Abstract
The proliferation of extended spectrum beta-lactamase (ESBL) producing Pseudomonas aeruginosa represent a major public health threat. In this study, we evaluated the antimicrobial resistance patterns of P. aeruginosa strains and characterized the ESBLs and Metallo- β-lactamases (MBL) produced. Strains of P. aeruginosa cultured from patients who attended Nelson Mandela Academic Hospital and other clinics in the four district municipalities of the Eastern Cape between August 2017 and May 2019 were identified; antimicrobial susceptibility testing was carried out against thirteen clinically relevant antibiotics using the BioMérieux VITEK 2 and confirmed by Beckman autoSCAN-4 System. Real-time PCR was done using Roche Light Cycler 2.0 to detect the presence of ESBLs; blaSHV, blaTEM and blaCTX-M genes; and MBLs; blaIMP, blaVIM. Strains of P. aeruginosa demonstrated resistance to wide-ranging clinically relevant antibiotics including piperacillin (64.2%), followed by aztreonam (57.8%), cefepime (51.5%), ceftazidime (51.0%), piperacillin/tazobactam (50.5%), and imipenem (46.6%). A total of 75 (36.8%) multidrug-resistant (MDR) strains were observed of the total pool of isolates. The blaTEM, blaSHV and blaCTX-M was detected in 79.3%, 69.5% and 31.7% isolates (n = 82), respectively. The blaIMP was detected in 1.25% while no blaVIM was detected in any of the strains tested. The study showed a high rate of MDR P. aeruginosa in our setting. The vast majority of these resistant strains carried blaTEM and blaSHV genes. Continuous monitoring of antimicrobial resistance and strict compliance towards infection prevention and control practices are the best defence against spread of MDR P. aeruginosa.
Subject terms: Microbiology, Medical research, Molecular medicine
Introduction
Pseudomonas aeruginosa is an opportunistic pathogen causing infections especially in immunocompromised patients. It is the leading cause of nosocomial infections such as urinary tract infections, surgical site infections, pneumonia, bacteremia and septicaemia1,2. It is one of the ESKAPE pathogens that is most medically and epidemiologically significant and has been implicated as a principal cause of chronic lung infections in cystic fibrosis (CF) patients and severe infections in burn victims3,4. The World Health Organization (WHO) has categorized P. aeruginosa as a critical priority pathogen, which needs urgent novel antibiotics intervention and was given a serious threat level due to multidrug resistance displayed to many antibiotics5,6. The growing resistance of P. aeruginosa to several antibiotics, as a result of excessive antibiotic administration, has resulted to the accumulation of antibiotic resistance and cross-resistance between antibiotics and the advent of multidrug-resistant (MDR) forms of P. aeruginosa. P. aeruginosa infections are generally linked with high mortality; this is due to its innate resistance to several antimicrobial agents and acquired resistance via mutation and horizontal transfer7,8 Various mechanisms involved in the resistance of P. aeruginosa include over expression of efflux pump, acquisition of Extended-Spectrum β-Lactamases (ESBLs) and Metallo-β-Lactamases (MBLs)9. ESBLs are a cluster of β-lactamases that inactivates β-lactams especially oxymino-β-lactams and monobactams, and are repressed by β-lactamase inhibitors, such as clavulanic acid. They are encoded on plasmids and can easily be conveyed from one organism to another10. ESBL enzymes according to Ambler classification are categorized into two, A and D. The most prevalent enzymes in class A include blaTEM, blaCTX-M and blaSHV, and has been described in P. aeruginosa strains10,11. The emergence of beta-lactamase enzymes is majorly due to chromosomal mutation and procurement of resistance genes which are moved about on various mobile genetic elements (MGEs) such as—bacteriophages, genomic islands, integrons, plasmids and insertion sequences12. The production of these enzymes is a going concern for infection control supervision because it restricts therapeutic choices. Continuous monitoring and timely detection of ESBL and MBL producing organisms is critical to establish suitable antimicrobial therapy and to thwart their spread13. Polymerase chain reaction (PCR)-based methods are critical to establish the prevalence and characterization of beta lactamases due to the presence of multiple resistance genes in some microorganisms14. Real-time PCR (rPCR) detection of ESBL enhances faster diagnosis and timely management of epidemiological information for monitoring outbreak situations15. Studies on ESBL-producing P. aeruginosa in South Africa have been documented from other provinces16–18 but scarce data exist in the Eastern Cape particularly in the former Transkei region on the molecular detection of ESBLs and MBLs in P. aeruginosa.
Antibiotic surveillance studies are important for the design of control strategies for preventing bacterial resistance and establishing therapeutic guidelines as well as for a better understanding of bacterial epidemiology. The first reported National antimicrobial resistance (AMR) surveillance in South Africa19 reported ESKAPE organisms causing bacteremia hence not much data for -comparative analysis. The data from the comprehensive view of AMR in blood cultures for ESKAPE pathogens revealed that 20% and 25% of P. aeruginosa bloodstream isolates were resistant to piperacillin/tazobactam and carbapenems respectively. To the best of our knowledge, there are few reports on surveillance of antimicrobial resistance (AMR) in clinical isolates of P. aeruginosa from all samples obtainable particularly from the Eastern Cape. The aim of this study was to examine the antimicrobial susceptibility profiles of clinical strains of P. aeruginosa obtained from patients attending healthcare facilities in the four district municipalities in Eastern Cape and to investigate their ESBL and MBL resistance mechanisms.
Results
Identification of P. aeruginosa and demographics
During the study period, a total of 204 P. aeruginosa isolates were identified from a range of clinical specimens of patients who attended various healthcare facilities in the OR Tambo district municipality, Alfred Nzo, Joe Gqabi and Amathole districts in the Eastern Cape Province. The strains were identified by Vitek 2 system (bioMérieux, Inc., USA), and confirmed by both Microscan autoscan-4 system (Beckman Coulter, Inc. USA) and rPCR using specific primer and probes targeting gyrB. The majority of the strains were from male patients (60%) while 40% belonged to female patients. The strains were predominantly from pus and wound swabs (80.4%), with surgical wounds constituting 43.3%, burn wounds 3.7% and others accounted for 53.0%. These samples originated from Surgical (33.3%), General (18.1%) and Paediatrics (11.3%) wards.
The mean age of patients was 32.8 years ranging from 6 days to 84 years. The male population have a mean age of 30.5 years ranging from 6 days to 83 years while the female mean age was 36.2 years with age ranging from 22 days to 84 years. These patients were drawn from four district municipalities with OR Tambo having the most at 80.4% with the least patient drawn from Joe Gqabi at 0.5% (Table 1).
Table 1.
General characteristics of study population.
| Variable | Number, n (%) |
|---|---|
| Gender | |
| Male | 122 (59.8) |
| Female | 82 (40.2) |
| Age (years) (mean ± SEM) | |
| ≤ 15 (7.4 ± 0.6) | 44 (21.6) |
| 16–30 (23.9 ± 0.7) | 48 (23.5) |
| 31–45 (37.2 ± 0.6) | 44 (21.6) |
| 46–60 (54.1 ± 0.8) | 30 (14.7) |
| > 60 (71.7 ± 1.3) | 21 (10.3) |
| Specimen source | |
| Pus and wound swab | 164 (80.4) |
| Sputum | 22 (10.8) |
| Fluid aspirate | 7 (3.4) |
| Catheter tip | 6 (2.9) |
| Urine | 3 (1.5) |
| Tissue | 2 (1.0) |
| MDR status | |
| MDR | 75 (36.8) |
| Non-MDR | 129 (63.2) |
| District municipality | |
| Alfred Nzo | 27 (13.2) |
| dAmathole | 12 (5.9) |
| Joe Gqabi | 1 (0.5) |
| OR Tambo | 164 (80.4) |
Antimicrobial susceptibility
Out of 204 isolates tested to various antibiotics, there was resistance observed in piperacillin (64.2%), followed by aztreonam (57.8%), cefepime (51.5%), ceftazidime (51.0%), piperacillin/tazobactam (50.5%), and imipenem (46.6%). Other percentages of resistance included gentamicin (35.3%), meropenem (24.0%) and amikacin (20.1%). Tobramycin was the most potent antibiotic with susceptibility of 91.7% followed by both doripenem and ciprofloxacin (88.7%) and levofloxacin (80.1%) (Fig. 1). The study also revealed a total of seventy-five isolates (36.8%) were multidrug-resistant out of the tested strains of which the majority was drawn from the OR Tambo district municipality (82.7%), Alfred Nzo (12%) and the least from Amathole (5.3%); while non-MDR constituted 63.2% of the total.
Figure 1.
Antibiotic resistance pattern of the P. aeruginosa isolates (N = 204).
Molecular Detection of ESBL- and MBL-encoding genes
Of 204 P. aeruginosa isolates, 82 were tested by singleplex rPCR for detection of ESBL and MBL. These data revealed that ESBL—genotypic resistance is driven by blaTEM (79.3%) followed by blaSHV (69.5%) and lastly blaCTX-M (31.7%). MBL-genotypic resistance, blaVIM, was not detected in all strains tested while only one blaIMP (1.25%) was detected (Table 2). The most common ESBL-genotype combination among the P. aeruginosa was a combination of blaTEM + blaSHV (40.5%).
Table 2.
ESBL genotypes in P. aeruginosa strains.
| Positive by PCR for ESBL genes | Number amplified (N = 82) | Total (%) |
|---|---|---|
| A. Single ESBL gene | ||
| blaTEM | 65 | 79.3 |
| blaSHV | 57 | 69.5 |
| blaCTX-M | 26 | 31.7 |
| blaIMP | 1 | 1.25 |
| blaVIM | 0 | 0 |
| B. Two or more ESBL genes | 121 | |
| blaTEM + blaSHV | 49 | 40.5 |
| blaTEM + blaCTX-M | 22 | 18.2 |
| blaSHV + blaCTX-M | 26 | 21.5 |
| blaTEM + blaIMP | 1 | 0.8 |
| blaTEM + blaSHV + blaCTX-M | 22 | 18.2 |
| blaTEM + blaSHV + blaIMP | 1 | 0.8 |
| blaTEM + blaSHV + blaCTX-M + blaIMP | 0 | 0 |
Discussion
The current study revealed that antibiotic resistance was observed in piperacillin (64.2%), aztreonam (57.8%), Cephalosporins (cefepime 51.5% and ceftazidime 51.0%), antipseudomonal penicillins + β-lactamase inhibitor (piperacillin/tazobactam 50.5%) and imipenem (46.6%). (Fig. 1). Others included gentamicin (35.3%), meropenem (24.0%) and amikacin (20.1%). Tobramycin was found to be the most potent antibiotic with a susceptibility of 91.7% followed by both doripenem and ciprofloxacin (88.7%) and levofloxacin (80.9%). Data from surveillance on isolates of P. aeruginosa in the South African public sector is not in agreement with the present study20. They reported much lower resistance rates of 15%, 16%, 24%, 23% and 19% in cefepime, ceftazidime, imipenem, meropenem and piperacillin/tazobactam respectively. The isolates were recovered from blood cultures only, possibly this might account for the variations in resistance rate, alternatively this might be due to regional variations in the empirical use of these antimicrobials20. This also underscores the importance of continuous local antimicrobial resistance surveillance for appropriate antibiotic treatment recommendations at the local and facility level since the data only accounted for bacteremic isolates, as there is no national surveillance data to facilitate comparison. In this study, the percentage of resistance of 11.3% to ciprofloxacin was within the same range of 13.4% described by Ramsamy et al.18. The data obtained were from nine public sector hospitals in KwaZulu-Natal Province. Additionally, gentamicin resistance of 17% and imipenem resistance of 13% as reported in the study was lower in comparison with resistance reported in the current study at 35.3% and 46.6% respectively. The susceptibility ranges of 75%-92% of P. aeruginosa isolates in this study to some routine antibiotics considered for therapy is encouraging but the increase in resistance exhibited to cephalosporins and imipenem is concerning. This might be due to selective pressure to those antibiotics and it will be important to monitor the prescription of these antibiotics. Owing to endless alteration, resistance exhibited to range of β-lactam antibiotics is challenging, thus making β-lactamase production the commonest cause of drug resistance and antimicrobial treatment failure7,21. This study detected an average resistance of 51.3% to the cephalosporins (ceftazidime and cefepime). Piperacillin and gentamicin resistance was 64.2% and 35.3% respectively similar to the findings of Uc-Cachon et al.22. The emerging level of resistance displayed to the cephalosporins highlight the development of cephalosporinases among resistant strains of these organisms. The cephalosporins due to their wide spectrum of activity are a significant class of antimicrobials used in controlling several infections however; the emergence of cephalosporinases can in effect hamper their clinical usefulness23. The reported increasing penicillinase-producing β-lactamases strains among these organisms validates the noticeably observable high rate resistance of our isolates to piperacillin23. Piperacillin is a penicillin beta-lactam antibiotic with in-vitro activity against Gram-positive and Gram-negative aerobic and anaerobic bacteria but because it is prone to hydrolysis by β-lactamase enzymes, its combination with tazobactam, a β-lactamase inhibitor, enhances the in-vitro activity of piperacillin to bacterial cells. This was noticed in the differences in the resistance to the two antibiotics with piperacillin having a higher resistance of 64.2% as compared to 50.5% in piperacillin/tazobactam.
Antibiotic resistance is a public health menace with an alarming proportion that is receiving collective attention more so that several studies have found a correlation between level of antibiotic prescription with the prevalence of antibiotic resistance24,25. Patients with resistant P. aeruginosa infections have a poor prognosis hence it is imperative that P. aeruginosa strains presenting severe drug resistance is monitored26. The swift spread and the emergence of MBL- and ESBL-producing P. aeruginosa of clinical origin is distressing and of great threat. Furthermore, level of antibiotic usage, horizontal gene transfer (HGT) event and environmental factors may account for variations in resistance patterns among strains isolated from diverse countries and regions. In the present study, 36.8% of the strains were MDR (defined as non-susceptibility to at least one agent in three or more antimicrobial categories). Studies have indicated that multidrug resistance often results into limited treatment options and adverse clinical and economic outcomes27,28.
Antimicrobial treatment is further hampered by the production of extended spectrum beta-lactamases and metallo beta-lactamases. The emergence of ESBL-producing P. aeruginosa is increasingly reported as a major cause of health-care associated infections. In the hospital locale, infections resulting from these resistant organisms are increasingly challenging to treat due to the intensity of resistance exhibited to the most commonly recommended antibiotics14,29. This study found out that the most prevalent genotype for ESBL production was blaTEM, which was detected in 65 (79.3%) strains followed by blaSHV (69.5%) and blaCTX-M (31.7%) (Table 2). It has been reported that ESBL genes show variation depending on the geographical location, the findings of Erhlers et al.30, Chen et al.31 and Miranda et al.32, from South Africa, China and Brazil respectively corroborated our results of the prevalent genotype as blaTEM while in contrast Jamali et al.33 reported the prevalent gene to be blaSHV. The predominant ESBL and MBL genes detected in a study conducted in Durban on MDR P. aeruginosa isolates were GES-2, OXA-21, and VIM-234. The least detected ESBL genotype from this study was blaCTX-M (31.7%) similar to Miranda et al.32. Although no blaVIM was detected in our study, MDR P. aeruginosa encoding blaVIM-2 gene have been reported in a tertiary hospital in Cape Town, which was responsible for an outbreak, and in a public hospital in Port Elizabeth35,36. The phenotypic resistance displayed to the carbapenems particularly imipenem which is not validated by the genotypic MBL result may be due to other resistance mechanism such as efflux over expression or forfeiture of exterior membrane protein37.
Several researchers have reported on the concurrence of different β-lactamase genes found in the same strains38,39. The most common ESBL combination in this study was a combination of blaTEM + blaSHV (40.5%) contrary to Chen et al.31, who reported the commonest to be blaSHV + blaCTX-M. The second most common genotype combination was blaSHV + blaCTX-M. This study showed the most predominant ESBL gene was blaTEM, which is corroborated by other studies. Prior to now, blaTEM used to be the most prevalent but recent reports suggest that the CTX-M-type group of ESBLs may now be the most predominant type globally40. These discrepancies may be due in part to varied geographic location, different levels of healthcare facilities involved, varied levels of exposure to healthcare settings, antibiotic use and antibiotic stewardship practices.
Conclusions
This study is the first surveillance report on antimicrobial susceptibility testing and molecular detection of resistant genes of P. aeruginosa strains from clinical samples of patients attending healthcare facilities in four district municipalities of Eastern Cape Province, South Africa. The study showed a high rate of MDR P. aeruginosa in our setting. The vast majority of these resistant strains carried blaTEM and blaSHV genes. Early detection and characterization of ESBLs is critical to contain their dissemination, prevent outbreak and optimise therapy. Continuous monitoring of antimicrobial resistance and strict compliance towards infection control practices are the best defence against continuous spread of MDR P. aeruginosa.
The limitation of this study is the fact that we could not screen P. aeruginosa isolates for the presence of all reported genes (GES-2 and OXA-21 genes) from other South African provinces due to funding constraints.
Methods
Study design and settings
A prospective, cross-sectional descriptive study. Samples from patients were collected from August 2016 to May 2019. All methods were performed in accordance with the relevant guidelines and regulations and ethics approval certificate from the Faculty of Health Sciences Human Research Committee at Walter Sisulu University was obtained, bearing the registration number 024/2016. This laboratory-based study involved collection of a range of clinical specimens of patients who attended various healthcare facilities in the OR Tambo district municipality, Alfred Nzo, Joe Jqabi and Amathole districts in the Eastern Cape Province. Five local municipalities (King Sabata Dalindyebo, Nyandeni, Mhlontlo, Port St Johns, and Ingquza Hill) form the OR Tambo district municipality with an estimated total population of 1,760,389. Patients’ clinical samples were collected from 1 Academic Central Hospital (Nelson Mandela Academic Hospital), 1 Regional Hospital (Mthatha regional hospital), 12 District Hospitals; and 11 Community Health Centers. These samples were sent for culture and susceptibility testing in the Department of Medical Microbiology at the National Health Laboratory Services (NHLS), located in the Nelson Mandela Central Hospital in Mthatha, Eastern Cape. Clinical samples from those various hospitals and clinics were sent as part of the patients’ routine standard of care.
Specimen collection and analysis
Non-duplicate P. aeruginosa isolates were collected from clinics and hospitals from the four district municipalities. Specimens included throat swabs, wound swabs, swabs from abscesses, sputum, urine, blood culture and catheter tips. Demographic characteristics of patients and medical histories were collected from medical records including date of specimen collection, gender and age. All samples were routinely cultured on MacConkey and Blood agar plates. Blood and sputum were also cultured on chocolate agar. Suspected colonies were plated on Cetrimide agar and identified by gram staining, colony characteristics, motility, pyocyanin production and characteristics grape-like odour41. Strains were identified to the species level with Vitek 2 GN (bioMérieux, Inc. USA) ID cards and confirmed by Microscan NID 2 panels (Beckman Coulter, Inc. USA). Specific primers and probes targeting gyrB were amplified by singleplex rPCR and were also used to confirm identity of the isolates.
Antimicrobial susceptibility
Antimicrobial susceptibility was obtained by determining MIC using Microscan dehydrated broth microdilution method with negative MIC Panel Type 44 (NM44) (Beckman Coulter, Inc. USA) following the manufacturer’s guidelines42 MICs were interpreted following CLSI guidelines (M100-S27 breakpoints)43. The following antibiotics were tested in the panels: amikacin, aztreonam, cefepime, ceftazidime, ciprofloxacin, doripenem, gentamicin, imipenem, levofloxacin, meropenem, piperacillin/tazobactam, piperacillin and tobramycin.
Criterion for multidrug resistance
The classification of MDR was performed according to Magiorakos et al.44. (MDR was defined as non-susceptibility to at least one agent in three or more antimicrobial categories).
Molecular ESBL and MBL detection by singleplex rPCR
Genomic DNA was extracted using Roche MagNA Pure Bacteria lysis buffer, MagNA Pure Compact Nucleic Acid Isolation kit and PCR grade water (Roche Applied Science, Indianapolis), following manufacturer’s instructions. The DNA was used as a template in the rPCR analysis. Real time PCR for blaCTX-M, blaSHV, blaTEM, blaIMP and blaVIM was carried out in the Light Cycler 2.0 instrument (Roche Applied Science, Germany) using Fast start Light Cycler 480 Hybridization probes Master kit (Roche Diagnostics, USA). The choice of testing for these genes was the result of scarcity of data in our setting. Specific primers and probes (Table 3) targeting the genes blaCTX-M, blaSHV, blaTEM, blaIMP and blaVIM were amplified by singleplex rPCR. Primers were designed by TIB-Molbiol (Berlin, Germany). rPCR assay was performed in a 32 carousels using 20 µL capillaries with each capillary containing a total volume of 20 µL including 2 µL of Light Cycler FastStart DNA Master Hybridization Probe, 2 µL of primers (0.5 mM for each forward and reverse), 2.4 µL of MgCl2, 2 µL of extracted DNA, and water to make up the volume of 20 µL. DNA amplification was carried out with the following run conditions: Pre-incubation for 5 min at 95 °C, followed by 45 cycles of amplification with denaturation at 95 °C for 30 s, annealing and extension for 1 min at 60 °C, and then a single cycle of cooling for 30 s at 40 °C11. Absolute quantification was carried out using the Light Cycler software 4.05. Positive control strains were used in the rPCR run (Table 4) These were obtained from the National Institute of Communicable Diseases (NICD), Johannesburg, South Africa.
Table 3.
Primer sequences for detection of blaCTX-M, blaSHV, blaTEM, blaIMP, blaVIM genes and gyrB.
| Target gene | Primers | Primers sequences (5′–3′) | Tm in 0 °C | References |
|---|---|---|---|---|
| blaCTX-M | CTX-M forward primer | ATGAGYACCAGTAARGTKATGGC | 58.7 | 45 |
| CTX-M reverse primer | ATCACKCGGRTCGCCIGGRAT | 59.3 | 45 | |
| CTX-M Probe | FAM-CCCGACAGCTGGGAGACGAAACGT-BBQ | 70.2 | 45 | |
| blaSHV | SHV forward primer | TCCCATGATGAGCACCTTTAAA | 56.8 | 46 |
| SHV reverse primer | TCCTGCTGGCGATAGTGGAT | 58.6 | 46 | |
| SHV Probe | FAM-TGCCGGTGACGAACAGCTGGAG-BBQ | 68.3 | 46 | |
| blaTEM | TEM forward primer | GCATCTTACGGATGGCATGA | 56.6 | 46 |
| TEM reverse primer | GTCCTCCGATCGTTGTCAGAA | 57.7 | 46 | |
| TEM Probe | FAM-CAGTGCTGCCATAACCATGAGTGA-BHQ1 | 62.2 | 46 | |
| blaIMP | IMP forward primer | GGGCGGAATAGAGTGGCTTA | 57.6 | 47 |
| IMP reverse primer | GGCTTGAACCTTACCGTCTTTTT | 59.3 | 47 | |
| IMP Probe | FAM-CGATCTATCCCCACGTATGCATCTGAATTAACA-BHQ1 | 67.4 | 47 | |
| blaVIM | VIM forward primer | TGCGCTTCGGTCCAGTAGA | 59.0 | 47 |
| VIM reverse primer | TGACGGGACGTATACAACCAGAT | 58.5 | 47 | |
| VIM Probe | FAM-CTTCTATCCTGGTGCTGCGCATTCG-BHQ1 | 67.6 | 47 | |
| gyrB | gyrB forward primer | CCT GAC CAT CCG TCG CCA CAA | 48 | |
| gyrB reverse primer | CGC AGC AGG ATG CCG ACG CC | 48 | ||
| gyrB probe |
6-FAM-CCG TGG TGG TAG ACC TGT TCC CAG ACC-BHQ 6-FAM-CCG TGG TGG TAG ACC TGT TCC CAG ACC-BBQ |
This study |
Table 4.
Control strains used for rPCR amplification.
| Organism | ATCC/NCTC number | Inherent resistant gene |
|---|---|---|
| Pseudomonas aeruginosa | ATCC 27853 | gyrB |
| Escherichia coli | NCTC 13461 | blaCTX-M |
| Klebsiella pneumoniae | ATCC 700603 | blaSHV |
| Escherichia coli | NCTC 13351 | blaTEM |
| Escherichia coli | NCTC 13476 | blaIMP |
| P. aeruginosa | NCTC 13437 | blaVIM |
Statistical analysis
The data was coded and entered into a database on an Excel spreadsheet and analyzed using Statistical Package for the Social Sciences (SPSS) version 23.0. The descriptive analysis was performed to calculate the frequency and categorical variables were expressed as proportions (%). All statistical analysis was done with statistical significance set at ≤ 0.05.
Ethics approval and consent to participate
Ethical approval for the study was granted by the Health Research Ethics and Biosafety Committee of the Faculty of Health Sciences, Walter Sisulu University (WSU) bearing the reference number 024/2016 while permission to conduct the study was obtained from the National Health Laboratory Services (NHLS). Informed consent was obtained from all study participants aged 18 years and above. However, for participants aged below 18 years, the consent was sought from a parent and/or legal guardian.
Acknowledgements
The authors are grateful to the Research Directorate of the Walter Sisulu University for their support. The support of the staff of Nelson Mandela Academic Hospital (NMAH) and the Microbiology Laboratory at the National Health Laboratory Services (NHLS) at NMAH during sample collection is greatly acknowledged. The supply of reference strains by the National Institute of Communicable Diseases (NICD) is appreciated. The considerable assistance of Dr. Ndebia J. in data analysis is highly appreciated. M.C.H received PhD bursary from National Research Foundation (NRF). The study was conducted within the Thuthuka Rating Track, [Ref. No. TTK150625121238; UID: 99307] project funded by NRF. Any opinions, findings and conclusion expressed in this manuscript are those of the authors. The funders had no role in the study design, data collection and analysis, preparation of the manuscript nor decision to publish.
Author contributions
M.C.H., T.A., S.V. Conceived and designed the experiment. M.C.H., S.V. performed the experiments: M.C.H., T.A. analysed the data: M.C.H., T.A. wrote the manuscript: M.C.H., T.A., S.V., G.E.O analysed and performed the interpretation of data as well as the proof reading of manuscript. All authors read and approved the final manuscript.
Data availability
All data generated or analysed during this study are included in this published article.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Breidenstein EB, de la Fuente-Núñez C, Hancock RE. Pseudomonas aeruginosa: all roads lead to resistance. Trends Microbiol. 2011;19(8):419–426. doi: 10.1016/j.tim.2011.04.005. [DOI] [PubMed] [Google Scholar]
- 2.Yayan J, Ghebremedhin B, Rasche K. Antibiotic resistance of Pseudomonas aeruginosa in pneumonia at a Single University Hospital Center in Germany over a 10-year period. PLoS ONE. 2015;10(10):e0139836. doi: 10.1371/journal.pone.0139836. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Subedi D, Vijay AK, Kohli GS, Rice SA, Willcox M. Comparative genomics of clinical strains of Pseudomonas aeruginosa strains isolated from different geographic sites. Sci. Rep. 2018;8:15668. doi: 10.1038/s41598-018-34020-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Rocha AJ, et al. Pseudomonas Aeruginosa: virulence factors and antibiotic resistance genes. Braz. Arch. Biol. Technol. 2019;62:e19180503. doi: 10.1590/1678-4324-2019180503. [DOI] [Google Scholar]
- 5.Frieden, T. Antibiotic resistance threats in the United States, 2013. Centers for Disease Control and Prevention, US Department of Health and Human Services 23, 11–28 (2013).
- 6.Tacconelli E, Magrini N, Kahlmeter G, Singh N. Global priority list of antibiotic-resistant bacteria to guide research, discovery, and development of new antibiotics. World Health Organ. 2017;27:318–327. [Google Scholar]
- 7.Farhan SM, Ibrahim RA, Mahran KM, Hetta HF, El-Baky RM. Antimicrobial resistance pattern and molecular genetic distribution of metallo-β-lactamases producing Pseudomonas aeruginosa isolated from hospitals in Minia, Egypt. Infect. Drug Resist. 2019;12:2125. doi: 10.2147/IDR.S198373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hwang W, Yoon SS. Virulence characteristics and an action mode of antibiotic resistance in multidrug-resistant Pseudomonas aeruginosa. Sci. Rep. 2019;9:487. doi: 10.1038/s41598-018-37422-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Chaudhary M, Payasi A. Rising Antimicrobial Resistance of Pseudomonas aeruginosa Isolated from clinical specimens in India. J. Proteom. Bioinform. 2013;6(1):005–009. [Google Scholar]
- 10.Laudy AE, et al. Prevalence of ESBL-producing Pseudomonas aeruginosa isolates in Warsaw, Poland, detected by various phenotypic and genotypic methods. PLoS ONE. 2017;12(6):e0180121. doi: 10.1371/journal.pone.0180121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Vasaikar S, Obi L, Morobe I, Bisi-Johnson M. Molecular characteristics and antibiotic resistance profiles of Klebsiella isolates in Mthatha, Eastern Cape province, South Africa. Int. J. Microbiol. 2017;7:8486742. doi: 10.1155/2017/8486742. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Founou RC, Founou LL, Essack SY. Extended spectrum beta-lactamase mediated resistance in carriage and clinical gram-negative ESKAPE bacteria: a comparative study between a district and tertiary hospital in South Africa. Antimicrob. Resist. Infect. Control. 2018;7:134. doi: 10.1186/s13756-018-0423-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Bharti NM, Sharma PC. Molecular characterization of Pseudomonas aeruginosa isolates recovered from human patients in Himachal Pradesh (India) for selective genes: extended spectrum β-lactamase (ESBL) Ampicillin Class C (AmpC) and metallo β- lactamase (MBL) genes. IJPSR. 2016;7(12):4905–4916. [Google Scholar]
- 14.Khurana S, Mathur P, Kapil A, Valsan C, Behera B. Molecular epidemiology of beta-lactamase producing nosocomial Gram-negative pathogens from North and South Indian hospitals. J. Med. Microbiol. 2017;66:999–1004. doi: 10.1099/jmm.0.000513. [DOI] [PubMed] [Google Scholar]
- 15.Alfaresi MS, Elkoush AA. Real-time polymerase chain reaction for rapid detection of genes encoding SHV extended-spectrum β-lactamases. Indian J. Med. Microbiol. 2010;28(4):332–336. doi: 10.4103/0255-0857.71827. [DOI] [PubMed] [Google Scholar]
- 16.Poirel L, Weldhagen GF, De Champs C, Nordmann PA. Nosocomial outbreak of Pseudomonas aeruginosa isolates expressing the extended-spectrum β-lactamase GES-2 in South Africa. J. Antimicrob. Chemother. 2002;49(3):561–565. doi: 10.1093/jac/49.3.561. [DOI] [PubMed] [Google Scholar]
- 17.Mudau M, et al. Outbreak of multi-drug resistant Pseudomonas aeruginosa bloodstream infection in the haematology unit of a South African Academic Hospital. PLoS ONE. 2013;8(3):e55985. doi: 10.1371/journal.pone.0055985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ramsamy Y, Essack SY, Sartorius B, Patel M, Mlisana KP. Antibiotic resistance trends of ESKAPE pathogens in Kwazulu-Natal, South Africa: a five-year retrospective analysis. Afr. J. Lab Med. 2018;7(2):a887. doi: 10.4102/ajlm.v7i2.887. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.National Department of Health Surveillance report. Surveillance for antimicrobial resistance and consumption of antibiotics in South Africa. 2018
- 20.Ismail H, et al. Surveillance and comparison of antimicrobial susceptibility patterns of ESKAPE organisms isolated from patients with bacteraemia in South Africa, 2016–2017. S. Afr. Med. J. 2019;109(12):934–940. doi: 10.7196/SAMJ.2019.v109i12.14079. [DOI] [PubMed] [Google Scholar]
- 21.Pitout JD. Enterobacteriaceae producing ESBLs in the community: are they a real threat? Infect. Med. 2007;24(2):57–65. [Google Scholar]
- 22.Uc-Cachón AH, Gracida-Osorno C, Luna-Chi IG, Jiménez-Guillermo JG, Molina-Salinas GM. High prevalence of antimicrobial resistance among gram-negative isolated bacilli in intensive care units at a tertiary-care hospital in Yucatán Mexico. Medicina. 2019;55(9):588. doi: 10.3390/medicina55090588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Osundiya OO, Oladele RO, Oduyebo OO. Multiple Antibiotic Resistance (MAR) Indices of Pseudomonas and Klebsiella species in Lagos Teaching Hospital. Afr. J. Cln. Exper. Microbiol. 2013;14(3):164–168. [Google Scholar]
- 24.Goldstein, E., MacFadden, D. R., Lee, R. S. & Lipsitch, M. Outpatient prescribing of four major antibiotic classes and prevalence of antimicrobial resistance in US adults. bioRxiv. 456244 (2018).
- 25.Sanz-García F, Hernando-Amado S, Martínez JL. Mutational evolution of Pseudomonas aeruginosa resistance to ribosome-targeting antibiotics. Front. Genet. 2018;9:451. doi: 10.3389/fgene.2018.00451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Dou Y, Huan J, Guo F, Zhou Z, Shi Y. Pseudomonas aeruginosa prevalence, antibiotic resistance and antimicrobial use in Chinese burn wards from 2007 to 2014. J. Int. Med. Res. 2017;45(3):1124–1137. doi: 10.1177/0300060517703573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Nathwani D, Raman G, Sulham K, Gavaghan M, Menon V. Clinical and economic consequences of hospital-acquired resistant and multidrug-resistant Pseudomonas aeruginosa infections: a systematic review and meta-analysis. Antimicrob. Resist. Infect. Control. 2014;3:32. doi: 10.1186/2047-2994-3-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Nørgaard SM, et al. Choice of therapeutic interventions and outcomes for the treatment of infections caused by multidrug-resistant gram-negative pathogens: a systematic review. Antimicrob. Resist. Infect. Control. 2019;8:170. doi: 10.1186/s13756-019-0624-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Amirkamali S, Naserpour-Farivar T, Azarhoosh K, Peymani A. Distribution of the bla OXA, bla VEB-1, and bla GES-1 genes and resistance patterns of ESBL-producing Pseudomonas aeruginosa isolated from hospitals in Tehran and Qazvin Iran. Rev. Soc. Bras. Med. Trop. 2017;50(3):315–320. doi: 10.1590/0037-8682-0478-2016. [DOI] [PubMed] [Google Scholar]
- 30.Ehlers MM, et al. Detection of blaSHV, blaTEM and blaCTX-M antibiotic resistance genes in randomly selected bacterial pathogens from the Steve Biko Academic Hospital. FEMS Immunol. Med. Microbiol. 2009;56(3):191–196. doi: 10.1111/j.1574-695X.2009.00564.x. [DOI] [PubMed] [Google Scholar]
- 31.Chen Z, et al. Prevalence of ESBLs-producing Pseudomonas aeruginosa isolates from different wards in a Chinese teaching hospital. Int. J. Clin. Exp. Med. 2015;8(10):19400. [PMC free article] [PubMed] [Google Scholar]
- 32.Miranda CC, et al. Genotypic characteristics of multidrug-resistant Pseudomonas aeruginosa from hospital wastewater treatment plant in Rio de Janeiro Brazil. J. Appl. Microbiol. 2015;118(6):1276–1286. doi: 10.1111/jam.12792. [DOI] [PubMed] [Google Scholar]
- 33.Jamali S, Shahid M, Sobia F, Singh A, Khan HM. Phenotypic and molecular characterization of cefotaximases, temoniera, and sulfhydryl variable β-lactamases in Pseudomonas and Acinetobacter isolates in an Indian tertiary health-care center. Indian J. Pathol. Microbiol. 2017;60:196–201. doi: 10.4103/0377-4929.208377. [DOI] [PubMed] [Google Scholar]
- 34.Adjei CB, Govinden U, Moodley K, Essack SY. Molecular characterisation of multidrug-resistant Pseudomonas aeruginosa from a private hospital in Durban, South Africa. S. Afr. J. Infect. Dis. 2018;33(2):38–41. [Google Scholar]
- 35.Jacobson RK, Minenza N, Nicol M, Bamford C. VIM-2 Metallo-β-lactamase-producing Pseudomonas aeruginosa causing an outbreak in South Africa. J. Antimicrob. Chemother. 2012;67(7):1797–1798. doi: 10.1093/jac/dks100. [DOI] [PubMed] [Google Scholar]
- 36.Govender S, Masunda T, Black J. VIM-2 carbapenemase-producing Pseudomonas aeruginosa in a patient from Port Elizabeth South Africa. S. Afr. Med. J. 2015;105(5):328–333. doi: 10.7196/SAMJ.9513. [DOI] [PubMed] [Google Scholar]
- 37.Polloto M, et al. Detection of P. aeruginosa harboring blaCTX-M-2, blaGES-1 and blaGES-5, blaIMP-1 and blaSPM-1 causing infections in Brazilian tertiary-care hospital. BMC Infect. Dis. 2012;12:176. doi: 10.1186/1471-2334-12-176. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Zafer MM, Al-Agamy MH, El-Mahallawy HA, Amin MA, Ashour MS. Antimicrobial resistance pattern and their beta-lactamase encoding genes among Pseudomonas aeruginosa strains isolated from cancer patients. BioMed Res. Int. 2014;2014:101635. doi: 10.1155/2014/101635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Bahrami M, Mohammadi-Sichani M, Karbasizadeh V. Prevalence of SHV, TEM, CTX-M and OXA-48 β-lactamase genes in clinical isolates of Pseudomonas aeruginosa in Bandar-Abbas Iran. Avicenna J. Clin. Microbiol. Infect. 2018;5(4):86–90. doi: 10.34172/ajcmi.2018.18. [DOI] [Google Scholar]
- 40.Sahoo S, Otta S, Swain B, Kar SK. Detection and genetic characterization of extended-spectrum beta-lactamases producers in a tertiary care hospital. J. Lab Phys. 2019;11:253–258. doi: 10.4103/JLP.JLP_31_19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Solomon FB, Wadilo F, Tufa EG, Mitiku M. Extended spectrum and metallo beta-lactamase producing airborne Pseudomonas aeruginosa and Acinetobacter baumanii in restricted settings of a referral hospital: a neglected condition. Antimicrob. Resist. Infect. Control. 2017;6(1):106. doi: 10.1186/s13756-017-0266-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Lutgring JD, et al. Evaluation of the MicroScan colistin well and gradient diffusion strips for colistin susceptibility testing in Enterobacteriaceae. J. Clin. Microbiol. 2019;57(5):e01866–e1918. doi: 10.1128/JCM.01866-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing; 20th Informational Supplement. CLSI document M100-S20, 2010. CLSI, Wayne, PA: Clinical and Laboratory Standards Institute.
- 44.Magiorakos AP, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012;18(3):268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
- 45.Angeletti S, et al. Real-time polymerase chain reaction with melting analysis of positive blood culture specimens in bloodstream infections: diagnostic value and turnaround time. New Microbiol. 2013;36:65–74. [PubMed] [Google Scholar]
- 46.Roschanski N, Fischer J, Guerra B, Roesler U. Development of a multiplex real-time PCR for the rapid detection of the predominant beta-lactamase genes CTX-M, SHV, TEM and CIT-type AmpCs in Enterobacteriaceae. PLoS ONE. 2014;9(7):e100956. doi: 10.1371/journal.pone.0100956. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Wendel AF, et al. Genetic characterization and emergence of the metallo-β-lactamase GIM-1 in Pseudomonas spp. and Enterobacteriaceae during a long-term outbreak. Antimicrob. Agents Chemother. 2013;57(10):5162–5165. doi: 10.1128/AAC.00118-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Anuj SN, et al. Identification of Pseudomonas aeruginosa by a duplex real-time polymerase chain reaction assay targeting the ecfX and the gyrB genes. Diagn. Microbiol. Infect. Dis. 2009;63(2):127–131. doi: 10.1016/j.diagmicrobio.2008.09.018. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analysed during this study are included in this published article.

