Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | B-catenin (Ctnnb1) | GenBank | ||
| Software, algorithm | R (RRID:SCR_001905) | https://www.r-project.org/ | Used for quantification and visualisation | |
| Software, algorithm | Volocity (RRID:SCR_002668) | https://quorumtechnologies.com/index.php/component/content/category/31-volocity-software | Used for quantification | |
| Software, algorithm | ImageJ (RRID:SCR_003070) | https://www.imagej.net | Used for quantification and visualisation | |
| Software, algorithm | OriginPro 2020 | OriginLab Corporation | Used for statistical analysis and visualisation | |
| Recombinant DNA reagent | 5TCF::H2B-RFP (plasmid) |
PMID:24942669 | Wnt reporter | |
| Recombinant DNA reagent | T2-5TCF::nd2Scarlet (plasmid) |
This paper and PMID:27869816 | Wnt reporter cloned into Tol2 transposon system, Daudet lab | |
| Recombinant DNA reagent | T2-Hes5::nd2EGFP (plasmid) |
PMID:22991441 | Notch reporter | |
| Recombinant DNA reagent | Hes5::d2FP635 (plasmid) |
PMID:22991441 | Notch reporter | |
| Recombinant DNA reagent | RCAS-βcat-LOF (plasmid) |
PMID:12941626 PMID:7876319 | β-catenin LOF | |
| Recombinant DNA reagent | T2-βcat-LOF (plasmid) |
This study | β-catenin LOF cloned into Tol2 transposon system, Daudet lab | |
| Recombinant DNA reagent | PB-βcat-GOF (plasmid) | PMID:24942669 | β-catenin GOF | |
| Recombinant DNA reagent | T2-βcat-GOF (plasmid) | This study | β-catenin GOF cloned into Tol2 transposon system, Daudet lab | |
| Recombinant DNA reagent | pNICD1-EGFP (plasmid) | PMID:15634704 | Notch GOF | |
| Recombinant DNA reagent | pDN-MAML1-EGFP (plasmid) | PMID:27218451 | Notch LOF | |
| Recombinant DNA reagent | T2-EGFP (plasmid) | PMID:17362912 | Control plasmid | |
| Recombinant DNA reagent | T2-mEGFP (plasmid) | This study | Control plasmid, mEGFP cloned into Tol2 transposon system, Daudet lab | |
| Recombinant DNA reagent | T2-mRFP (plasmid) | This study | Control plasmid, mRFP cloned into Tol2 transposon system, Daudet lab | |
| Recombinant DNA reagent | pTurquoise (plasmid) (RRID:Addgene_98817) | Addgene | Addgene No: 98817 | Control plasmid |
| Recombinant DNA reagent | mPB (plasmid) | PMID:19755504 | PiggyBac transposase | |
| Recombinant DNA reagent | pCAGGS-T2-TP (plasmid) | PMID:17362912 | Tol2 Transposase | |
| Commercial assay or kit | In-Fusion HD Cloning | Takarabio | No: 638916 | |
| Commercial assay or kit | RNAqueous-Micro Total RNA Isolation Kit | Life Technologies | No: AM1931 |
|
| Antibody | Rabbit polyclonal anti-Jagged 1 (RRID:AB_649685) | Santa-Cruz Biotechnology | No: sc-8303 | IF (1:200) |
| Antibody | Rabbit polyclonal anti-Sox2 (RRID:AB_2341193) | Abcam | No: 97959 | IF (1:500) |
| Antibody | Mouse IgG1 monoclonal anti-Sox2 (RRID:AB_10694256) | BD Biosciences | No: 561469 | IF (1:500) |
| Antibody | Mouse monoclonal IgG1 anti-Islet1 (RRID:AB_1157901) | Developmental Studies Hybridoma Bank | Clone 39.3F7 | IF (1:250) |
| Antibody | Mouse monoclonal IgG1 anti-HA-tag (RRID:AB_291262) | Babco Inc | No: MMS-101R | IF (1:500) |
| Antibody | Mouse monoclonal IgG1 anti-Myo7a (RRID:AB_2282417) | Developmental Studies Hybridoma Bank | Clone 138–1 | IF (1:500) |
| Antibody | Mouse monoclonal IgG1 anti-HCA (RRID:AB_2314626) | Guy Richardson | IF (1:1000) | |
| Chemical compound, drug | LiCl | Sigma-Aldrich | No: L7026 | Concentrations: 5 µM, 15 µM, 25 µM, 35 µM |
| Chemical compound, drug | IWR-1 | Sigma-Aldrich | No: I0161 | Concentration 300 µM |
| Chemical compound, drug | Leibovitz’s | Gibco | No: 21083–027 | |
| Chemical compound, drug | Matrigel | Corning | No: 354230 | |
| Chemical compound, drug | DMEM/F12 | Gibco | No: 21041–025 | |
| Chemical compound, drug | HEPES | Sigma-Aldrich | No: SRE 0065 | Concentration 1% |
| Chemical compound, drug | Ciprofloxacin | Fluka | No: 17850–5 G-F | Concentration 0.1% |
| Sequence-based reagent | 5xTCF-BS_F | This paper | PCR primers | ATGGGCCCTCGTCGAACGACGTTGTAAAACGACGG |
| Sequence-based reagent | 5xTCF-BS_R | This paper | PCR primers | TGGTGGCgAGATCTGCGGCACGCTG |
| Sequence-based reagent | Bcat_GOF_F | This paper | PCR primers | TTTTGGCAAAGAATTGCCACCATGGCTACTCAAGC |
| Sequence-based reagent | Bcat_GOF_R | This paper | PCR primers | TAGACTCGAGGAATTtcacctattatcacggccgcc |
| Sequence-based reagent | Bcat_LOF_F | This paper | PCR primers | gattacgctgctcgagcaatccccgagc |
| Sequence-based reagent | Bcat_LOF_R | This paper | PCR primers | ctagagtgaagcagctcagtaagag |