Skip to main content
PLOS One logoLink to PLOS One
. 2021 Mar 26;16(3):e0249357. doi: 10.1371/journal.pone.0249357

Prevalence of pfk13 and pfmdr1 polymorphisms in Bounkiling, Southern Senegal

Ambroise Ahouidi 1,2,*, Rafael Oliveira 3, Lis Lobo 3, Cyrille Diedhiou 2, Souleymane Mboup 2, Fatima Nogueira 3
Editor: Luzia Helena Carvalho4
PMCID: PMC7996989  PMID: 33770151

Abstract

Background

Delayed Plasmodium falciparum parasite clearance has been associated with Single Nucleotide Polymorphisms (SNPs) in the kelch protein propeller domain (coded by pfk13 gene). SNPs in the Plasmodium falciparum multidrug resistance gene 1 (pfmdr1) are associated with multi-drug resistance including the combination artemether-lumefantrine. To our knowledge, this is the first work providing information on the prevalence of k13-propeller and pfmdr1 mutations from Sédhiou, a region in the south of Senegal.

Methods

147 dried blood spots on filter papers were collected from symptomatic patients attending a hospital located in Bounkiling City, Sédhiou Region, Southern Senegal. All samples were collected between 2015–2017 during the malaria transmission season. Specific regions of the gene pfk13 and pfmdr1 were analyzed using PCR amplification and Sanger sequencing.

Results

The majority of parasites (92.9%) harboured the pfk13 wild type sequence and 6 samples harboured synonymous changes. Regarding pfmdr1, wild-type alleles represented the majority except at codon 184. Overall, prevalence of 86Y was 11.9%, 184F was 56.3% and 1246Y was 1.5%. The mutant allele 184F decreased from 73.7% in 2015 to 40.7% in 2017. The prevalence of haplotype NFD decreased from 71.4% in 2015 to 20.8% in 2017.

Conclusions

This study provides the first description of pfk13 and pfmdr1 genes variations in Bounkiling, a city in the Sédhiou Region of Senegal, contributing to closing the gap of information on anti-malaria drug resistance molecular markers in southern Senegal.

Introduction

Malaria caused by P. falciparum remains a public health problem with the majority of cases and deaths occurring in sub-Saharan Africa [1]. In Senegal, incremental interventions have significantly reduced malaria morbidity and mortality rates [2,3]. Nonetheless, in Senegal half a million people in the country suffered from malaria during 2018 [1].

Prevalence of malaria in Senegal varies across regions, with extremely low prevalence in northern (0.1%) and western (0.2%) regions, and higher prevalence (up to 5.9%) in the southern region [2,3]. Following World Health Organization (WHO) recommendations, in 2006, the Senegalese health authorities changed the first line antimalarial drug to fixed dose artemisinin combination therapies (ACTs); artemether+lumefantrine (AL) and artesunate+amodiaquine (ASAQ), as first and second lines of treatment for uncomplicated P. falciparum malaria [4]. Artemisinin resistance, as well as resistance to other antimalarial partner drugs are present in 5 countries of the Greater Mekong subregion (in Southeast Asia) [5–7] and although it has not yet been irrefutably documented in Africa [1], some reports have emerged lately [8–10].

Genome-wide analysis of artemisinin resistance in P. falciparum has demonstrated that mutations in the propeller domain of the gene encoding the Kelch 13 (K13) protein (pfk13) are associated with resistant in vitro and in vivo phenotypes in Southeast Asia [6,11,12]. Nine nonsynonymous mutations have been validated (F446I, N458Y, M476I, Y493H, R5397T, I543T, P553L, R561H and C580Y) in the Pfk13 gene as molecular markers, alongside with eleven candidate mutations [13]. In sub-Saharan Africa, increasing frequencies of nonsynonymous mutations on the pfk13 gene have been reported throughout the continent [14–16] including in Senegal [17,18] and the neighbouring The Gambia [19,20], Guinea-Bissau [21] and Mali [22].

The P. falciparum multidrug resistance transporter 1 (pfmdr1) gene encodes an ABC transporter protein located in the digestive vacuole of the parasite [23]. Pfmdr1 polymorphisms at codons N86Y, Y184F, S1034C, N1042D, and D1246Y have been associated with drug resistance to several antimalarials [24–26]. Drug pressure (in vivo) due to ACT partner drugs has resulted in directional selection of pfmdr1 variants: 86Y, Y184 and 1246Y for amodiaquine (AMQ) and N86, 184F and D1246 for AL [24–27] The same tendency is also observed in vitro and ex vivo susceptibility assays [28,29]. Interestingly, allelic replacement of pfmdr1 86Y was able to increase parasite susceptibility to dihydroartemisinin (DHA) in vitro [30].

Ex vivo susceptibilities to ACT partner drugs, lumefantrine (LUM) and AMQ, have been decreasing since 2008 in Senegal and neighboring The Gambia and Mali [19,20,31]. In The Gambia, some isolates have shown declining sensitivity to DHA in in vitro assays [19]. Despite sustained drug pressure (accessible through public and private health facilities) and a high burden of malaria, few studies on P. falciparum molecular markers of drug resistance surveillance are available from southern regions of Senegal [32]. Most of the studies of molecular marker surveillance in Senegal have been performed in Dakar and Thiés [17,31,33–41] (Fig 1). Our study provides information on pfk13 and pfmdr1 from Bounkiling, a city located in the Sédhiou region, in the South of Senegal (Fig 1).

Fig 1. Map of Senegal showing the different regions and the sample collection site.

Fig 1

Sédhiou has year-round malaria transmission that peaks during the rainy season (June through October) with sustained but lower transmission the rest of the year. This region lies between two malaria endemic countries: The Gambia (66 cases/1000 people at risk) and Guinea-Bissau (123 cases/1000 people at risk) [1].

Materials and methods

Sample collection

In this study, we collected 147 samples (blood spots on Whatman filter paper) from P. falciparum infected patients with uncomplicated malaria, attending the health center in Bounkiling, Senegal. After laboratory confirmation of malaria infection by microscopy or rapid diagnostic test, patients were asked to participate in the study. Written informed consent was obtained from all patients before sample collection. The study was reviewed and approved by the Ethical Committee of the Ministry of Health of Senegal (082 MSAS/DPRS/CNERS). Samples were collected during the peak malaria transmission period (October to December) in 2015, 2016 and 2017.

Genotyping of pfmdr1 and pfk13 genes

P. falciparum mutations associated with resistance to ACT components were typed using PCR amplification and Sanger sequencing. We evaluated specific regions of the genes pfk13 (codon 436 to 706) and pfmdr1 (codons 86, 184 and 1246). DNA from 147 blood spots was extracted using Chelex method [42] and DNA was stored at -20°C.

For pfk13 one fragment containing the main polymorphisms associated with delayed clearance in Southeast Asia was amplified by nested PCR as described elsewhere [43] with modifications. Briefly, specific primers were developed for this purpose (forward—3’ GAAAGAAGCAGAATTTTATGG5’; reverse—3’ GCTTGGCCCATCTTTATTAGTTCCC 5’, obtaining a fragment of 856bp. A semi-nested PCR was performed in some samples using the inner forward primer 3’ GTGTAGAATATTTAAATTCG 5’ obtaining a fragment of 788bp.

For pfmdr1, specific primers were designed for the amplification of the fragment of 452bp containing codons 86 and 184 (forward—3’ GTATGTGCTGTATTATCAGGAGGA 5’; reverse—3’ TTAATTTATGTTTGTGGTGTCATATG 5’) and for the amplification of the fragment of 508bp containing codon 1246 (forward—3’ CTACAGCAATCGTTGGAGAA 5’ reverse—3’ GAGAATAGCTATAGCTAGAGC 5’). PCR conditions 94°C 2 min; [94°C 1 min, 56°C 1 min, 72°C 1 min] 10X; [94°C 1 min, 50°C 1 min, 72°C 1 min] 30X; 72°C 3 min. An aliquot of the PCR products was analyzed by electrophoresis on a 2% agarose gel stained with GreenSafe Premium (Nzytech, Portugal) to confirm single band amplification. All PCR products were then purified using SureClean Plus (Bioline) before Sanger sequencing at Eurofins Genomics (GATC services, Germany).

Data analysis

Sequences were analyzed using Multalin software (http://multalin.toulouse.inra.fr/multalin/multalin.html; free online) using P. falciparum-3D7 strain as wild type genotype.

The prevalence of a particular mutant allele was calculated as the proportion of the specific mutant samples among the total number of samples successfully analyzed for this mutation. All graphical representations and calculations were performed with GraphPad Prism PRISM 8 for MAC (V8.4.2).

Results

Sample characteristics

Among the 147 samples analyzed, twenty-one of them tested negative for P. falciparum by PCR (6/39 in 2015, 6/65 in 2016 and 9/43 in 2017), hence removed from further analysis. Of the remaining 126 blood samples, 7 had no slide available, so they were not considered for the parasitemia evaluation that varied between 0.02–9.33% with a median value of 0.67%. Of the 126 subjects, 72 (57.14%) were men and 54 (42.86%) were women, and age varied between 3–70 years, with a median of 18 years. The majority 46.83% (n = 59) were adults (over 20 years), 40.48% (n = 51) were adolescents and 12.69% (n = 16) were children between the age of 3 and 10 years.

Molecular markers of anti-malarial drug resistance

All 126 samples (from day 0 before treatment), were successfully sequenced for pfk13, 120 were wild type (identical to the reference, 3D7 strain) and 6 carried synonymous mutations (Table 1). One of the synonymous mutations, C469C was previously described in Senegal [17]. None of the pfk13 variants associated with artemisinin resistance in Southeast Asia [13] were observed in our study (Table 1).

Table 1. Mutations in pfk13 and pfmdr1 genes.

Year (n) pfk13 pfmdr1
Allele prevalence (%) Haplotype (%)
Codon (*) N86 86Y Y184 184F D1246 1246Y
2015 (33) F583F (2) 90.9 9.1 26.3 73.7 100 0 NFD (71.4)
NYD (14.3)
YFD (14.3)
2016 (59) F491F (1) 90.2 9.8 42.0 58.0 100 0 NFD (54.5)
NYD (40.9)
YFD (4.5)
2017 (34) G545G (1) 82.1 17.9 59.3 40.7 96.0 4.0 NFD (20.8)
C469C (1) NYD (62.5)
A627A (1) YFD (16.7)
overall 6*/126 88.1 11.9 43.8 56.3 98.5 1.5

*number of samples with synonymous mutation.

A total of 101, 96 and 68 samples were successfully genotyped for pfmdr1 codons 86, 184, and 1246, respectively. Mixed pfmdr1 alleles were not observed. Overall, wild-type alleles predominated (Fig 2), except for codon 184 where the mutant allele 184F occurred more frequently (56.3%) than the wild-type allele Y184 (43.8%; Table 1). When analyzed separately over time, the prevalence of the mutant allele 184F decreased from 73.7% in 2015 to 58.0% in 2016 and to 40.7% in 2017 (Table 1).

Fig 2. Temporal changes of prevalence at codons 86, 184 and 1246 of pfmdr1.

Fig 2

Percentage (%) inserted in the graphic bars represents the prevalence of the alleles and haplotypes in each year.

For pfmdr1, only three haplotypes were identified with the following overall prevalence: NFD (45.0%), NYD (43.3%) and YFD (11.7%). No triple pfmdr1 mutants were found at codon 86, 184, or 1246 (YFY). When compared between years, the prevalence of the triple haplotype NFD decreased significantly from 71.4% in 2015 to 54.5% in 2016 and 20.8% in 2017 (Fig 2).

Discussion

Considering the trends of artemisinin decreasing activity [5–7], treatment efficacy should be monitored at regular intervals. Monitoring should be performed by directly measuring efficacy in vivo, or indirectly, by molecular markers surveillance, which can reveal drug response trends that inform on the possible therapeutic life-span of a given treatment [13]. In Senegal, ACTs (AL, ASAQ and DHA-piperaquine; DHA-PPQ) remain highly effective for the treatment of uncomplicated P. falciparum malaria. In the few reported cases of recrudescence after ACT treatment, parasite samples did not carry mutations in the K13-propeller domain [32]. These observations seem to follow the regional tendency.

In Senegal, there are currently no systematic (nationwide) epidemiological studies on molecular markers of drug resistance. Although a number of studies have been published in Senegal reporting mutations in pfk13 [20,31,32,36–38,44], samples from those studies originate mostly from Thies and Dakar regions (near and around the capital). In one exception, a recent study reported pfk13 SNPs from Diourbel (east of Thiés) and Kedougou, in the southeast of the country (Fig 1); [32]. Hence the importance of our study, which analyses samples from Bounkiling City, in the Sédhiou region in the south of Senegal (Fig 1). Our analysis revealed that all but 6 of the isolates carried wild type K13-propeller. This is in line with recent observations in Senegal, where most of the samples were also wild type for K13-propeller domain [17,32,38]. None of the 5 identified SNPs in our samples occurred in more than two samples (Table 1). Nevertheless one study including 207 isolates from Thiés and Dakar [17], identified a total of 22 SNPs in pfk13 propeller domain (7 synonymous and 15 non-synonymous). In our work, we have identified only 6 polymorphisms 5 synonymous and one non-synonymous (Table 1). Most of these polymorphisms were limited to single isolates, suggesting that they are likely transient polymorphisms part of naturally evolving parasite populations. The fact that some of these polymorphisms tend to occur in the same positions, might indicate that certain regions of the gene are more disposed to variations then others. Also, pfk13 artemisinin-resistance associated alleles being selected in Africa, may not be the same as the ones selected in Southeast Asia. The synonymous polymorphism C469C might be particularly relevant because, in this position, two variant amino acids (C469F and C469Y) have been previously associated with slow clearance of parasitemia, after ACT therapy [45,46]. Additionally, this polymorphism was also previously reported in samples from Thiés and Dakar in Senegal [17] and in Ghana [47,48]. In the two countries bordering Sedhiou, The Gambia to the north and Guinea-Bissau to the south (Fig 1), wild type pfk13 is highly prevalent and SNPs associated with artemisinin resistance in Southeast Asia, have not been identified [19–21]. Nevertheless, monitoring the prevalence of these loci over time may help to infer which alleles are biologically relevant or selected under drug pressure.

The molecular marker pfmdr1 86Y (together with pfcrt, initially driven through the parasite population by the previous widespread use of chloroquine) has been decreasing in many parts of Africa. This declining prevalence is accelerated in countries using AL, consistent with the expected direction of selection [49,50]. Here we report a high prevalence of wild type alleles N86 and D1246, which follow the tendency reported from northern Senegal, namely from Thiés and Dakar [19,20,28,33,35,44,51–54], the neighbouring The Gambia [19,20,54], and other West Africa countries [16,55]. The pfmdr1 86Y is associated with a longer time to reinfection after AL treatment and a shorter time after ASAQ [49], reinforcing its informative value as a molecular marker of antimalarial drug susceptibility.

For codon 184, our analysis of pfmdr1 revealed differences in the distribution of mutant allele between years. The high prevalence of 184F in 2015 (73.7%) decreased over time to 40.7% in 2017 (Fig 2; Table 1). Declining of 184F prevalence was previously reported in parasite samples collected between 2012 and 2014 in northern Senegal [20,31,51] and in The Gambia [20]. This decrease, in Senegal, was correlated with a local and temporary change to ASAQ as first the line of treatment [31]. Three pfmdr1 haplotypes were identified in our study: NFD, NYD and YFD. The haplotype YYY was not identified; however, this was not surprising since YYY is believed to be selected under the pressure of DHA-PPQ treatment from a genetic background 86Y and Y184 [56,57]. DHA-PPQ has not been widely used in Senegal, except to compensate for antimalarial drug shortages in 2010 and 2011 [32]. Other studies have reported absence or low prevalence of the allele 1246Y [35] or the haplotype YYY haplotype in Senegal (northern regions) [31]. The two haplotypes NFD and NYD were the most frequent triple haplotypes found in our samples, as was the case in other studies from northern Senegal [31,51] in the neighbouring The Gambia [19,20] and generally in Africa [50]. These observations argue in favor of lumefantrine selecting the triple haplotype N86F184D1246 (NFD) [28,31,35,58–60] and that this selection might be sequential; first N86, second D1246 and the last 184F [24,50,61,62]. A high prevalence of haplotype NFD was observed in 2015 (71.4%) samples, however, a significant decrease was detected in 2017 (20%) driven by the decline of the mutant allele 184F (Fig 2). This decrease could be explained by therapy policy change, and/or intense migration of parasite populations to Bounkiling from other regions of Senegal or the neighboring The Gambia or Guinea-Bissau. Malaria therapy policy did not change in Bounkiling during 2016 and 2017, which could cause decreased in AL pressure hence accounting for the observed decrease in 184F frequency. Recently, a decreasing trend in frequency of the 184F allele around the same period, was reported from the neighboring Guinea-Bissau [21,63]. Hence intense migration of parasite populations to Bounkiling from Guinea-Bissau, could account (at least in part) for the observed 184F decreasing frequency trend. To the best of our knowledge, there is no published information on the prevalence of these markers between 2015 and 2017 (or since 2017) either from other regions in Senegal or from the neighboring The Gambia. A higher number of samples analyzed with next generation sequencing, would increase the robustness of our results. A national survey of molecular markers of drug resistance would help to clarify these results and better inform National Public Health Authorities on first-line treatment regimens to manage uncomplicated P. falciparum malaria.

Conclusions

All isolates carried wild type pfk13 gene, except for 6 samples that carried 5 different synonymous SNPs. Prevalence of haplotype NFD in pfmdr1 gene, decreased over time from 2015 to 2017. To our knowledge, this is the first work providing information on the prevalence of k13-propeller and pfmdr1 mutations in Sédhiou, a region in the south of Senegal. We are contributing to the surveillance of molecular markers of drug resistance in Africa.

Supporting information

S1 File. Primers used in this study.

(PDF)

S2 File. Comprehensive data of isolate genotype for pfmdr1 N86Y, Y184F and D1246Y.

(PDF)

S3 File. Comprehensive data showing sequence alignment for pfK13 with highlighted SNPs.

(PDF)

Acknowledgments

We are grateful to all the patients who participated in the study, to Maria Mendes and Amy Bei for helping with English revision and to the team in Bounliking Dr Jean.S.N. Kaly, Dr Bou Diarra, Elhadj Abou Diop, Ndeye Fatou Thiam Kebe, Mansanou Fall, Theophile Coly and Dior Diop for collecting samples.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

A.A: was support by EDCTP/Wanetam RegNet2015-1049 and European Research Council (AdG-2011-294428). F.N: was funded by Portuguese FCT R&D center GHTM-UID/04413/2020.

References

  • 1.WHO. World Malaria Report 2019. Geneva. World Malar Rep. 2019. [Google Scholar]
  • 2.Programme National de Lutte Contre le Paludisme. Bulletin Epidemiologique Annuel 2017 du Paludisme au Senegal. Ministere de la Sante. 2018. p. 1–40. [Google Scholar]
  • 3.Faye S, Cico A, Gueye AB, Baruwa E, Johns B, Ndiop M, et al. Scaling up malaria intervention “packages” in Senegal: Using cost effectiveness data for improving allocative efficiency and programmatic decision-making. Malar J. 2018. 10.1186/s12936-018-2305-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Programme National de Lutte Contre le Paludisme. Progress & Impact Series: Focus on Senegal. Roll Back Malaria. 2010. p. 1–54.
  • 5.Dondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J, et al. Artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2009. 10.1056/NEJMoa0808859 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Takala-Harrison S, Jacob CG, Arze C, Cummings MP, Silva JC, Dondorp AM, et al. Independent emergence of artemisinin resistance mutations among Plasmodium falciparum in Southeast Asia. J Infect Dis. 2015. 10.1093/infdis/jiu491 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Imwong M, Suwannasin K, Kunasol C, Sutawong K, Mayxay M, Rekol H, et al. The spread of artemisinin-resistant Plasmodium falciparum in the Greater Mekong subregion: a molecular epidemiology observational study. Lancet Infect Dis. 2017;17(5):491–7. 10.1016/S1473-3099(17)30048-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ebohon O, Irabor F, Ebohon LO, Omoregie ES. Therapeutic failure after regimen with artemether-lumefantrine combination therapy: A report of three cases in Benin city, Nigeria. Rev Soc Bras Med Trop. 2019. 10.1590/0037-8682-0163-2019 [DOI] [PubMed] [Google Scholar]
  • 9.Van Hong N, Amambua-Ngwa A, Tuan NQ, Cuong DD, Giang NTH, Van Dung N, et al. Severe malaria not responsive to artemisinin derivatives in man returning from Angola to Vietnam. Emerg Infect Dis. 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Dahal P, d’Alessandro U, Dorsey G, Guerin PJ, Nsanzabana C, Price RN, et al. Clinical determinants of early parasitological response to ACTs in African patients with uncomplicated falciparum malaria: a literature review and meta-analysis of individual patient data. BMC Med. 2015. 10.1186/s12916-015-0445-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Takala-Harrison S, Clark TG, Jacob CG, Cummings MP, Miotto O. Genetic loci associated with delayed clearance of Plasmodium falciparum following artemisinin treatment in Southeast Asia. Proc Natl Acad Sci. 2013;110(1):240–5. 10.1073/pnas.1211205110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ariey F, Witkowski B, Amaratunga C, Beghain J, Langlois AC, Khim N, et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature. 2014. 10.1038/nature12876 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.WHO. Artemisinin resistance and artemisinin-based combination therapy efficacy: status report. [Internet]. 2018. Available from: https://apps.who.int/iris/handle/10665/274362.
  • 14.Djaman JA, Olefongo D, Ako AB, Roman J, Ngane VF, Basco LK, et al. Molecular epidemiology of malaria in Cameroon and Côte d’Ivoire. XXXI. Kelch 13 propeller sequences in plasmodium falciparum isolates before and after implementation of artemisinin-based combination therapy. Am J Trop Med Hyg. 2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dorkenoo AM, Yehadji D, Agbo YM, Layibo Y, Agbeko F, Adjeloh P, et al. Therapeutic efficacy trial of artemisinin-based combination therapy for the treatment of uncomplicated malaria and investigation of mutations in k13 propeller domain in Togo, 2012–2013. Malar J. 2016. 10.1186/s12936-016-1381-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ocan M, Akena D, Nsobya S, Kamya MR, Senono R, Kinengyere AA, et al. K13-propeller gene polymorphisms in Plasmodium falciparum parasite population in malaria affected countries: A systematic review of prevalence and risk factors. Malaria Journal. 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Talundzic E, Ndiaye YD, Deme AB, Olsen C, Patel DS, Biliya S, et al. The molecular epidemiology of Pf k13 mutations in Senegal using targeted amplicon deep sequencing. Antimicrob Agents Chemother. 2017;61(3):1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Boussaroque A, Fall B, Madamet M, Wade KA, Fall M, Nakoulima A, et al. Prevalence of anti-malarial resistance genes in Dakar, Senegal from 2013 to 2014. Malar J. 2016. 10.1186/s12936-016-1379-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Amambua-Ngwa A, Okebe J, Mbye H, Ceesay S, El-Fatouri F, Joof F, et al. Sustained ex vivo susceptibility of Plasmodium falciparum to artemisinin derivatives but increasing tolerance to artemisinin combination therapy partner quinolines in The Gambia. Antimicrob Agents Chemother. 2017. 10.1128/AAC.00759-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Dieye B, Affara M, Sangare L, Joof F, Ndiaye YD, Gomis JF, et al. West Africa international centers of excellence for malaria research: Drug resistance patterns to artemether-lumefantrine in Senegal, Mali, and the Gambia. Am J Trop Med Hyg. 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Nag S, Ursing J, Rodrigues A, Crespo M, Krogsgaard C, Lund O, et al. Proof of concept: Used malaria rapid diagnostic tests applied for parallel sequencing for surveillance of molecular markers of anti-malarial resistance in Bissau, Guinea-Bissau during 2014–2017. Malar J. 2019. 10.1186/s12936-019-2894-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ouattara A, Kone A, Adams M, Fofana B, Maiga AW, Hampton S, et al. Polymorphisms in the K13-propeller gene in artemisinin-susceptible Plasmodium falciparum parasites from Bougoula-Hameau and Bandiagara, Mali. Am J Trop Med Hyg. 2015. 10.4269/ajtmh.14-0605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cowman AF, Karcz S, Galatis D, Culvenor JG. A P-glycoprotein homologue of Plasmodium falciparum is localized on the digestive vacuole. J Cell Biol. 1991;113(5):1033–42. 10.1083/jcb.113.5.1033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Humphreys GS, Merinopoulos I, Ahmed J, Whitty CJM, Mutabingwa TK, Sutherland CJ, et al. Amodiaquine and artemether-lumefantrine select distinct alleles of the Plasmodium falciparum mdr1 gene in Tanzanian children treated for uncomplicated malaria. Antimicrob Agents Chemother. 2007. 10.1128/AAC.00875-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Dokomajilar C, Nsobya SL, Greenhouse B, Rosenthal PJ, Dorsey G. Selection of Plasmodium falciparum pfmdr1 alleles following therapy with artemether-lumefantrine in an area of Uganda where malaria is highly endemic. Antimicrob Agents Chemother. 2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Baraka V, Tinto H, Valea I, Fitzhenry R, Delgado-Ratto C, Mbonye MK, et al. In vivo selection of plasmodium falciparum pfcrt and pfmdr1 variants by artemether-lumefantrine and dihydroartemisinin-piperaquine in Burkina Faso. Antimicrob Agents Chemother. 2015. 10.1128/AAC.03647-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Price RN, Uhlemann AC, Brockman A, McGready R, Ashley E, Phaipun L, et al. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet. 2004. 10.1016/S0140-6736(04)16767-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wurtz N, Fall B, Pascual A, Fall M, Baret E, Camara C, et al. Role of Pfmdr1 in In Vitro Plasmodium falciparum Susceptibility to Chloroquine, Quinine, Monodesethylamodiaquine, Mefloquine, Lumefantrine, and Dihydroartemisinin. Antimicrob Agents Chemother. 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Dama S, Niangaly H, Ouattara A, Sagara I, Sissoko S, Traore OB, et al. Reduced ex vivo susceptibility of Plasmodium falciparum after oral artemether-lumefantrine treatment in Mali. Malar J. 2017. 10.1186/s12936-017-1700-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Veiga MI, Dhingra SK, Henrich PP, Straimer J, Gnädig N, Uhlemann AC, et al. Globally prevalent PfMDR1 mutations modulate Plasmodium falciparum susceptibility to artemisinin-based combination therapies. Nat Commun. 2016. 10.1038/ncomms11553 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Mbaye A, Dieye B, Ndiaye YD, Bei AK, Muna A, Deme AB, et al. Selection of N86F184D1246 haplotype of Pfmrd1 gene by artemether-lumefantrine drug pressure on Plasmodium falciparum populations in Senegal. Malar J. 2016. 10.1186/s12936-016-1490-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Diallo MA, Yade MS, Ndiaye YD, Diallo I, Diongue K, Sy SA, et al. Efficacy and safety of artemisinin-based combination therapy and the implications of Pfkelch13 and Pfcoronin molecular markers in treatment failure in Senegal. Sci Rep. 2020. 10.1038/s41598-020-65553-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Dieye Y, Mbengue B, Dagamajalu S, Fall MM, Loke MF, Nguer CM, et al. Cytokine response during non-cerebral and cerebral malaria: Evidence of a failure to control inflammation as a cause of death in African adults. PeerJ. 2016. 10.7717/peerj.1965 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Diawara S, Madamet M, Kounta MB, Lo G, Wade KA, Nakoulima A, et al. Confirmation of Plasmodium falciparum in vitro resistance to monodesethylamodiaquine and chloroquine in Dakar, Senegal, in 2015. Malar J. 2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Gendrot M, Wague Gueye M, Tsombeng Foguim F, Madamet M, Wade KA, Bou Kounta M, et al. Modulation of in vitro antimalarial responses by polymorphisms in Plasmodium falciparum ABC transporters (pfmdr1 and pfmdr5). Acta Trop. 2019. 10.1016/j.actatropica.2019.05.020 [DOI] [PubMed] [Google Scholar]
  • 36.Torrentino-Madamet M, Fall B, Benoit N, Camara C, Amalvict R, Fall M, et al. Limited polymorphisms in k13 gene in Plasmodium falciparum isolates from Dakar, Senegal in 2012–2013. Malaria Journal. 2014. 10.1186/1475-2875-13-472 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Boussaroque A, Fall B, Madamet M, Camara C, Benoit N, Fall M, et al. Emergence of mutations in the K13 propeller gene of Plasmodium falciparum isolates from Dakar, Senegal, in 2013–2014. Antimicrob Agents Chemother. 2016. 10.1128/AAC.01346-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Madamet M, Kounta MB, Wade KA, Lo G, Diawara S, Fall M, et al. Absence of association between polymorphisms in the K13 gene and the presence of Plasmodium falciparum parasites at day 3 after treatment with artemisinin derivatives in Senegal. Int J Antimicrob Agents. 2017. 10.1016/j.ijantimicag.2017.01.032 [DOI] [PubMed] [Google Scholar]
  • 39.Fall B, Camara C, Fall M, Nakoulima A, Dionne P, Diatta B, et al. Plasmodium falciparum susceptibility to standard and potential anti-malarial drugs in Dakar, Senegal, during the 2013–2014 malaria season. Malar J. 2015;14(1):1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ménard D, Khim N, Beghain J, Adegnika A, Shafiul-Alam M, Amodu O, et al. A Worldwide Map of Plasmodium falciparum K13-Propeller Polymorphisms. N Engl J Med. 2016;374(25):2453–64. 10.1056/NEJMoa1513137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ndiaye D, Dieye B, Ndiaye YD, Tyne D Van, Daniels R, Bei AK, et al. Polymorphism in dhfr/dhps genes, parasite density and ex vivo response to pyrimethamine in plasmodium falciparum malaria parasites in thies, senegal. Int J Parasitol Drugs Drug Resist. 2013. 10.1016/j.ijpddr.2013.07.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Bereczky S, Mårtensson A, Gil JP, Färnert A. Short report: Rapid DNA extraction from archive blood spots on filter paper for genotyping of Plasmodium falciparum. Am J Trop Med Hyg. 2005. [PubMed] [Google Scholar]
  • 43.Escobar C, Pateira S, Lobo E, Lobo L, Teodosio R, Dias F, et al. Polymorphisms in Plasmodium falciparum K13-propeller in angola and mozambique after the introduction of the ACTs. PLoS One. 2015;10(3). 10.1371/journal.pone.0119215 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Ménard D, Khim N, Beghain J, Adegnika AA, Shafiul-Alam M, Amodu O, et al. A worldwide map of Plasmodium falciparum K13-propeller polymorphisms. N Engl J Med. 2016. 10.1056/NEJMoa1513137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.WWARN. Plasmodium falciparum and artemisinin combination therapies. 2020.
  • 46.Asua V, Vinden J, Conrad MD, Legac J, Kigozi SP, Kamya MR, et al. Changing molecular markers of antimalarial drug sensitivity across Uganda. Antimicrob Agents Chemother. 2019. 10.1128/AAC.01818-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Matrevi SA, Opoku-Agyeman P, Quashie NB, Bruku S, Abuaku B, Koram KA, et al. Plasmodium falciparum Kelch Propeller Polymorphisms in Clinical Isolates from Ghana from 2007 to 2016. Antimicrob Agents Chemother. 2019. 10.1128/AAC.00802-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Kamau E, Campino S, Amenga-Etego L, Drury E, Ishengoma D, Johnson K, et al. K13-propeller polymorphisms in plasmodium falciparum parasites from sub-saharan Africa. J Infect Dis. 2015. 10.1093/infdis/jiu608 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Bretscher MT, Dahal P, Griffin J, Stepniewska K, Bassat Q, Baudin E, et al. The duration of chemoprophylaxis against malaria after treatment with artesunate-amodiaquine and artemether-lumefantrine and the effects of pfmdr1 86Y and pfcrt 76T: A meta-analysis of individual patient data. BMC Med. 2020. 10.1186/s12916-020-1494-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Okell LC, Reiter LM, Ebbe LS, Baraka V, Bisanzio D, Watson OJ, et al. Emerging implications of policies on malaria treatment: Genetic changes in the Pfmdr-1 gene affecting susceptibility to artemether–lumefantrine and artesunate–amodiaquine in Africa. BMJ Glob Heal. 2018. 10.1136/bmjgh-2018-000999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Van Tyne D, Dieye B, Valim C, Daniels RF, Sène PD, Lukens AK, et al. Changes in drug sensitivity and anti-malarial drug resistance mutations over time among Plasmodium falciparum parasites in Senegal. Malar J. 2013. 10.1186/1475-2875-12-441 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Ndiaye D, Patel V, Demas A, LeRoux M, Ndir O, Mboup S, et al. Short report: A non-radioactive DAPI-based high-throughput in vitro assay to assess Plasmodium falciparum responsiveness to antimalarials—Increased sensitivity of P. falciparum to chloroquine in senegal. Am J Trop Med Hyg. 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Ly O, El Hadji Omar Gueye P, Deme AB, Dieng T, Badiane AS, Ahouidi AD, et al. Evolution of the pfcrt T76 and pfmdr1 Y86 markers and chloroquine susceptibility 8 years after cessation of chloroquine use in Pikine, Senegal. Parasitol Res. 2012;111(4):1541–6. 10.1007/s00436-012-2994-7 [DOI] [PubMed] [Google Scholar]
  • 54.Nwakanma DC, Duffy CW, Amambua-Ngwa A, Oriero EC, Bojang KA, Pinder M, et al. Changes in malaria parasite drug resistance in an endemic population over a 25-year period with resulting genomic evidence of selection. J Infect Dis. 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Xu C, Wei Q, Yin K, Sun H, Li J, Xiao T, et al. Surveillance of Antimalarial Resistance Pfcrt, Pfmdr1, and Pfkelch13 Polymorphisms in African Plasmodium falciparum imported to Shandong Province, China. Sci Rep. 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Pillai DR, Lau R, Khairnar K, Lepore R, Via A, Staines HM, et al. Artemether resistance in vitro is linked to mutations in PfATP6 that also interact with mutations in PfMDR1 in travellers returning with Plasmodium falciparum infections. Malar J. 2012. 10.1186/1475-2875-11-131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Taylor AR, Flegg JA, Holmes CC, Guérin PJ, Sibley CH, Conrad MD, et al. Artemether-lumefantrine and dihydroartemisinin-piperaquine exert inverse selective pressure on plasmodium falciparum drug sensitivity-associated haplotypes in Uganda. Open Forum Infect Dis. 2017. 10.1093/ofid/ofw229 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Muiruri P, Juma DW, Ingasia LA, Chebon LJ, Opot B, Ngalah BS, et al. Selective sweeps and genetic lineages of Plasmodium falciparum multi-drug resistance (pfmdr1) gene in Kenya. Malar J. 2018. 10.1186/s12936-018-2534-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Kavishe RA, Paulo P, Kaaya RD, Kalinga A, Van Zwetselaar M, Chilongola J, et al. Surveillance of artemether-lumefantrine associated Plasmodium falciparum multidrug resistance protein-1 gene polymorphisms in Tanzania. Malar J. 2014. 10.1186/1475-2875-13-264 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Happi CT, Gbotosho GO, Folarin OA, Sowunmi A, Hudson T, O’Neil M, et al. Selection of Plasmodium falciparum multidrug resistance gene 1 alleles in asexual stages and gametocytes by artemether-lumefantrine in nigerian children with uncomplicated falciparum malaria. Antimicrob Agents Chemother. 2009. 10.1128/AAC.00968-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Malmberg M, Ferreira PE, Tarning J, Ursing J, Ngasala B, Björkman A, et al. Plasmodium falciparum drug resistance phenotype as assessed by patient antimalarial drug levels and its association with pfmdr1 polymorphisms. J Infect Dis. 2013. 10.1093/infdis/jis747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Baliraine FN, Rosenthal PJ. Prolonged selection of pfmdr1 polymorphisms after treatment of falciparum malaria with artemether-lumefantrine in Uganda. J Infect Dis. 2011. 10.1093/infdis/jir486 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Nag S, Dalgaard MD, Kofoed PE, Ursing J, Crespo M, Andersen LOB, et al. High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology. Sci Rep. 2017. 10.1038/s41598-017-02724-x [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File. Primers used in this study.

(PDF)

S2 File. Comprehensive data of isolate genotype for pfmdr1 N86Y, Y184F and D1246Y.

(PDF)

S3 File. Comprehensive data showing sequence alignment for pfK13 with highlighted SNPs.

(PDF)

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES