Exogenous administration of dsRNA for the demonstration of RNAi in Maruca vitrata (lepidoptera: crambidae)

Abstract

The polyphagous spotted pod borer, Maruca vitrata is an important agricultural pest that causes extensive damage on various food crops. Though the pest is managed by synthetic chemicals, exploration of biotechnological approaches for its control is important. RNAi-based gene silencing is one such tool that has been extensively used for functional genomics and is highly variable in insects. In view of this, we have attempted to demonstrate RNAi in M. vitrata through exogenous double-stranded RNA (dsRNA) administration targeting seven genes associated with midgut, chemosensory, cell signalling and development. Two modes of exogenous dsRNA delivery by either haemolymph injection and/or ingestion into third and late third instar larval stages respectively exhibited efficient silencing of specific transcripts. Furthermore, dsRNA injection into the haemolymph showed significant reduction of target gene expression compared to negative controls establishing this mode of delivery to be more efficient. Interestingly, haemolymph injection required lesser dsRNA and led to higher reduction of transcript level vis-à-vis ingestion as demonstrated in dsRNA Serine Protease 33 (ds-SP33)-fed larvae. Over-expression of key RNAi component DICER and detection of siRNA authenticated the presence of RNAi in M. vitrata. Additionally, we have identified inhibitor molecules like morpholine, piperidine, carboxamide and piperidine–carboxamide through in silico analysis for blocking the function of SP33 to demonstrate the utility of functional genomics. Thus, the present study establishes the usefulness of injection and ingestion approaches for exogenous dsRNA delivery into M. vitrata larvae for effective RNAi.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13205-021-02741-8.

Introduction

Maruca vitrata F. (Lepidoptera: Crambidae), commonly known as legume pod borer, is considered as one of the most serious pests of economically important food crops leading to ~ 80% yield losses (Sharma et al. 1998). Despite various synthetic chemical compounds predominantly being used for pest management, resistance to insecticides has been a complicated and an ever-growing problem globally. Moreover, there is a major concern regarding the effect of synthetic chemicals on non-target insects and other organisms as well. This necessitated the development of biotechnological approaches for insect pest management like breeding for insect resistance, over-expression of insecticidal toxin genes and down-regulation of important insect genes through RNA interference (RNAi) (Stevens et al. 2012).

RNAi is a post-transcriptional gene silencing mechanism in which expression of target genes of a particular organism can be suppressed by the introduction of double-stranded RNA (dsRNA) into cells (Fire et al. 1998; Hannon 2002). The strategy has been well demonstrated in Caenorhabditis elegans and Drosophila melanogaster (Fire et al. 1998; Mello and Conte 2004) with utility in broad range of applications. Gradually, RNAi gene silencing has emerged as a potential tool for pest management in agriculture (Mezzetti et al. 2020). This knockdown strategy is also a useful approach for understanding gene functionality in insects.

The efficiency of RNAi is not always similar among insects and can vary between insect species (Joga et al. 2016). Factors influencing the efficacy of RNAi are functionality of a target gene (Ulrich et al. 2015), level of expression, concentration of dsRNA used to feed the insect (Whyard et al. 2009) and more importantly mode of dsRNA introduction (Scott et al. 2013). Studies have not only demonstrated successful RNAi in lepidoptera, diptera and coleopteran insect species (Yamaguchi et al. 2011; Christiaens et al. 2018; Heigwer et al. 2018; Lamacchia et al. 2013; Rodrigues et al. 2017; Mutti et al. 2006; Jaubert-Possamai et al. 2007; Ye et al. 2019), but have also reported difficulties in achieving efficient RNAi in these insects (Christiaens and Smagghe 2014; Yu et al. 2016). RNAi efficiency especially in lepidoptera is found to be lower than any other insect species due to cellular uptake, transport and degradation of dsRNA (Terenius et al. 2011; Guan et al. 2018).

Successful RNAi in M. vitrata has been demonstrated using diet-based dsRNA delivery (Baki et al. 2018; Baki et al. 2019; Rana et al 2020). However, we have attempted to study the effect of an array of genes involved in various biological activities using RNAi pathway through dsRNA delivery by injection and ingestion in M. vitrata. One of the functionally validated genes has been used for the identification of inhibitor bio-molecules for the management of M. vitrata as an alternative for transgenics. The emanating information can form a basis for the successful use of integrated biotechnological approaches for the control of this legume pod borer.

Materials and methods

Insect collection

Various stages of M. vitrata larvae were collected from pigeonpea fields of ICAR-Indian Agricultural Research Institute, New Delhi. Prior to collection, the larval stages were identified based on morphological characters (http://idtools.org/id/leps/lepintercept/pdfs/vitrata.pdf; Shinde et al. 2017) and molecular markers (Chatterjee et al. 2019). Healthy larvae of second to fifth instar were collected and a few fifth instar larvae were allowed to pupate and develop into adults (Fig. 1a). Finally, a total of six developmental stages consisting of second to fifth instar larvae, pupa and adults were frozen in liquid nitrogen and stored at − 80 °C until further analysis.

Fig. 1.

Cloning and expression analysis of target genes in different developmental stages of M. vitrata. a (i) Different developmental stages of M. vitrata (right to left) (ii) and (iii) pupae maintained in a glass beaker for emergence of adults. b PCR amplification of the selected genes from late third instar larva of M. vitrata.; Lanes 1–7: Serine Protease 33 (433 bp), H⁺ transporting ATP Synthase delta Subunit (332 bp), Triosephosphate isomerase (376 bp), Acyl-CoA delta-9 desaturase (318 bp), Arrestin 2 (498 bp), Glutamate Receptor, Kainate 2-like (366 bp), Cadherin-like protein (350 bp), M: Molecular marker. c Relative fold change expression of selected genes in different developmental stages of M. vitrata. Each bar represents the log₂ -transformed mean ± S.E of three biological and three technical replicates. Asterisks indicate significant differential expression analyzed by one-tailed t-test with P ≤ 0.05 in comparison with the gene expression of second instar larvae

Selection and bioinformatic analyses of M. vitrata genes

In the present study, seven genes cardinal for development, metabolism and chemosensory functions were selected. Among them, Serine Protease 33 (SP33), H⁺ transporting ATP synthase delta subunit (HTAS), Triose phosphate Isomerse (TIM), Acyl-CoA delta-9 desaturase (ACCOA), Glutamate Receptor Ionotropic, Kainate 2-like (GLUR) and Cadherin-like protein (CDH) were identified from the transcriptome data (unpublished data) of an Indian population of M. vitrata and the sequence of a non-visual Arrestin (ARR 2) was fetched from NCBI database (Chang and Ramaswamy 2013).

For bioinformatic analysis, domains and motifs were identified in the selected genes using NCBI CDD database (https://www.ncbi.nlm.nih.gov/cdd/) and Expasy PROSITE tool (https://prosite.expasy.org/), respectively (Table 1). For phylogenetic analysis, lepidoptera-specific FASTA sequences were aligned using ClustalW (Jeanmougin et al. 1998) algorithm by setting default parameters. Phylogenetic trees of all the genes were constructed using maximum likelihood method considering 1000 bootstrap replications under different distance models (Jukes and Cantor 1969; Nei and Kumar 2000; Tamura and Nei 1993; Kimura 1980) in MEGAX software application package (Kumar et al. 2018).

Table 1.

Details of domain and motif analysis of selected target genes

Target Genes	Abbreviations used	Domain Region	Motif Region	Superfamily
Serine Protease 33	SP33	15–125	16–127	Trypsin
H+ transporting ATP Synthase delta Subunit	HTAS	1–103	No hit	F1-ATPase delta superfamily
Triphosphate isomerase	TIM	1–85	1–85	TIM superfamily
Acyl-CoA delta-9 desaturase	ACCOA	25–102	72–86	Membrane Fatty Acid desaturase like superfamily
Arrestin 2	ARR 2	6–404	No hit	Arrestin C-superfamily
Glutamate Receptor, Kainate 2-like	GLUR	13–105	No hit	OS-D superfamily
Cadherin-like protein	CDH	No hit	No hit	No hit

Cloning and sequencing of selected target genes

Total RNA was isolated from a single healthy late third instar M. vitrata larva using TRIzol™ reagent with modifications. Quantity and quality of RNA samples were analysed by Nanodrop®2000 and 1.2% agarose gel, respectively. cDNA was synthesized using SuperScript™ VILO™ (Invitrogen, USA) for PCR amplification. Each PCR reaction contained 1 unit of Taq DNA polymerase (Bangalore Genei, Bengaluru, India), 2.5 µl of 10X Taq buffer, 0.2 mM dNTPs, 0.2 µM of each of forward and reverse primers and 19.67 µl of nuclease-free water (Ambion, USA) so as to make up the final volume to 25 µl. Amplification was carried out with initial denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 95 °C for 1 min, annealing at 60 °C for 1 min, extension at 72 °C for 1 min and final extension at 72 °C for 10 min using Bio-Rad thermal cycler (California, United States). Amplified products were checked by loading 10 µl on 1.5% agarose gel, stained with ethidium bromide and visualized using a gel documentation system. Individual PCR products were cloned into pGEM-T easy vector (Promega, Madison, WI, USA) and positive clones of all the genes were sequenced (Agri Genome Labs Pvt. Ltd., Kochi, Kerala, India). The sequences were analyzed and submitted to GenBank to obtain accession numbers (Table 2).

Table 2.

Details of gene specific primers used for PCR amplification

Target Genes	NCBI GenBank Accessions	Forward and reverse primers	Amplicon length (bp)
Serine Protease 33	MN998527	FP: GCACCCTTCTATTGGGAAG RP: CACAGCAGACACCAAGTT	433
H+ transporting ATP Synthase delta Subunit	MT007238	FP: CTGCACTCAAAGAAGGTGAA RP: GAATTCAGACTGGGCTTTGT	332
Triosephosphate isomerise	MT041673	FP: TGGAGTTCCTGCCATTTATC RP: CTCATAGGCAAGCACAACTT	376
Acyl-CoA delta-9 desaturase	MT063055	FP: TACTTGTACCTGATGCCTCT RP: GAAGAGCTTGGTGATGTTGA	318
Arrestin 2	JN871509	FP: CTGCTAACGTGATTGTCTCC RP: CGTTGGTGTACAGAGAGTTC	498
Glutamate Receptor, Kainate 2-like	MT109492	FP: CCTCTTCGATCTTGTCCTTG RP: CCATAATCGTAGTCAGCCTTAG	366
Cadherin-like protein	MT247672	FP: GGGCTTACTGCTGAAGAAAT RP: CCACGGAATGAGGAATCAAA	350

Expression analyses of target genes in various developmental stages of M. vitrata

Expression of selected genes was quantified in six developmental stages (second, third, fourth and fifth instar larva, pupa and adult) using qRT-PCR. For this, total RNA was isolated following the above-mentioned procedure from three biological replicates and three technical replicates for each of the developmental stages of M. vitrata. qRT-PCR (BioRad CFX 96 ™ Real-Time System, C1000 Touch™ Thermal cycler) was performed using SYBR green and gene-specific primers (Table 3) following the programme as described in Papolu et al. (2013).

Table 3.

Details of gene specific primers used for qRT-PCR analysis

Target genes	Forward and reverse primers	Amplicon length (bp)
Serine Protease 33	FP: CTGGATGGTCTCCATGACAAC RP: ACACTGTTTCCAACCCTCAC	126
H+ transporting ATP Synthase delta Subunit	FP: ATTTGCAGCTGGCAACAAG RP: GGACATGCTTGGGCAGAATA	101
Triphosphate isomerase	FP: GGATGACTTGGTTGCTGAGA RP: GAAGACAACCTCCTCAGTCTTG	118
Acyl-CoA delta-9 desaturase	FP: CCTCTGTGTTGCTTCATCCT RP: TTCAAGACGGCCACGTAAC	107
Arrestin 2	FP: GCCAAGGGAACCAAGTAGAA RP: TGTCCAACACGTGGAGATTAC	132
Glutamate Receptor, Kainate 2-like	FP: CAAAGACCTGAAGGAAACCCTA RP: GCTTGTTGATAAGATGCCTGATG	110
Cadherin-like protein	FP: GTCTGATGACGAGAGTGGTAATG RP: GTCTTCTTACGTCGTCTGGTTT	98
Dicer (MT281581)	FP: CAGCTCACGAACATCAAGAG RP: CGAAGAAACCAGGCACTAAG	136
Translational Elongation Factor-1 alpha (MK681895)	FP: GACCGTCGTACTGGTAAATC RP: GTTGACAGCCTTGATGACTC	189

In lepidoptera, Translational Elongation Factor has been validated as a potential reference gene for expression analysis using qRT-PCR (Lu et al. 2013). We had earlier cloned Translation Elongation Factor-1 alpha (tef-1α) specific to Indian population of M. vitrata (Chatterjee et al. 2019) and used as a molecular marker for its diversity analysis (Chatterjee et al. 2019). Hence, in the present study, the tef-1α already cloned was used as an internal control gene for normalization and evaluation of relative gene expression. One-tailed t test was performed to calculate the mean of C_t values (n = 3).

Assessment of RNAi in M. vitrata through exogenous dsRNA administration

Preparation of dsRNA and delivery into M. vitrata

pGEM-T recombinants of selected genes were used to synthesize sense and antisense strands using MEGAscript™ (Invitrogen) SP6 and T7 in vitro transcription kits (Papolu et al. 2013). dsRNA was delivered into the late third instar larvae using two different methods.

Injection

About 1 µg of gene-specific dsRNA was injected into the haemolymph from the ventral side of M. vitrata larvae with the help of an insulin injection syringe, Hamilton injection syringe and FemtoJet (Eppendorf) microinjector. The larvae were anaesthetized with 70% ethanol for 1 min in the latter two methods. For each gene, six larvae were injected as biological replicates. For negative control, 3 µl of nuclease-free water was injected into the same number of larvae and 1 µg of ds-gfp was injected as unrelated control. Observations were taken at 24 and 48 h, live larvae were collected, snap chilled in liquid nitrogen and stored at -80 °C until further use.

Ingestion

The experiment was set up in 110 mm petriplates containing pigeonpea twigs with flowers and tender leaves in six replications per gene. A droplet containing one µg of dsRNA was applied on the surface of the plate onto which two third instar larvae were released. Furthermore, dsRNA solution was also applied within pigeonpea flowers to facilitate mimicking of insect behaviour under natural conditions. A droplet of nuclease-free water was applied as negative control and ds-gfp as an unrelated control. After 24 h, observations were recorded and fresh dsRNA solution was re-applied to ensure continuous ingestion of intact dsRNA by the larvae. After 48 h, live larvae were collected and stored as above.

Assessment of RNAi in dsRNA-treated M. vitrata

Relative gene expression and statistical analysis

Expression of target genes was quantified in dsRNA-injected and ingested larvae employing qRT-PCR using tef-1α as the housekeeping gene for normalization. Likewise, expression of DICER was also quantified in dsRNA-injected samples. Fold-change in the expression of target genes was calculated by comparative C_t method (Schmittgen and Livak 2008) and log₂- transformed. One-tailed t-tests were performed to calculate the mean of C_t values of biological replicates (n = 3) for each treatment.

Northern hybridization for detection of siRNA production

Successful processing of dsRNA for siRNA generation in M. vitrata is demonstrated by northern blot hybridization. For this, siRNA was isolated from ds-SP33-injected as well as ds-gfp-injected larvae separately from all the replications (NucleoSpin^® MiRNA isolation kit, Macherey–Nagel, Düren, Germany). Primers specific to the best performing target gene were used for preparing a probe using digoxigenin-labelling kit (Roche, Basel, Switzerland). Blotting and hybridization were carried out as per the standardized protocol (Papolu et al. 2013).

Molecular docking for identification of inhibitor molecules

Simulations for initial molecular docking were performed using the virtual screening mode of Docking App (di Muzio et al. 2017), an AutoDockVina graphical user interface. The search space (docking grid) included the whole PqsR co-inducer-binding domain (CBD) structure in all simulations to perform “blind” predictions of the “hit” compound binding sites. For further refinement, a minimum dock score of -9 kcal/mol was considered as threshold for selecting the ligand pose. Twenty such poses were selected and refined docking analysis was carried out using command line FlexX program (BioSolveIT) to generate binding affinity (ΔG) of respective selected ligand poses. Finally, the ligand efficiency was calculated for each of the selected poses (Reynolds et al. 2007).

Results and discussion

It is known through literature that biotechnological approaches are being exploited for the management of M. vitrata (Bett et al. 2017). RNAi has been a well-established functional genomics tool for which identification of target genes could be useful for effective control. Our study is an attempt to demonstrate the utility of RNAi-mediated gene silencing of metabolically relevant and development-related genes in this important legume pod borer. Towards this, seven genes essential in different phases of M. vitrata life cycle were selected.

Insect gut is mostly divided into three compartments viz., foregut, midgut and hindgut (Lemaitre et al. 2013). The food mixed with gut enzymes are transferred to midgut for nutrient absorption, a principal aspect of digestion (Xu et al. 2012). Therefore, midgut genes, SP33, HTAS, TIM and ACCOA were primarily selected as targets so as to directly block the entire enzymatic pathway by activating RNAi that can lead to either insect death or perturbed growth and development. As ACCOA belongs to desaturase gene family, they are involved in several essential biological processes including lipid metabolism, cell signalling and membrane fluidity regulation in insects (Helmkampf et al. 2015). The desaturase gene family was identified to be crucial for fatty acid metabolism in different insect species (Zeng et al. 2019). Additionally, in lepidoptera, ACCOA with the combination of other desaturases was found to be involved in sex-pheromone biosynthesis in moths (Liénard et al. 2010). Apart from these genes, focus was also on genes associated with chemosensory function, cell signalling and larval cell development. Ionotropic GluR(s) are involved in mediating neuronal responses across vertebrates and invertebrates (Benton et al. 2008). These kainate receptors were identified in D. melanogaster and are thought to be involved in excitatory synaptic transmission (Li et al. 2016). Arrestins act as regulators in trafficking and signalling of several G-Protein coupled receptors (GPCRs) with homologs of arrestins being found in insects (Gurevich et al. 2006). Cadherins comprise of a large family of cell surface transmembrane proteins and are highly conserved among metazoans (Fabrick et al. 2015). They play important roles in morphogenesis, cell development, cell signalling and maintenance of cell integrity (Fabrick et al. 2015). They mediate calcium-dependent adhesion and contact between cells (Chen et al. 2005; Hall et al. 2015; Valaitis 2011).

Bioinformatic analysis of selected genes in M. vitrata

Initially, sequence authenticity of all the seven selected genes was confirmed by NCBI BLAST analysis. Furthermore, CDD and ExPASy-PROSITE analyses confirmed the position of functional domains and motifs (Table 1). Since these genes have been used for the first time as targets for RNAi in M. vitrata, verification of functional domains was necessary for further experiments and molecular studies. A stringent domain and motif analysis of the selected genes revealed that the superfamily of SP33, HTAS, TIM and ACCOA was functional in the midgut region. No significant hits appeared in ExPASy-PROSITE for motif search of HTAS, ARR2 and GLUR. The conserved domain and motif of CDH was not found in NCBI CDD as well as ExPASy-PROSITE database. This analysis provided a better insight about the functionality of proteins encoded by the selected genes at molecular level.

Multiple sequence alignment followed by phylogenetic analyses of all the selected genes demonstrated that the sequences were conserved in different lepidopteran insect pests (Supplementary file 1). Based on phylogenetic trees, the nearest clades to M. vitrata confirmed that development of RNAi-based transgenics using these genes would most likely not result in off-target effects towards beneficial lepidopteran insect species. Hence, these genes could be useful targets for designing and development of insect-resistant transgenics or novel green molecules.

Cloning and sequencing of selected target genes

Presence of the selected seven genes in M. vitrata larvae was confirmed by PCR amplification (Fig. 1b), sequencing and NCBI blast analyses. The sequences were submitted to Genbank and accession numbers were obtained (Table 2).

Expression analyses of the selected target genes in developmental stages of M. vitrata

Expression of selected genes across different developmental stages of M. vitrata is useful to assess their relevance (Fig. 1c).While third instar larvae showed an increase in the expression levels of SP33, GLUR, ARR2 and CDH, decreased expression of HTAS, TIM and ACCOA was observed. Furthermore, transcripts of SP33, HTAS, ACCOA, GLUR and CDH were more in the fourth instar larvae; TIM and ARR2 depicted reduced expression. However, in fifth instar larvae, SP33, ACCOA, GLUR and CDH showed increased expression when compared to HTAS, TIM and ARR2. Interestingly, accumulation of SP33, HTAS, TIM and ACCOA transcripts was less in the pupal stage, while ARR2, GLUR and CDH was more. Higher accumulation of HTAS, TIM, ACCOA, GLUR and CDH transcripts was noticed in the adults compared to second instar larva, while SP33 and ARR2 were less accumulated. Since the involvement of ACCOA in sex pheromone biosysthesis in moths (Liénard et al. 2010) has been demonstrated, increased transcript accumulation in adults compared to larval stages could be expected. Similarly higher transcript accumulation of GLUR and CDH corroborated with their functional role in all the developmental stages. Furthermore, aggressively feeding larval stages have shown higher accumulation of SP33 transcripts compared to the resting pupal stage and reproductively active adult stage. Therefore, expression analyses of the selected genes demonstrated that though the gene transcripts were present across different developmental stages, there was variation in their level of expression.

Assessment of RNAi through exogenous administration of dsRNA in M. vitrata

Successful RNAi depends on the method used for the introduction or delivery of dsRNA. In insects, this has been commonly achieved through methodologies like oral delivery, haemolymph injection and soaking (Katoch et al. 2013). However, various studies have also shown that dsRNA is prone to degradation by nucleases in salivary glands, midgut and haemolymph (Christiens et al. 2020). Lepidopteran insects are found to take up dsRNA that could not be processed into siRNAs due to accumulation in acidic bodies leading to absence of significant silencing (Shukla et al. 2016). Similarly, exposure to midgut juices in Bombyx mori degraded the dsRNA (Liu et al. 2013). Furthermore, in Spodoptera litura, injection of dsRNA effectively silenced the midgut-expressed amino peptidase gene (slapn) but feeding through artificial diet was not effective (Rajagopal et al. 2002). In general, due to these limitations, dsRNA introduction through artificial diet as well as haemolymph injection are considered as potential options. However, in our study, dsRNA feeding through artificial diet could not be a feasible approach due to lack of congenial environmental conditions at the experimental site for successful in vitro rearing of M. vitrata. Thus, RNAi was initiated by administering gene-specific dsRNA through haemolymph injection using insulin injection syringe. As an alternative strategy, ingestion of dsRNA through droplet application was also performed.

1. Haemolymph injection

   dsRNA (1 µg) of selected genes was administered into the larval haemolymph using Hamilton syringe, microinjector and insulin syringe (Fig. 2a (i)) to determine the suitable method. While the insertion of Hamilton syringe significantly injured the larvae leading to their death, microinjection though convenient was unsuccessful due to haemolymph clogging the glass micro needles used for injection. Hence, use of insulin syringe for injection was considered which also offers an advantage of being simple and cost effective. The larvae exhibited behavioural changes like sluggishness and feeding avoidance 24 h after injection. However, nuclease-free water and ds-gfp-injected larvae were found to be active and healthy (Fig. 2a (ii) and (iii)). Furthermore, mortality was observed particularly in ds-SP33 fed larvae (Fig. 2a (iv) and (v)) possibly due to starvation. It could thus be speculated that, incorporation of protease-specific dsRNA resulted in blocking of gene-specific mRNA leading to silencing of SP33 as well as disruption in peptide digestion. The dsRNA injection strategy for inciting successful RNAi has also been evidenced in several insects like B. mori (Li et al. 2015), Manduca sexta (Garbutt et al. 2013), Phyllotreta striolata (Zhao et al. 2011) and Schistocerca gregaria (Badisco et al. 2011; Wynant et al. 2012).

2. dsRNA droplet ingestion

   Oral delivery was found to be another plausible approach to introduce dsRNA as it did not involve any mechanical injury to the insect (Chen et al. 2010). This can be an effective method particularly for smaller insects, which are difficult to handle during injection. Successful RNAi through oral delivery of dsRNA has been reported in Diabrotica virgifera virgifera (Belles et al. 2010), Helicoverpa armigera (Kumar et al. 2009). Accordingly, in the present study, ability of dsRNA of four target genes was assessed to trigger RNAi through oral delivery (Fig. 3a).

   Observations of dsRNA droplet ingestion were recorded every 24 h after initiation. After 48 h, while mortality was recorded in ds-SP33-ingested larvae (Fig. 3b (i) and (ii)), water and ds-gfp-ingested larvae were found to be healthy and actively feeding (Fig. 3b (iii) and (iv)). No significant morphological changes were observed in the larvae ingested with dsRNA of other three genes (HTAS, TIM and ARR2).

Fig. 2.

Establishment of RNAi in M. vitrata by injection of dsRNA. a (i) Insulin syringe-based injection of 3 μl gene specific dsRNA through the ventral side of the larva into the hemolymph (ii) and (iii) Normal feeding observed in nuclease-free water and ds-gfp injected larvae respectively after 48 h of injection. (iv) and (v) Larval mortality observed in ds-SP33-injected larvae after 48 h of injection. b Expression analysis of target genes to assess the effect of RNAi in the hemolymph-injected larvae, 48 h after injection. Each bar represents log₂ -transformed mean ± S.E of three biological and three technical replicates. Asterisks indicate significant differential expression (P ≤ 0.05) analyzed by one-tailed T-test in comparison with the gene expression of nuclease-free water injected larvae. ds-gfp injected larvae were used as unrelated control. c Relative fold change expression of DICER in dsRNA-injected larvae of corresponding genes. Each bar represents the log₂ -transformed mean ± S.E of three biological and three technical replicates. Asterisks indicate significant differential expression of DICER (P ≤ 0.05) analyzed by one-tailed T-test in comparison with the gene expression of nuclease-free water injected larvae. ds-gfp injected larvae were used as unrelated control. d Northern blot analysis using gene specific probe for the detection of the presence of siRNA in ds-SP33 -injected larvae after 48 h of injection. Nuclease free water injected larvae were used as negative control (NC). Gene specific probe (433 bp) was used as positive control (PC)

Fig. 3.

Establishment of RNAi in M. vitrata through dsRNA ingestion. a (i) and (ii) Representation of the droplet application method for larval ingestion of dsRNA of selected genes. b (i) and (ii) Mortality observed in ds-SP33 droplet ingested larvae after 48 h (iii) and (iv) healthy and actively feeding larvae that were ingested with nuclease-free water and ds-gfp. c Expression analysis of target genes in the dsRNA ingested larvae after 48 h. Each bar represents the log₂ -transformed mean ± S.E of three biological and three technical replicates. Asterisks indicate significant differential expression (P ≤ 0.05) as analyzed by one-tailed T-test in comparison with the gene expression of nuclease-free water ingested larvae. Larvae fed with ds-gfp droplet were used as an unrelated control

Assessment of RNAi in dsRNA-treated M. vitrata

Relative gene expression analysis

(a) Injection

Effect of RNAi on the transcript accumulation of target genes in dsRNA-injected larvae was determined by qPCR in the larvae collected at 24 h (data not shown) and 48 h after dsRNA administration. In this regard, silencing of SP33, HTAS, TIM and GLUR by haemolymph injection resulted in significant reduction in transcript accumulation (P ≤ 0.05) compared to ds-gfp-injected larvae (Fig. 2b). Statistically non-significant (P ≥ 0.05) increased expression levels were noticed in ds-ACCOA-and ds-CDH-injected larva (Fig. 2b) compared to ds-gfp-injected larvae. Likewise, ds-ARR2-injected larvae did not show statistically significant reduction in its transcript accumulation. In view of these two situations, we have authenticated dsRNA processing by quantifying DICER expression in the injected larvae. Significant over-expression (P ≤ 0.05) of DICER was observed in ds-SP33, ds-TIM, ds-ARR2 and ds-GLUR-injected larvae (Fig. 2c). Though transcript level of ARR2 was statistically non-significant (P ≥ 0.05), expression of DICER was significantly over-expressed in the same larvae. Furthermore, inspite of ds-HTAS-injected larvae depicting non-significant (P ≥ 0.05) increment in the expression of DICER, gene specific transcripts were upto 2.9 fold (P ≤ 0.05) lower. Thus, quantification of DICER transcripts under varying levels of target gene silencing due to dsRNA administration confirmed processing of dsRNA leading to gene silencing in M. vitrata.

Northern hybridization of dsRNA-injected larvae for the detection of siRNA production

Additionally, dsRNA processing was demonstrated by the detection of siRNA by Northern blot analysis in the larvae injected with ds-SP33 along with other controls. siRNA production was detected only in the ds-SP33-injected larvae, while it was absent in nuclease-free water and ds-gfp-injected larvae (Fig. 2d).

(b) dsRNA droplet ingestion

Corroborating the effect of dsRNA on the target transcripts demonstrated significant (P ≤ 0.05) depletion in the transcript accumulation of HTAS vis-à-vis ds-gfp droplet-fed larvae. But, mortality was observed only in ds-SP33-ingested larvae. However, expression of SP33 and TIM was reduced and was statistically non-significant (P ≥ 0.05) (Fig. 3c).

Though 2 µg of dsRNA was used for application in the ingestion approach which was repeated after 24 h of experiment, 1 µg was sufficient to determine gene silencing when dsRNA was injected. Incidentally, in both the methods, intervention of SP33 transcripts showed mortality and depletion in gene expression. In the injected samples, 2.1-fold reduction in the expression of SP33 was observed when compared to 0.9 fold in the droplet ingestion method. Hence, injection of dsRNA into haemolymph can be considered as a more precise, direct and effective way to bring about RNAi gene silencing in M. vitrata compared to ingestion, possibly due to degradation of ingested dsRNA in the oral cavity.

Although the relative fold change expression in ds-ACCOA, ds-ARR2 and ds-CDH were statistically non-significant (P ≥ 0.05), the reason for increased transcript accumulation of ACCOA and CDH genes could be due to either feedback mechanism or other intricate physiological processes (Regev et al. 1998; Rae and Steel 1979). In support of this phenomenon, studies have demonstrated several classes of small non-coding RNA molecules to be responsible for the triggered expression in post-transcriptome/epigenetic level (Li et al. 2006; Portnoy et al. 2011). However, statistically significant (P ≤ 0.05) over-expression of DICER in ds-SP33-, ds-TIM-, ds-ARR2- and ds-GLUR-injected samples confirmed the occurrence of an active RNAi machinery.

The study thus provided positive leads towards the use of two approaches to initiate RNAi in the insect. In addition to these evidences of successful RNAi, designing of inhibitor molecules against any of the validated genes in the present study can be pertinent as an alternate and futuristic “green chemicals” approach for the management of M. vitrata. Green molecules are environmental-friendly chemical products that reduce or eliminate the generation of hazardous substances as often seen in many of the synthetic pesticides. Since RNAi of M. vitrata- SP33 has been found to affect the insect development, we have explored the utility of this gene to design green molecules using molecular docking.

Molecular docking for the identification of inhibitor bio-molecules

The initial virtual screening of putative SP33 inhibitors were short-listed from ChEMBL database (56 K compounds in total) based on cut-off value of minimum energy score. This resulted in the identification of 20 ligand poses that were structurally different from each other, except for four poses (Poses 2 and 3; Poses 7 and 8; Supplementary file 2). Furthermore, these 20 ligand poses were refined; their binding affinity (ΔG) and ligand efficiency (LE) estimated (Supplementary file 2). In-depth docking analysis revealed that the ligand poses 2, 3, 10, 13 and 16 showed highest docking scores (−20.57, −21.99, −19.9216, −23.3554 and 23.4387, respectively). Furthermore, their respective binding affinity values (Supplementary file 2) confirmed ligand poses 6, 9 and 18 to possess good binding affinities (−35 kJ/mol, −36 kJ/mol, −44 kJ/mol) despite having a low docking score (−10.28, −10.8755, −15.1725) with pose 18 showing the best binding affinity score. Additionally, it was found that 7 ligand poses (Pose nos. 2, 3, 6, 9, 10, 16, and 18) out of 20 displayed an LE score > 0.3 authenticating the potential binding affinity of selected ligands (Rackham et al. 2014).

In case of ligand Pose 18-protease binding interface, 2 conventional hydrogen bonds (between the 2° amine of the piperidine ring —SER 152 and between the carbonyl oxygen of the amide group-PRO 155) and 11 hydrophobic interactions were responsible for the higher affinity of ligand binding (Fig. S1). Furthermore, pose number 9 (Fig. S1) demonstrated highest ligand efficiency and a subtle balance of hydrophobic (ALA 18, LEU 17 and SER 148) and hydrophilic (LYS 22, PRO 155 and THR 11) binding of amino acid residues. As a result, an optimal binding pocket was created for the compound in focus. Along with the optimal hydrophobicity, morpholine ring was considered as an important factor for inhibitor identification. Accordingly, the favourable roles of morpholine, piperidine, carboxamide and piperidine–carboxamide moieties emerged as putative serine protease inhibitors.

Conclusion

The present study demonstrates RNAi in M. vitrata using injection and ingestion approaches for functionally important genes in addition to the earlier reported diet-based dsRNA delivery. In this report, RNAi was assessed through larval mortality, decreased accumulation of transcripts and over-expression of key RNAi component, DICER. Furthermore, detection of siRNAs in ds-SP33-injected larvae using northern hybridization reiterated successful RNAi in M. vitrata using ingestion and injection approaches. An overview of the results obtained displayed a clear insight that haemolymph injection was much more effective than dsRNA droplet ingestion. The findings indicate that this approach could be useful for functional validation of genes for host-delivered RNAi or designing and developing molecules targeted to specific pathways. Thus, the leads obtained from the study could offer options for integration of this strategy into crop improvement programmes for the mitigation of this devastating herbivore.

Supplementary Information

Below is the link to the electronic supplementary material.

Authors contributions

UR planned, designed and supervised the experiments. MC and JY performed the experiments. MC and MR interpreted, analysed and arranged the experimental data. AM performed molecular docking. RS, UR and GC reviewed and finalized the manuscript.

Funding

Present research was funded by Department of Biotechnology, Government of India (Grant No. BT/IC-2/ISCB/Phase-IV/Pigeonpea).

Data availability

The data generated during the current study are available with the corresponding author.

Declarations

Conflict of interest

The authors declare that they have no conflict of interest in the publication.