloom AA, Gao P, Miller CE & Yung YL (2016). Hypotheses for nearsurface exchange of methane on Mars. Astrobiology 16, 539–550. [DOI] [PubMed] [Google Scholar]
  25. Jackson WA, Bohlke JK, Andraski BJ, Fahlquist L, Bexfield L Eckardt FD, Gates JB, Davila AF, McKay CP, Rao B & Sevanthi R (2015). Global patterns and environmental controls of perchlorate and nitrate co-occurrence in arid and semi-arid environments. Geochim. Cosmochim. Acta 164, 502–522. [Google Scholar]
  26. Kezao C & Bowler JM (1986). Late Pleistocene evolution of salt lakes in the Qaidam basin, Qinghai province, China. Palaeogeogr. Palaeoclimatol. Palaeoecol 54, 87–104. [Google Scholar]
  27. Kilmer BR, Eberl TC, Cunderla B, Chen F, Clark BC & Schneegurt MA (2014). Molecular and phenetic characterization of the bacterial assemblage of Hot Lake, WA, an environment with high concentrations of magnesium sulphate, and its relevance to Mars. Int. J. Astrobiol 13, 69–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kounaves SP, Hecht MH, Kapit J, Gospodinova K, DeFlores L, Quinn RC, Boynton WV, Clark BC, Catling DC, Hredzak P, Ming DW, Moore Q, Shusterman J, Stroble S, West SJ & Young SMM (2010). Wet chemistry experiments on the 2007 Phoenix Mars Scout Lander mission: Data analysis and results. J. Geophys. Res 115, E00E10, doi: 10.1029/2009JE003424. [DOI] [Google Scholar]
  29. Kumar S, Stecher G & Tamura K (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molec. Biol. Evol 33,1870–1874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Last WM & Ginn FM (2005). Saline systems of the Great Plains of western Canada: an overview of the limnogeology and paleolimnology. Saline Syst. 1, 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Last WM & Slezak LA (1988). The salt lakes of western Canada: A paleolimnological overview. Hydrobiologia 158, 310–316. [Google Scholar]
  32. Litzner BR, Caton TM & Schneegurt MA (2006). Carbon substrate utilization, antibiotic sensitivity, and numerical taxonomy of bacterial isolates from the Great Salt Plains of Oklahoma. Arch. Microbiol 185, 286–296. [DOI] [PubMed] [Google Scholar]
  33. Mellon MT, Feldman WC & Prettyman TH (2004). The presence and stability of ground ice in the southern hemisphere of Mars. Icarus 169, 324–340. [Google Scholar]
  34. Ming DW, et al. (2014). Volatile and organic compositions of sedimentary rocks in Yellowknife Bay, Gale crater, Mars. Science 343, 1245267, DOI: 10.1126/science.1245267. [DOI] [PubMed] [Google Scholar]
  35. Nimmo F & Pappalardo RT (2016). Ocean worlds in the outer solar system. J. Geophys. Res 121, 1378–1399, doi: 10.1002/2016JE005081. [DOI] [Google Scholar]
  36. Pontefract A, Zhu TF, Walker VK, Hepburn H, Lui C, Zuber MT, Ruvkun G, Carr CE (2017). Microbial diversity in a hypersaline sulfate lake: A terrestrial analog of ancient Mars. Front. Microbiol 8, 1819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Rivera-Valentin EG, Gough RV, Chevrier VF, Primm KM, Martinez GM & Tolbert M (2018). Constraining the potential liquid water environment at Gale Crater, Mars throughout MSL’s traverse. Lunar Planet. Sci. Conf 2018, 2752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rivkina E, Shcherbakova V, Laurinavichius K, Petrovskaya L, Krivushin K, Kraev G, Pecheritsina S & Gilichinsky D (2007). Biogeochemistry of methane and methanogenic archaea in permafrost. FEMS Microbiol. Ecol 61, 1–15. [DOI] [PubMed] [Google Scholar]
  39. Rivkina EM, Friedmann EI, McKay CP & Gilichinsky DA (2000). Metabolic activity of permafrost bacteria below the freezing point. Appl. Environ. Microbiol 66, 3230–3233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Rummel JD, et al. (2014). A new analysis of Mars “special regions”: Findings of the Second MEPAG Special Regions Science Analysis Group (SR-SAG2). Astrobiology 14, 887–968. [DOI] [PubMed] [Google Scholar]
  41. Schneegurt MA (2012). Media and conditions for the growth of halophilic and halotolerant bacteria and archaea. In: Vreeland RH (ed.), Advances in Understanding the Biology of Halophilic Microorganisms, Springer, Dordrecht, pp. 35–58. [Google Scholar]
  42. Schneegurt MA, Wilks J, Zayed H, Joad MD, Mahdi A, Zbeeb H, Chen F & Clark BC (2018). Bacterial growth and survival under the extreme chemical and physical conditions of Mars and the icy worlds. Abstracts and Program, 42nd COSPAR Scientific Assembly, Pasadena, CA, July 2018, F3.1-0016-18, 22238. [Google Scholar]
  43. Toner JD, Catling DC & Light B (2014). The formation of supercooled brines, viscous liquids, and low-temperature perchlorate glasses in aqueous solutions relevant to Mars. Icarus 233, 36–47. [Google Scholar]
  44. Tosca NJ, Knoll AH & McLennan SM (2008). Water activity and the challenge for life on early Mars. Science 320, 1204–1207. [DOI] [PubMed] [Google Scholar]
  45. Vaniman DT, Bish DL, Chipera SJ, Fialips CI, Carey JW & Feldman WC (2004). Magnesium sulphate salts and the history of water on Mars. Nature 431, 663–665. [DOI] [PubMed] [Google Scholar]
  46. Wilks J, Chen F, Clark BC & Schneegurt MA (2017). Bacterial growth at eutectic temperatures and in saturated salt solutions relevant to Mars. Abstracts and Program, 117th Annual Meeting of the American Society for Microbiology, New Orleans, LA, June 2017. [Google Scholar]
  47. Wilson C, Caton TM, Buchheim JA, Buchheim MA, Schneegurt MA, Miller RV (2004). DNA-Repair potential of Halomonas spp. from the Salt Plains Microbial Observatory of Oklahoma. Microb. Ecol 48, 541–549. [DOI] [PubMed] [Google Scholar]

RESOURCES