Skip to main content
PLOS One logoLink to PLOS One
. 2021 Mar 30;16(3):e0248522. doi: 10.1371/journal.pone.0248522

Mutation status and prognostic value of KRAS and NRAS mutations in Moroccan colon cancer patients: A first report

Fatima El agy 1,2,*, Sanae el Bardai 2, Ihsane El Otmani 1,2,3, Zineb Benbrahim 4, Ibn Majdoub Hassani Karim 5, Khalid Mazaz 5, El Bachir Benjelloun 5, Abdelmalek Ousadden 5, Mohammed El Abkari 6, Sidi Adil Ibrahimi 5, Laila Chbani 1,2
Editor: Hassan Ashktorab7
PMCID: PMC8009361  PMID: 33784337

Abstract

This study aimed to estimate the incidence of KRAS, NRAS, and BRAF mutations in the Moroccan population, and investigate the associations of KRAS and NRAS gene mutations with clinicopathological characteristics and their prognosis value. To achieve these objectives, we reviewed medical and pathology reports for 210 patients. RAS testing was investigated by Sanger sequencing and Pyrosequencing technology. BRAF (exon 15) status was analyzed by the Sanger method. The expression of MMR proteins was evaluated by Immunohistochemistry. KRAS and NRAS mutations were found in 36.7% and 2.9% of 210 patients, respectively. KRAS exon 2 mutations were identified in 76.5% of the cases. RAS-mutated colon cancers were significantly associated with female gender, presence of vascular invasion, classical adenocarcinoma, moderately differentiated tumors, advanced TNM stage III-IV, left colon site, higher incidence of distant metastases at the time of diagnostic, microsatellite stable phenotype, lower number of total lymph nodes, and higher means of positive lymph nodes and lymph node ratio. KRAS exon 2-mutated colon cancers, compared with KRAS wild-type colon cancers were associated with the same clinicopathological features of RAS-mutated colon cancers. NRAS-mutated patients were associated with lower total lymph node rate and the presence of positive lymph node. Rare RAS-mutated tumors, compared with wild-type tumors were more frequently moderately differentiated and associated with lower lymph node rate. We found that KRAS codon 13-mutated, tumors compared to codon 12-mutated tumors were significantly correlated with a higher death cases number, a lower rate of positive lymph, lower follow-up time, and poor overall survival. Our findings show that KRAS and NRAS mutations have distinct clinicopathological features. KRAS codon 13-mutated status was the worst predictor of prognosis at all stages in our population.

Introduction

Ras-family G-proteins transduce growth factor signals, such as EGF receptor (EGFR) signaling pathway [1]. KRAS and NRAS mutations appear early in colorectal carcinogenesis (aberrant crypt foci lacking dysplasia and polypsis) leading to constitutive signaling and downstream activation of mitogen-activated protein kinase (MAPK) and phosphoinositide 3- kinase (PI3K) dependent pathways [2–4], and contribute also to tumor progression in association with others genetic alterations [5]. Numerous studies have reported that KRAS and NRAS mutations occur respectively in 45% and 5–8% of worldwide colorectal cancer patients [6]. The overwhelming majority of KRAS and NRAS mutations occur in codons 12 and 13 (90%) of KRAS gene and less frequently in codons 59, 61, 117 and 146 of KRAS and NRAS genes. In the field of metastatic colorectal treatment, previous studies have demonstrated that KRAS exon 2 mutations have a negative effect on response to anti epidermal growth factor receptor (EGFR) monoclonal antibodies (cetuximab and panitumumab) [7]. In fact, it have been confirmed that patients with KRAS codon 12 and 13 mutants tumors do not respond to anti-EGFR monoclonal antibodies. In contrast, patients with WT KRAS exon 2 tumors significantly benefited from the treatment. Recently, mutations in KRAS outside exon 2 (KRAS exons 3,4) and in other downstream effectors of the EGFR signalling pathway, such as NRAS have been reported to be also associated with resistance to anti-EGFR monoclonal antibodies [8]. For this reason, since 2013 full RAS WT state was recommended to be confirmed in all mCRC patients before initiating treatment with Anti- EGFR monoclonal antibodies, panitumumab and cetuximab. Previous reports have demonstrated that KRAS exon 2 mutations might be associated with many clinicopathological features. Christophe and all [9] found in a cohort of 41514 patients that KRAS mutations appear frequently in older patients with a predominance of male gender and located in right (coecum). Mucinous differentiation has been reported to be correlated with Kras mutations by some studies, whereas others reported no relationship [9,10]. KRAS, NRAS and BRAF mutations are mutually exclusive; however KRAS-mutant CRCs also have PIK3CA and APC mutations [11]. Furthermore KRAS exon 3 mutations are associated with deficient mismatch repair status and Lynch syndrome. Several local studies had analyzed data on KRAS- mutant CRCs. Some studies have demonstrated that KRAS gene mutated colorectal cancers were correlated with worse overall survival [12]. Although, others found noassociation [13].

Up until now, the association between all RAS status (exon 2, 3 and 4 of KRAS and NRAS genes) and tumor features has been investigated by few studies [14]. Recently, the Molecular Cancer Genetics Platform of Poitiers (French) has published interesting results about the clinicopathological features of every KRAS and NRAS mutation in a cohort of 1735 French colorectal cancer patients, enrolled from 28 hospital molecular genetics platforms throughout France [15]. However, this type of study has been never established in Moroccan colon cancer patients. Our study aimed to estimated the incidence of KRAS and NRAS mutations (KRAS exons 2/3/4 and NRAS exons 2/3/4) in Moroccan population, to identify the clinicopathological characteristics of KRAS and NRAS gene mutations and to evaluate their prognosis value in colon cancer.

Materials and methods

Ethics

This study protocol was reviewed and approved by Hassan II University Hospital Ethics Committee of FEZ, Morocco, under reference no. 13/18. All patients gave written informed consent before the start of the study.

Patients

A total of 210 patients were enrolled in this study at Hassan II University Hospital, Fez, Morocco, from 2015 to 2020. Medical charts were prospectively and retrospectively reviewed, and patients were recruited using the following selection criterion: (a) patients with histologically confirmed primary adenocarcinoma (b) all cases with pathologic I-IV stage colon cancer, (c) patients with prognostic information and who underwent surgical resection for CC tumor at the surgery department of Hassan II University Hospital. Patients were excluded if their records were incomplete, without histological confirmation of colon adenocarcinoma and if they had rectal cancer. Demographic and clinicopathological information (e.g. age, gender, tumor grade, tumor site histological subtype, disease stage, and numbers of examined regional lymph nodes…) and follow up data, were obtained from the patient’s medical records and pathology reports. Overall survival was defined as the time from the start of diagnosis until death or until the last follow-up.

Molecular testing was performed at the molecular pathology department of Hassan II University Hospital. Before 2016, only KRAS exon 2 mutations have been analyzed. Since 2016, we have started testing complete RAS status systematically, for every metastasis colon cancer patient when considered for anti-EGFR therapy.

DNA extraction

Tumoral DNA was extracted from paraffin- embedded tumor sections. The blocks with higher proportion of tumors cells was selected by a pathologist on hematoxylin, safran and eosin- stained slides. From the selected FFPE tumor block 4–8 sections of 5 μm thickness were obtained for DNA extraction using the QIAamp DNA FFPE Tissue Kit (Invitrogen), and according to the manufacturer’s instructions. DNA concentration (ng/ul) was assessed by Qubit fluorometer.

Molecular analysis

KRAS (exon 2, 3 and 4) and NRAS (exon 2, 3, and 4) mutations were analyzed using polymerase chain reaction (PCR) amplification and pyrosequençing on the Qiagen PyroMark Q24 device according to the CE-IVD-marked therascreen RAS Pyro Kit Handbook.

Direct sequencing

PCR was performed in 25 ul volume containing 10 ng of template DNA, 12× PCR mix platinium, 12.5 pmol primers, and 50 umol Mgcl2. Primer sequences used for PCR are presented in Table 1. PCR products were purified using ExoSAP® kit according to the manufacturer’s protocols. The purified PCR products were sequenced using the direct sequencing with BigDye Terminator V3.1 Cycle Sequencing Kit (ABI Prism) and analyzed on Applied Biosystems 3500Dx Genetic Analyzer (Applied Biosystem). Results were visualized using Sequencing Analysis software v5.4.

Table 1. Primer sequences used for PCR.
Primer name Primer sequence
KRAS-ex 2- F 5’-GGTGGAGTATTTGATAGTGTA- 3’
KRAS-ex 2- R 5’-TGCATATTACTGGTGCAGACC- 3’
KRAS-ex 3- F 5’-AGTAAAAGGTGCACTGTAATAA-3’
KRAS-ex 3- R 5’-ATAATAAGCTGACATTAAGGAG-3’
KRAS-ex 4- F 5’-TGTTACTAATGACTGTGCTATAACTTTT-3’
KRAS-ex 4- R 5’-TATGCTATACTATACTAGGAAATAAAA-3’
NRAS-ex2-F 5’-ATGACTGAGTACAAACTGGTGGTGGTTGGAGCA-3’
NRAS-ex2-R 5’-CACTTTGTAGATGAATATGATCCCACCATAGAG-3’
NRAS-ex3-F 5’-GATTCTTACAGAAAACAAGTGGTTA-3’
NRAS-ex3-R 5’-CATTTGCGGATATTAACCTCTACAG-3’
NRAS-ex4-F 5’-GGAGCAGATTAAGCGAG-3’
NRAS-ex4-R 5’-TCAGCCAAGACCAGACAG-3’

Pyrosequencing

The TheraScreen® KRAS Pyro kit (for KRAS codons 12 and 13), and the TheraScreen® RAS Extension Pyro kit (for KRAS codons 59/61, 117 and 146, and NRAS codons 12, 13, 59, 61, 117 and 146) (Qiagen, GERMANY), were used for RAS mutations testing, according to the manufacturer’s instructions. Briefly, 5 μl of template DNA (2–10 ng of genomic DNA) were amplified by polymerase chain reaction (PCR) in a 20 μl volume containing 12.5 μl of PyroMark® PCR Master Mix 2x, 2.5 μl of Coral Load Concentrate 10x, 4 μl of nuclease-free water, and 1 μl of the corresponding set of PCR primers (Qiagen). 10 μl of PCR products were immobilized to Streptavidin Sepharose High Performance beads (Qiagen) to prepare the single‑stranded DNA. The corresponding sequencing primers were allowed to anneal to the DNA using a PyroMark Q24 plate and a vacuum workstation (Qiagen). The sequences were analyzed using Pyromark Q24 software in the AQ analysis mode. In each run, a negative control (without template DNA) and an unmethylated control DNA, provided by the kit as a positive control for PCR and sequencing reactions were included.

BRAF molecular testing

BRAF testing was performed for 200 patients using Sanger sequencing as described previously (KRAS and NRAS mutations testing). Briefly, DNA was amplified by PCR (Master Mix (2X) kits) according to the manufacturer’s protocols and using the following forward primer (5’-ACGAACGAGACTATCCTTTTAC-3’) and reverse primer (5’- CATTGAGTCGTCGTAGAGTCCC-3’). PCR products were purified using ExoSAP® kit according to the manufacturer’s protocols. The purified PCR products were sequenced using the direct sequencing with BigDye Terminator V3.1 Cycle Sequencing Kit (ABI Prism) and analyzed on Applied Biosystems 3500Dx Genetic Analyzer (Applied Biosystems).

Detection of MMR protein expression

The mismatch repair tumor status (MSS or MSI) was established by immunohistochemistry (IHC) to detect the intact or the loss expression of the MMR proteins (MLH1, PMS2, MSH2, and MSH6). The IHC study was assessed on unstained formalin-fixed paraffin-embedded (FFPE) tumor tissue sections of 4 μm thickness, on the automated immunostainer Ventana Benchmark ULTRA. We have employed monoclonal antibodies specific for each MMR protein, MLH1 (G168-728/CELL MARQUE), MSH2 (G219-1129/CELL MARQUE), MSH6 (44/CELL MARQUE), and PMS2 (MRQ-28/CELL MARQUE).Adjacent normal tissue (lymphocytes or normal glandular cells) was used as an internal control for positive staining.

Statistical analysis

Clinical, pathological, and molecular variables collected at baseline were described as means and standard deviation (sd’s) for quantitative variables and percentages for qualitative variables. Associations between mutational status and tumor characteristics were assessed using the χ2-test or Fisher’s exact test for categorical variables and using unpaired t-test for continuous variables. Tests were statistically significant when p<0.05.

PFS and OS according to KRAS status were analyzed using the Kaplan‑Meier method to estimate the probability of survival and survival difference with the use of the log-rank test. All reported P-values were the result of two‑sided tests, with P<0.05 considered statistically significant. Multivariate analysis was performed using a Cox proportional hazard model to identify prognostic factors. Factors that were significant and nearly significant (P<0.1) were included in univariate analysis. Statistical analysis was performed using the IBM SPSS Statistic 21.

Results

Molecular and clinicopathological features of patients

A total of 210 patients with locally and advanced CC, were enrolled in this study. Patients and tumor characteristics are summarized in Table 2. 97 (46.2%) were Women and 113 (53.8%) were Men with a mean age of 55.56 years (range, 16–92 years). The left-sided colon cancers were the most frequent tumors diagnosed in our cohort (n = 143, 68.1%), compared to right-sided CC (n = 67, 31.9%), indicating a predominance of left CC in our population.

Table 2. Clinicopathological and molecular characteristics of patients.

Characteristics Total
Age:
    Mean (±SD) 55.56 (±14.3)
        ≤55 92 (43.8%)
        ≥55 118 (56.2%)
Gender
Female 97 (46.2%)
Male 113 (53.8%)
Tumor site
Right colon 67 (31.9%)
Left colon 143 (68.1%)
Histologic subtype:
Adenocarcinoma 172 (81.9%)
Mucinous adenocarcinoma 26 (12.4%)
Others 12 (5.7%)
Histologic grade:
Well 92 (43.8%)
moderate 99 (47.1%)
Poor 19 (9.0%)
Vascular invasion:
Yes 37 (17.6%)
No 173(82.4%)
perineural invasion:
Yes 22 (10.7%)
No 184 (89.3%)
Distant metastases (M)
M0 127 (60.5%)
M1 83 (39.5%)
Number of metastases:
1 51 (68.0%)
≥2 24 (32.0%)
Number of removed lymph nodes:
    Mean (± SD) 18.40 (± 9.67)
<12 46 (23.1%)
    ≥12 153 (76.9%)
Average 1–53
Positive lymph node:
    Mean (± SD) 1.74 (± 3.63)
    Presence 83 (39.5%)
    Absence 127 (60.5%)
    Average 1–18
Lymph node ratio:
mean (± SD) 0.16 (±0.38)
range 0.00–3.25
Disease stages
I-II 126 (60%)
III-IV 84 (40%)
MSI status
MSS 100 (85.5%)
MSI 17 (14.5%)
BRAF mutation:
Presence 0 (0%)
Absence 200(100%)
RAS mutation
Presence 83(39.5%)
Absence 127(60.5%)
follow-up time (months):
Mean (SD) 46.74 (±34.53)
    Range 3–132
Recurrence
(+) 75 (35.7%)
(−) 135 (64.3%)
Mortality
Death cases 53 (25.4%)
Censored cases 156 (74.6%)

The most common histological subtype of CC was adenocarcinoma with 172 cases (81.9%) and less frequent subtype was mucinous adenocarcinoma with 26 (12.4%) cases. Others subtypes were diagnosed only in 12 cases (5.7%). 99 (47.1%) tumors out of 210 were moderately differentiated, 92 (43.8%) and 19 (9.0%) were well and poorly differentiated, respectively. A vascular invasion was seen in 37 (17.6%) tumors. Perineural invasion was identified in 22 (10.7%) tumors. In this study, the mean number of removed Lymph Nodes was 18.40 (rang, 1–53), and 153 (76.9%) patients had more than 12 dissected LN. Positive LNs were identified in 83 (39.5%) patients (mean = 1.74; rang, 1–18). Regarding the pathologic stage, 126 (60%) of tumors were classified as stage I-II and 84 (40%) as stage III-IV. 83 (39.5%) of patients study were classified as metastatic group.

The mean follow-up time of overall survival was 46.74 months (rang, 3–132 months). From 210 patients’ colon cancer, 53 (25.4%) were died. Moreover, the rate of recurrence was 75 35.7% (n = 75). Regarding molecular characteristics of our cohort, the MSI status was reported in 17 patients (14.5%) and KRAS and NRAS mutations in 83 patients (39.5%). Although, from 200 patients, we did not find any BRAF mutation.

Mutations frequencies and current alterations

KRAS and NRAS mutation were detected in 39.5% (83/210) of tumor cases examined, of which 36.7% (77/210) and 2.9% (6/210) were occurred in KRAS and NRAS gene respectively. BRAF mutations analysis was performed on 200 tumors, while we did not find any case with BRAF mutation. Interestingly, simultaneous mutations were not found in this study Table 3.

Table 3. Mutational status of patients with CC by genes.

Gene alterations Number (%)
KRAS (n = 210):
Wildtype (n = 133) 66.3%
Mutated (n = 77) 36.7%
NRAS (n = 210):
Wildtype (n = 204) 97.1%
Mutated (n = 6) 2.9%
BRAF (n = 200):
Wildtype 100%
Mutated 0%

All data according to the site of mutations are presented in Table 4. In the KRAS-mutant CC group, 88.3% (n = 68/77) of mutations were in exon 2, 1.3% in exon 3 (1/77), and 10.4% (8/77) in exon4. Among mutations in KRAS exon 2, 76.5% (52/68) of cases had single mutations in codon 12 and 23.5% (16/68) of cases in codon 13. The most frequent mutant type in exon 2 of KRAS gene was G12D (19/77, 24.7%), followed by G12V (17/77, 22.1%) and G13D (13/77, 16.9%), others mutation were also found in our study (G12C, G12A, G12R, G13V, G13R) but were less frequent, Table 4. Exon 3 KRAS mutations were found in one case. The mutation was located in codon 61 (Q61L) and it accounted for 1.3% (1/77) of KRAS-mutant CC group. In exon 4, 5 mutations (5/77, 6.5%) were located in codon 146 and 3 mutations in codon 117 (3/77, 3.9%). The main mutant types were K117N and A146T with a percentage of (3/77, 3.9%) followed by A146P and A146V (1/77, 1.3%).

Table 4. Frequency and distribution of KRAS, NRAS, and BRAF mutations.

Gene Exon Nucleotide substitution Codon substitution Amino acid substitution Number %
c.35G>A GGT>GAT p.G12D 19 24.7%
c.35G>T GGT>GTT p.G12V 17 22.1%
2 c.34G>T GGT>TGT p.G12C 9 11.7%
c.35G>C GGT>GCT p.G12A 5 6.5%
c.34G>C GGT>CGT p.G12R 2 2.6%
c.38 G>A GGC>GAC p.G13D 13 16.9%
KRAS c.38G>T GGC>GTC p.G13V 2 2.6%
c.37G>C GGC>CGC p.G13R 1 1.3%
3 c.182A>T CAA>CTA p.Q61L 1 1.3%
4 c.351A>T AAA>AAT p.K117N 3 3.9%
c.436G>C GCA>ACA p.A146T 3 3.9%
c.436G>A GCA>CCA p.A146P 1 1.3%
c.437C>T GCA>GTA p.A146V 1 1.3%
NRAS 2 c.35G>A GGT>GAT p.G12D 2 33.3%
3 c.181C>A CAA>AAA p.Q61K 2 33.3%
c.182A>T CAA>CTA p.Q61L 2 33.3%
4 any any any 0 0%
BRAF 15 WT pV600E 0 0%

NRAS mutations occurred in 33.3% (2/6) of cases in exon 2, and in 66.7% (4/6) of cases in exon 3. The main mutant types were G12D in codon 12 of exon 2 (2/6, 33.3%), Q61K in codon 61of exon 3 (2/6, 33.3%) and Q61L also in the same site (2/6, 33.3%), Table 4.

Association between KRAS and NRAS mutations and clinicopathological features

Table 5 demonstrates the relationship between KRAS and NRAS mutations status and clinicopathological parameters. Compared with RAS wild-type tumors, RAS mutant tumors were statistically associated with female gender (P = 0.003), presence of vascular invasion (P = 0.03), classical adenocarcinoma (P = 0.01), moderately differentiated tumors (0.04) and advanced TNM stage III-IV (P = 0.02). KRAS and NRAS mutations tended also to be located in the left colon (P = 0.009), to have a higher incidence of distant metastases at the time of diagnostic (P = 0.03) and occurred more frequently in tumors with microsatellite stable phenotype (P = 0.02). Regarding nodal counts, RAS mutant tumors subgroup was significantly associated with lower number of total lymph nodes examined, than the Wild-type subgroup (P <0.001). 61.1% of the mutated RAS patients have more than 12 lymph nodes examined, compared with 85.8% in the wild-type RAS patients (P <0.001). Although, the means of positive LNs and Lymph node Ratio (LNR) were significantly higher in RAS mutant tumors (P = 0.03); (P<0.001). Interestingly when analyzing our cohort, the number of recurrence and death cases was significantly higher in RAS-mutant tumors subgroup. In contrast, there were no significant associations with other clinical and pathological features (age, perineural invasion).

Table 5. Clinicopathological characteristics according to KRAS and NRAS mutations status in 210 colon cancer patient.

Characteristics RAS Wild-type RAS Mutants p-value
Age:
    Mean (±SD) 55.3 (±14.3) 55.9 (±15.7) 0.7
        ≤55 57 (44.9%) 35 (42.2%) 0.1
        ≥55 70 (55.1%) 48 (57.8%)
Gender
Female 49 (38.6%) 48 (57.8%) 0.003
Male 78 (61.4%) 35 (42.2%)
Tumor site
Right colon 48(37.8%) 19 (22.9%) 0.009
Left colon 79 (62.2%) 64 (77.1%)
Histologic subtype:
Adenocarcinoma 107 (84.3%) 65 (78.3%) 0.01
Mucinous adenocarcinoma 10 (7.9%) 16 (19.3%)
Others 10(7.9%) 2 (2.4%)
Histologic grade:
Well 58 (45.7%) 34 (41.0%) 0.04
moderate 54 (42.5%) 45 (54.2%)
Poor 15 (11.8%) 4 (4.8%)
Vascular invasion:
Yes 15 (11.8%) 22 (26.5%) 0.006
No 112 (88.2%) 61(73.5%)
perineural invasion:
Yes 14 (11.0%) 8 (10.1%) 0.1
No 113 (89.0%) 71(89.9%)
Distant metastases (M)
M0 82 (64.6%) 45 (54.2%) 0.03
M1 45 (35.4%) 38 (45.8%)
Number of metastases:
1 31 (73.8%) 20 (60.6%) 0.04
≥2 11 (26.2%) 13 (39.4%)
Number of removed lymph nodes, mean ± SD 20.43 ±9.37 14.83 ±9.19 <0.001
<12 18 (14.2%) 28 (38.9%) <0.001
    ≥12 109 (85.8%) 44 (61.1%)
Positive lymph node:
    Mean (± SD) 1.34 (±3.70) 2.44 (±3.4)1 0.03
    Presence 29 (22.8%) 35 (48.6%)
    Absence 98 (77.2%) 37 (51.4%) <0.001
Lymph node ratio, mean ± SD 0.07 ±0.18 0.32 ±0.55 <0.001
Disease stages
I-II 57 (44.9%) 27 (32.5%) 0.02
III-IV 70 (55.1%) 56 (67.5%)
MSI status
MSI 15 (19.5%) 2 (5.0%) 0.02
MSS 62 (80.5%) 38 (95.0%)
BRAF mutation: - - -
    follow-up time (months):
        Mean 50.08 41.69 0.04
        SD ±34.19 ±34.63
Recurrence
(+) 36 (28.3%) 39 (47.0%) 0.003
(−) 91 (71.7%) 44 (53.0%)
Mortality
Death cases 26(20.5%) 27 (32.9%) 0.01
Censored cases 101 (79.5%) 55 (67.1%)

Association between KRAS and NRAS mutation subtypes and clinicopathological features

Secondly, we investigated the association between KRAS and NRAS mutation subtypes and clinicopathological parameters. As shown in Table 6, female gender, left localization, classical adenocarcinoma, vascular invasion, presence of positive lymph node and advanced disease stage were found to be associated with KRAS mutated colon cancers as compared with KRAS wild-type colon cancers. More KRAS mutated colon cancers had a higher incidence of metastatic disease at diagnosis (P = 0.04). At all stages, the mean of examined lymph nodes was significantly higher in KRAS wild-type tumors than KRAS mutated tumors (P<0.001). In addition, 62.1% of the mutated KRAS tumors have more than 12 lymph nodes examined, compared with 84.2% in the wild-type RAS patients (P <0.001). Furthermore the presence of positive lymph node was significantly associated with KRAS mutated tumors (P = 0.003). Moreover, KRAS mutations were more likely to appear in tumors with microsatellite-stable phenotype (P = 0.03). Generally, the incidence of recurrence and death cases was significantly higher in KRAS-mutated colon cancers. Compared to NRAS wild- type patients, NRAS-mutated patients, were more likely to exhibit lower total lymph node rate (P = 0.04). This subgroup of tumors was also marked by the presence of positive lymph node (83.3%, P = 0.01). Although, there were no significant associations in others clinicopathological characteristics between NRAS mutant and WT patients.

Table 6. Association between KRAS and NRAS mutation subtypes and clinicopathological parameters.

Characteristics KRAS mutant KRAS wild type p NRAS Mutant NRAS wild type p Rare mutations wild-type status p
Age
Mean ((±SD) 55.8 ± 16.0 55.3 ±14.3 0.7 56.5 ±13.0 55.5 ±14.9 0.8 50.2 ±16.0 55.8 ±14.7 0.1
≤55 33 (42.9%) 59 (44.4%) 0.1 2 (33.3%) 90 (44.1%) 0.4 7 (46.7%) 85 (43.6%) 0.5
>55 44 (57.1% 74 (55.6%) 4 (66.7%) 114 (55.9%) 8 (53.3%) 110 (56.4%)
Gender
Female 45(58.4%) 52 (39.1%) 0.003 3 (50.0%) 94 (46.1%) 0.4 7 (46.7%) 90 (46.2%) 0.5
Male 32(41.6%) 81(60.9%) 3 (50.0%) 110 (53.9%) 8 (53.3%) 105 (53.8%)
Tumor site
Right colon 18 (23.4%) 49(36.8%) 0.01 1 (16.7%) 66 (32.4%) 0.2 2 (13.3%) 65 (33.3%) 0.06
Left colon 59 (76.6%) 84 (63.2%) 5 (83.3%) 138 (67.6%) 13 (86.7%) 130 (66.7%)
Histologic subtype
Adenocarcinoma 60 (77.9%) 112(84.2%) 0.02 5 (83.3%) 167(81.9%) 0.5 12 (80.0%) 160 (82.1%) 0.4
Mucinous adenocarcinoma 15(19.5%) 11 (8.3%) 1(16.7%) 25 (12.3%) 3(20.0%) 23 (11.8%)
Others 2 (2.6%) 10 (7.5%) 0 (0.0%) 12(5.9%) 0 (0.0%) 12 (6.2%)
Histologic grade
Well 33 (42.9%) 59 (44.4%) 0.07 1(16.7%) 91 (44.6%) 0.1 2 (13.3%) 90 (46.2%) 0.006
Moderate 40 (51.9%) 59(44.4%) 5 (83.3%) 94 (46.1%) 13 (86.7%) 86 (44.1%)
Poor 4 (5.2%) 15 (11.3%) 0 (0.0%) 19 (9.3%) 0 (0.0%) 19 (9.7%)
vascular invasion
Presence 20 (26.0%) 17(12.8%) 0.04 0 (0.0%) 26 (12.7%) 0.4 0 (0%) 26 (13.3%) 0.09
15 (100%) 169 (86.7%)
Absence 57(74.0%) 116(87.2%) 6 (100.0%) 178 (87.3%)
Perineural invasion
Presence 8 (11.0%) 14(10.5%) 0.1 2 (33.3%) 35 (17.2%) 0.5 4 (26.7%) 33 (16.9%) 0.1
Absence 65 (89.0%) 119(89.5%) 4 (66.7%) 169 (82.8%) 11 (73.3%) 162 (83.1%)
Distant metastases (M)
M0 42 (54.4%) 85 (63.9%) 0.04 3 (50.0%) 83 (65.4%) 0.3 8 (53.3%) 119 (61.0%) 0.3
M1 35 (45.5%) 48 (36.1%) 3 (50.0%) 44 (34.6%) 7 (46.7%) 76 (39.0%)
Number of metastases:
1 18 (62.1%) 33(76.7%) 0.1 3 (100.0%) 49 (70.0%) 0.3 3 (40.0%) 48 (71.6%) 0.4
≥2 11 (37.9%) 10(23.3%) 0 (0.0%) 21 (30.0%) 2 (60.0%) 19 (28.4%)
Removed lymph nodes:
mean ± SD 15.0 ±9.4 20.0 ±9.3 <0.001 12.2 ±5.8 18.6 ±9.7 0.04 12.3 ±7.0 18.82 ±9.7 0.007
<12 25 (37.9%) 21 (15.8%) <0.001 3 (50.0%) 43 (22.3%) 0.1 6 (46.2%) 146 (78.5%) 0.04
≥12 41 (62.1%) 112(84.2%) 3 (50.0%) 150 (77.7%) 7 (53.8%) 40 (21.5%)
Positive lymph node:
    Mean (± SD) 2.4 ±3.4 1.4 ±3.7 0.07 0.83 ±0.4 1.7 ±3.6 0.2 2.3 ±3.0 1.7 ±3.6 0.9
    Presence 30 (45.5%) 34 (25.6%) 0.003 5 (83.3%) 59 (30.6%) 0.01 7 (53.8%) 57 (30.6%) 0.08
    Absence 36 (54.4%) 99 (74.4%) 1 (16.7%) 134 (69.4%) 6 (46.2%) 129 (69.4%)
Lymph node ratio, mean ± SD 0.3 ±0.5 0.1 ±0.1 <0.001 0.4 ±0.46 0.2 ±0.4 0.1 0.3 ±0.4 0.2 ±0.4 0.1
Disease stages
I-II 26 (33.8%) 58(43.6%) 0.04 1 (16.7%) 83 (40.7%) 0.1 5 (33.3%) 79 (40.5%) 0.3
III-IV 51 (66.2%) 75 (56.4%) 5 (83.3%) 121 (59.3%) 10 (66.7%) 116 (59.5%)
BRAF mutation: - - - - - - - - -
Phenotype MSI:
MSI 2 (5.1%) 15 (19.2%) 0.03 0 (0.0%) 17 (14.7%) 0.6 0 (0.0%) 17 (15.5%) 0.3
MSS 37 (94.9%) 63 (80.8%) 1 (100.0%) 99 (85.3%) 7 (100.0%) 93 (84.5%)
    Follow-up time (months)
Mean SD ± 41.4 ±35.3 49.8 ±33.8 0.09 44.5 ±27.0 46.8 ±34.7 0.6 38.1 ±30.7 47.7 ±34.7 0.2
Recurrence
(+) 37 (48.1%) 38 (28.6%) 0.02 2 (33.3%) 36 (28.3%) 0.5 7(46.7%) 68 (34.9%) 0.2
(−)
40 (51.9%) 95 (71.4%) 4 (66.7%) 91 (71.7%) 8 (53.3%) 127 (65.1%)
Mortality
Death cases 26 (34.2%) 27 (20.3%) 0.02 1(16.7%) 73 (35.8%) 0.6 3 (20.0%) 50 (25.8%) 0.4
Censored cases 50 (65.8%) 106(79.7%) 5 (83.3%) 131(64.2%) 12 (80.0%) 144 (74.2%)

We then looked at the associations between rare mutations (exons 3 and 4 in KRAS gene and exons 2, 3 and 4 of NRAS gene) and patients’ clinicopathological characteristics (Table 4). Rare RAS-mutated tumors compared with WT tumors, were more frequently moderately differentiated (86, 7% versus 44, 1%, P = 0.003) and was associated with lower total lymph node rate (P = 0.007). In addition, 53.8% of these tumors have more than 12 lymph nodes removed, compared with 21.5% in RAS wild-type tumors (P = 0.04). Furthermore, Rare KRAS and NRAS mutations were detected more frequent in left colon with a difference close to significance (P = 0.06).

Association between KRAS exon 2 mutation subtypes and clinicopathological features

A summary of the main clinicopathological features of KRAS codon 12 mutants and KRAS codon 13 mutants compared to RAS wild-Type colon cancer is shown in Table 7. In the majority of cases KRAS codon 12 mutated tumors were associated with female gender (P = 0.01), classical adenocarcinoma (P = 0.02), advanced TNM stage (P = 0.04) and presence of positive lymph node (P = 0.004). KRAS codon 12 mutated colon cancers were also associated with a significantly lower total LN count (P <0.001), and 63.6% of patients in this subgroup have more than 12 lymph nodes examined, compared with 80.6% in the KRAS codon12-wild- type patients (P = 0.01). While, lymph node metastasis (P = 0.02) and LNR (P <0:001) rate was significantly higher in KRAS codon 12 mutated tumors. Interestingly, KRAS codon 12 mutations were correlated with a higher recurrence rate (P = 0.02). Tumors with KRAS codon 13 mutants, in comparison with RAS wild-type colon cancers were more likely to exhibit lower total LN rate (P = 0.05), and the majority of LN were significantly less than 12 (P = 0.05). Moreover, KRAS codon 13 mutants tumors were correlated with a higher risk of death (P = 0.003) Table 6.

Table 7. KRAS exon 2 mutation subtypes and clinicopathological features.

Characteristics KRAS codon 12 mutant KRAS codon 12 wild type p Kras codon 13 mutants KRAS codon 13 wild type p KRAS codon 12 mutants KRAS codon 13 mutants p
Age
Mean ((±SD) 57.2 ± 14.0 55.0 ±15.1 0.3 57.3±20.1 55.4±14.3 0.6 57.2 ± 14.0 57.3±20.1 0.9
≤55 22 (42.3%) 70 (44.3%) 0.4 6 (37.5%) 86 (44.3%) 0.1 22 (42.3%) 6 (37.5%) 0.2
>55 30 (57.7% 88 (55.7%) 10 (62.5%) 108 (55.7%) 30 (57.7%) 10 (62.5%)
Gender
Female 31(59.6%) 66 (41.8%) 0.01 10 (62.5%) 87 (44.8%) 0.08 31(59.6%) 10 (62.5%) 0.2
Male 21(40.4%) 92 (58.2%) 6 (37.5%) 107 (55.2%) 21(40.4%) 6 (37.5%)
Tumor site
Right colon 14 (26.9%) 53(33.5%) 0.2 3 (18.8%) 64 (33.0%) 0.1 14 (26.9%) 3 (18.8%) 0.09
Left colon 38(73.1%) 105(66.5%) 13 (81.3%) 130 (67.0%) 38(73.1%) 13 (81.3%)
Histologic subtype
Adenocarcinoma 43 (82.7%) 133(84.2%) 0.02 14(87.5%) 158 (81.4%) 0.1 43 (82.7%) 14(87.5%) 0.1
Mucinous adenocarcinoma 7 (13.5%) 15 (9.5%) 2(12.5%) 24 (12.4%) 7 (13.5%) 2(12.5%)
Others 2 (3.8%) 10 (6.3%) 0 (0.0%) 12 (6.2%) 2 (3.8%) 0 (0.0%)
Histologic grade
Well 24 (46.2%) 68 (43.0%) 0.8 8(50.0%) 84 (43.3%) 0.1 24 (46.2%) 8(50.0%) 0.1
Moderate 24 (46.2%) 75 (47.5%) 8 (50.0%) 91 (46.9%) 24 (46.2%) 8 (50.0%)
Poor 4 (7.7%) 15 (9.5%) 0 (0.0%) 19 (9.8%) 4 (7.7%) 0 (0.0%)
Vascular invasion
Presence 15 (28.8%) 22 (13.9%) 0.01 3 (18.8%) 34 (17.5%) 0.1 8 (16.3%) 2 (12.5%) 0.1
Absence 37 (71.2%) 136(86.1%) 13(81.3%) 160 (82.5%) 41 (83.7%) 14 (87.5%)
Perineural invasion
Presence 7 (14.3%) 15 (9.6%) 0.2 0 (0.0%) 26 (13.4%) 0.1 7 (14.3%) 0 (0.0%) 0.1
Absence 42 (85.7%) 142(90.4%) 16 (100.0%) 168 (86.6%) 42 (85.7%) 16 (100.0%)
Distant metastases (M)
M0 29 (55.8%) 98 (62.0%) 0.2 8 (50.0%) 119 (61.3%) 0.1 29 (55.8%) 8 (50.0%) 0.2
M1 23 (44.2%) 60 (38.0%) 8 (50.0%) 75 (38.7%) 23 (44.2% 8 (50.0%)
Number of metastases:
1 15 (71.4%) 36 (70.6%) 0.5 2 (33.3%) 49 (73.1%) 0.1 15 (71.4%) 2 (33.3%) 0.08
≥2 6 (28.6%) 15 (29.4%) 4 (66.7%) 18 (26.9%) 6 (28.6%) 4 (66.7%)
Removed lymph nodes:
mean ± SD 15.6±10.1 20.4 ±9.3 <0.001 14.6 ±7.9 18.7 ±9.7 0.05 15.6±10.1 14.6 ±7.9 0.7
<12 16 (36.4%) 30 (19.4%) 0.01 6 (40.0%) 40(21.7%) 0.05 16 (36.4%) 6 (40.0%) 0.2
    ≥12 28 (63.6%) 125(80.6%) 9 (60.0%) 144 (78.3%) 28 (63.6%) 9 (60.0%)
Positive lymph node:
    Mean (± SD) 2.9 ±3.7 1.4 ±3.5 0.02 1.3 ±2.4 1.7 ±3.7 0.5 2.9 ±3.7 1.3 ±2.4 0.01
    Presence 22 (50.0%) 42 (27.1%) 0.004 6 (40.0%) 58 (31.5%) 0.1 22 (50.0%) 6 (40.0%) 0.1
    Absence 22 (50.0%) 113(72.9%) 9 (60.0%) 126 (68.5%) 22 (50.0%) 9 (60.0%)
Lymph node ratio, mean ± SD 0.4±0.6 0.1 ±0.2 <0.001 0.2 ±0.3 0.1 ±0.4 0.9 0.4±0.6 0.2 ±0.3 0.02
Disease stages
I-II 15 (28.8%) 69 (43.7%) 0.04 7 (43.8%) 77 (39.7%) 0.1 15 (28.8%) 7 (43.8%) 0.2
III-IV 37 (71.2%) 89 (56.3%) 9 (56.3%) 117 (60.3%) 37 (71.2%) 9 (56.3%)
BRAF mutation: - - - - - - - - -
Phenotype MSI:
MSI 2 (8.0%) 15 (16.3%) 0.2 0 (0.0%) 17 (15.6%) 0.2
MSS 23 (92.0%) 77 (83.7%) 8 (100.0%) 92 (84.4%)
    Follow-up time (months)
Mean SD ± 46.6 ±37.8 46.7 ±33.5 0.9 29.0 ±23.3 48.0 ±34.9 0.006 46.6 ±37.8 29.0 ±23.3 <0.001
Recurrence
(+) 25 (48.1%) 50 (31.6%) 0.02 7 (43.8%) 68(35.1%) 0.1 25 (48.1%) 7 (43.8%) 0.2
(−) 27 (51.9%) 108(68.4%) 9 (56.3%) 126 (64.9%) 27 (51.9%) 9 (56.3%)
Mortality
Death cases 15 (28.8%) 38 (24.1%) 0.2 9(56.3%) 44(22.8%) 0.003 15 (28.8%) 9(56.3%) 0.03
Censored cases 37 (71.2%) 120(75.9%) 7 (43.8%) 149 (77.2%) 37 (71.2%) 7 (43.8%)

When comparing the different KRAS exon 2 mutation (codon 12 versus codon 13) groups to each other, we found that KRAS codon 13-mutated tumors were significantly correlated with a higher death cases number (P = 0.03) and lower follow-up time (p = 0.03), lower rate of positive lymph node and lower rate of LNR. Although, it did not reach the statistical significance, KRAS codon 13 mutated tumors tended to be located in the left colon (P = 0.09) and to have more than 1 metastasis site (P = 0.08) compared to the same features in KRAS codon 12 mutated tumors.

Prognostic significance of genetic alterations

Follow up data from all 210 CC patients were included in the survival analysis. The median length of the follow-up period was 34.00 months (range 3–132 months), and there were 53 CC-related deaths. The Kaplan–Meier analysis revealed that RAS mutant patients exhibited the shortest OS compared with RAS wild-type patients (78.18 vs. 104.29, P = 0.006). When assessing the prognostic value of RAS genes (KRAS and NRAS), we found that KRAS mutant patients had a strong association with poorer OS compared to RAS-WT patients (76.81 vs 104.14, P = 0.003). Although, NRAS mutations, and rare mutations did not show any association with the patients’ OS (P = 0.6, and P = 0.8).

We also evaluated OS by KRAS exon 2 mutation subtypes, and we compared survival among three groups: codon12/13 WT CC, codon 12 mutant CC, and codon 13 mutant CC. Among these three groups, OS was significantly poorer for codon 13 mutant CC patients than codon 12 mutant and codon12/13 WT CC patients (P <0.001). We documented that the codon12/13 WT status was the better predictor of prognosis. The correlation between OS and clinicopathological features was also investigated in this study. The variables including absence of distant metastases (P = 0.001), positive vascular invasion (P = 0.02), number of removed lymph node (≥12) (P = 0.01), absence of positive LN (P = 0.04), stage I-II disease (P = 0.002), and MSI phenotype (P = 0.001) revealed higher rate of OS in colon patients. The results of OS analysis are compiled in Table 8. By using Cox proportional hazards model, number of metastases (≥2), III-IV disease stage, and MSS phenotype were the independent poor prognostic factors for OS in colon cancer. However, codon12/13 WT subgroup was the better predictor factor of prognosis in CC Table 8.

Table 8. The molecular and clinical variables associated with overall survivals in the 210 colon cancer.

Variables Univariate analysis Multivariate analysis
Mean OS months (95% CI) P value Hazard ratio (95% CI) P value
Age (yr)
    ≥55 95.52(84.85–106.18) 0.9
    <55 96.03(83.19–108.88)
Gender
    Female 91.84 (78.98–104.70) 0.4
    Male 98.09 (87.26–108.92)
Tumor site
    Right side 93.75 (79.58–107.92) 0.8
    Left side 90.34 (81.79–98.90)
Histologic subtype
Adenocarcinoma 95.42 (86.08–104.76) 0. 3
Mucinous adenocarcinoma 94.11 (74.50–113.73)
Others 61.33 (37.33–85.33)
Histologic grad
    Well 96.23 (84.53–107.94) 0.6
    Moderate 96.65 (84.05–109.25)
    Poor 73.45 (51.38–95.52)
Distant metastases
    M0 105.10 (96.10–114.10) 0.001 0.34 (0.61–2.77) 0.4
    M1 75.33 (59.12–91.54)
Number of metastases:
1 50.12 (34.71–65.54) 0.1 1.26 (0.05–1.05) 0.05
≥2 84.45 (56.81–112.09)
Tumor stage
    I-II 109.41(99.52–119.51) 0.002 1.98 (0.00–0.21) 0.003
    III-IV 84.63 (72.57–96.69)
TLN
≥12 102.26 (93.41–111.10) 0.01 0.66 (0.29–3.32) 0.9
<12 72.51 (57.02–88.01)
Positive LN
    Presence 80.54 (66.88–94.19) 0.04 0.31 (0.46–4.15) 0.5
    Absence 102.09 (92.71–111.47
Perineural invasion
    Yes 91.56 (77.95–105.18) 0.2
    No 94.97 (86.34–103.60)
Vascular invasion
    Yes 102.23 (90.81–113.66) 0.02 1.93 (0.20–20.78) 0.5
    No 92.25 (83.25–101.25)
MSI status 0.05
    MSI 109.71 (99.85–119.58) 0.001 0.11 (0.06–1.04)
    MSS 74.08 (68.00–80.16)
Full RAS status 104.29 (94.35–114.02) 0.006
    Wild-type 0.33 (0.00–4.50) 0.9
    Mutant 78.18 (65.84–90.52)
KRAS status
    Wild-type 104.14 (94.48–113.80) 0.003
    Mutant 76.81 (63.89–89.74) 0.29 (0.00–3.01) 0.9
NRAS status
    Wild-type 95.68 (87.36–104.01) 0.6
    Mutant 73.00 (48.99–97.00)
KRAS exons 2 codon:
    codon 12/13 WT 103.75 (94.32–113.17) <0.001
    codon 12 mutant 84.56 (69.29–99.82) 0.35 (0.82–14.08) 0.01
    codon 13 mutant 40.64 (23.02–58.27)

Discussion

KRAS and NRAS genes are a well-known driver oncogene in CRCs, and the presence of KRAS or NRAS mutation predicts poor response to anti-EGFR targeted therapy [8]. To our knowledge, this study is one of the first to evaluate the frequencies and clinicopathological significance of KRAS and NRAS mutations, and to analyze the prognostic impact of KRAS and NRAS mutations in patients with locally and advanced CC in the Moroccan population and the Middle East and Nord Africa region.

In this study, mutation rates of RAS, KRAS, NRAS, and BRAF genes were 39.5%, 36.7%, 2.9% %, and 0.0%, respectively. KRAS mutations were seen mainly in exon 2 (codon 12/13) (88.3% of all KRAS mutations). The frequency of KRAS mutations in this cohort is in accordance with that in previous reports, which reported that approximately 34~45% of the patients had KRAS mutations [16,17].While, the rate of RAS, BRAF and KRAS exon 2 mutations was slightly lower than that in two recently published studies [12,15]. Previous studies have reported that the most common KRAS mutation types are p.Gly12Asp, p.Gly12Val and p.Gly13Asp. In our cohort, the most common single mutation identified was a G>A transition (c.35G>A, p.G12D) in codon 12 of exon 2 (27.9%), followed by the G12V mutation (25.0%), this finding is generally consistent with data found in the literature [18,19]. Furthermore, our findings revealed a lower rate of p.G13D (c.38 G>A) mutation in codon 13 (19.1%) compared to the rate of G12D and G12V mutations in codon 12. This result is in agreement with that reported by NIU et al [20] and Omidifar et al [21].

We detected 7.14% of rare mutations (KRAS exons 3 and 4 and NRAS exons 2, 3, and 4) in this study. These mutations were distributed between KRAS exon 3 mutants (0.5%), KRAS exon 4 mutants (2.4%), and NRAS mutants (exons 2 and 3) (2.9%), we did not find any NRAS mutation in exon 4. The prevalence of rare mutations in our cohort is higher than that reported by Rimbert et al recently (15) and other studies [17,22]. There are some explanations for this difference. First, we enrolled both the locally and advanced CC patients, second, we analyzed the RAS status using Pyrosequencing technology, which is considered to show higher sensitivity (5%) than that of other testing methods. A study conducted by Tougeron et al [23], demonstrated that Pyrosequencing detected 17.9% of the KRAS mutations in patients with KRAS wild-type using direct sequencing alone.

NRAS mutations were identified in 6 (2.9%) out of 210 tumor samples. This incidence is in concordance with what was reported in previously published data, which concluded that NRAS mutations occur in 2–7% of cases [8,24]. The mutation frequency of NRAS exon 3 (4, 2.0%) was higher than in NRAS exon 2 (2, 1.0%). These findings are similar to Guo’s study of 353 Chinese colorectal cancer patients [25]. NRAS mutations can coexist with KRAS mutations [26], in our analysis; we did not find any case with simultaneous mutations. In our study, from 200 patients, we did not find any BRAF mutation. This result confirms the rarity of the V600E mutation in colon cancer, epically in the Moroccan population [27].

This study demonstrates that RAS and KRAS mutant status underline special clinicopathological and molecular features. As reported in some studies [15,28,29], in our context, RAS mutated CC was associated with female gender, distal colon, classical adenocarcinoma subtype, moderately differentiated tumors, and presence of vascular invasion. Interestingly, our study demonstrated that CC with RAS and epically KRAS mutations show a lower rate of the total lymph node. Recently, NOGUERA et al [29] found the same observation, but the difference was not statistically significant. Besides, patients with KRAS mutations showed a significantly higher rate of positive lymph nodes. This finding is in line with the results reported by Mannan et Hahn-Stro [30] and an earlier study by Oliveira et al [31]. In the Chinese group, previous reports suggest that KRAS mutated CCs have no specific trend in lymph node metastasis [32].

Regarding the correlation between KRAS mutations and tumor site, there is some dissimilarity in the literature. Some studies have shown that KRAS mutations occur more frequently in the right colon [32,33]. In contrast and similar to our analysis, Kawazoe et al [17] demonstrate that distal colon harbors more KRAS mutations. In the same way, some studies [15,34] have shown that KRAS mutations tended to occur more frequently in classical adenocarcinoma tumors as reported in our study. However, other has observed an increased tendency of these mutations in the mucinous adenocarcinoma subtype [32]. Significance association between KRAS mutations and advanced TNM stage was also observed in our study, which further supports previous findings [30]. Although, Zhang et al [32] did not find any association.

Interestingly, we documented a positive relationship between KRAS mutated CC and microsatellite stability phenotype, which is consistent with findings reported by Rimbert et al [15,35]. There was no significant association between age and KRAS mutations in our analysis, which is similar to previous studies [17,32].

In this study, we also compared the clinicopathological features between codon 12 CC and codon 13-mutated CC. As a point of interest, the result indicates that codon 13 gene mutation was associated with a higher number of death cases, a lower rate of positive lymph node, and a lower rate of LNR. These findings suggest that tumors with codon 13 mutations are more aggressive than in codon 12. Recently, the molecular epidemiological study conducted by Gonsalves et al [36] has shown that KRAS codon 13 mutations were associated with deficient mismatch repair phenotype and poor differentiation. These parameters were reported to be predictors of worse OS [37]. These results may explain the worse survival observed in patients with codon 13 mutations CC, as reported by Modest et al [38]. However, Mannan et al [39] reported have that KRAS codon 12-mutated CC is more aggressive than codon 13-mutated CC because they were associated with factors of poor prognosis like advanced tumor staging (p = 0.02) and nodular metastasis (p = 0.04).

Another remarkable investigation in this study is the correlation between a patient’s clinicopathological features and rare KRAS and NRAS mutations (KRAS exons 3 and 4 and NRAS mutations). We documented that, in comparison with wild-type tumors, rare mutations tumors were more likely to exhibit moderate differentiation, lower lymph node rate, and lower incidence of ≥12 lymph nodes. Moreover, RAS rare-mutated tumors tended to be associated with the left tumor site (P = 0.08) and higher lymph node metastasis rate (P = 0.08) with a difference close to significance. To the best of our knowledge, we are the first to illustrate the clinicopathological and survival differences between rare RAS mutated CC and wild-type CC in the Middle East and Nord Africa (MENA) region. While the publication of the Molecular Cancer Genetics Platform of Poitiers (French National Cancer Institute (INC)) was the first world-wild detailed report concerning the association between clinicopathological features and rare mutation status. The investigators of this study [15] have demonstrated that KRAS exon 3-mutated CC and KRAS exon 4-mutated CC were both associated with mucinous histological subtypes. Additionally, KRAS exon 3-mutated CC tended to be correlated with the rectal tumor site.

Finally, we found that in comparison with wild-type RAS status, NRAS mutated status was significantly associated with a lower lymph node rate and a higher lymph node metastasis rate. A recent Chinese study on Chinese patients showed that NRAS mutations occurred more frequently in female patients [25]. Others report did not find any correlations between NRAS mutations and clinicopathological characteristics [15,32]. This discrepancy of results may be attributed to the sampling size included in each study, the rarity of NRAS mutations in CC, and few available data concerning the association between NRAS mutations and clinicopathological features.

Regarding our second objective, our analysis is the first to evaluate the relationship between KRAS and NRAS mutations and clinical outcome in CC patients, in the Middle East and North Africa region. We found that KRAS and NRAS mutations appear to have worse OS in comparison to RAS wild-type in CC patients at all stages. The same results were reported by Yaeger et al [40] in 2015. We also demonstrated that KRAS mutations exhibit similar behavior to full RAS mutations concerning OS, while KRAS wt patients show an improved OS. In the literature, the prognostic role of KRAS mutations as a global prognostic biomarker factor of OS remains controversial. Several studies have reported a statistically significant reduction of OS in the presence of KRAS mutations [41–43] as reported in our analysis. In contrast, Ogino et al [44] did not identify a relevant prognostic role of KRAS mutations in patients with CC. Furthermore, no association between KRAS mutations and survival was found in the PETACC-3 trial among 1404 colon cancer patients [45].

In our study, we epically determined and compared the impact on OS between three groups of tumors: tumors with KRAS codon 13 mutations, tumors with KRAS codon 12 mutations, and KRAS codon 12/13 wild type tumors. We documented that tumors carried KRAS codon 13 mutations show the poorer and adverse OS as compared to those with KRAS codon 12 mutations. Although, KRAS codon 12/13 wild-type tumors had shown better OS between the three groups (P<0.001). In the literature, a few subsequent clinical studies and meta-analyses have been conducted on CRC patients for this issue [46,47]. Recently, Kwak and colleagues have illustrated in a systematic review that KRAScodon13 gene mutation appears to have worse OS in comparison to KRAS wild-type in CRC patients but shows similar clinical outcomes to codon 12 gene mutations [48]. In contrast, Imamura et al and Taieb et al [49] showed that KRAS codon 12 mutations are associated with inferior survival in comparison with mutations at codon 13 [50]. NRAS mutations seemed to have any clinical impact on OS in our cohort. Considering we found only 6 patients harboring NRAS mutations, this finding does not yet allow us to draw a firm conclusion of the prognostic value of NRAS status. Recent clinical studies were also limited by a small number of NRAS-mutant cases to establish their clinical effects on survival [51]. In contrast, a case series from Italy of mCRC patients that included 47 cases with NRAS mutant disease found a significant correlation between NRAS mutation and shorter OS compared with wild-type cases [52]. Additionally, Wang et al documented that in a retrospective analysis of stage I–IV colorectal cancers, the presence of an NRAS mutation was associated with significantly shorter survival [53].

Conclusion

Our study demonstrates that KRAS and NRAS mutations occur respectively in 36.7% and 2.9% of our patients. Our findings show that KRAS and NRAS mutations especially KRAS mutations have distinct clinicopathological features (tumor site, MSS status, positive lymph node…). Among KRAS and NRAS mutations, the KRAS codon 13-mutated status was the worst predictor of prognosis at all stages in our population.

Data Availability

All relevant data are within the paper.

Funding Statement

The authors received no specific funding for this work.

References

  • 1.Colussi D, Brandi G, Bazzoli F, Ricciardiello L. Molecular pathways involved in colorectal cancer: implications for disease behavior and prevention. Int J Mol Sci. 2013;14(8):16365–85. 10.3390/ijms140816365 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Yoon HH, Tougeron D, Shi Q, Alberts SR, Mahoney MR, Nelson GD, et al. KRAS codon 12 and 13 mutations in relation to disease-free survival in BRAF-wild-type stage III colon cancers from an adjuvant chemotherapy trial (N0147 alliance). Clin Cancer Res. 1 Juin 2014;20(11):3033–43. 10.1158/1078-0432.CCR-13-3140 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Li W, Zhu T, Guan KL. Transformation potential of Ras isoforms correlates with activation of phosphatidylinositol 3-kinase but not ERK. J Biol Chem. 2004;279(36):37398–406. 10.1074/jbc.M405730200 [DOI] [PubMed] [Google Scholar]
  • 4.Ebi H, Corcoran RB, Singh A, Chen Z, Song Y, Lifshits E, et al. Receptor tyrosine kinases exert dominant control over PI3K signaling in human KRAS mutant colorectal cancers. J Clin Invest. 2011;121(11):4311–21. 10.1172/JCI57909 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Barbie DA, Tamayo P, Boehm JS, Kim SY, Susan E, Dunn IF, et al. Processing-a-Programming-Handbook-for-Visual-Designers-and-Artists.Pdf. 2010;462(7269):108–12. [Google Scholar]
  • 6.Rodriguez-Salas N, Dominguez G, Barderas R, Mendiola M, García-Albéniz X, Maurel J, et al. Clinical relevance of colorectal cancer molecular subtypes. Crit Rev Oncol Hematol. 2017;109:9–19. 10.1016/j.critrevonc.2016.11.007 [DOI] [PubMed] [Google Scholar]
  • 7.Petrelli F, Coinu A, Cabiddu M, Ghilardi M, Barni S. KRAS as prognostic biomarker in metastatic colorectal cancer patients treated with bevacizumab: A pooled analysis of 12 published trials. Med Oncol. 2013;30(3):4–11. 10.1007/s12032-013-0650-4 [DOI] [PubMed] [Google Scholar]
  • 8.Douillard J-Y, Oliner KS, Siena S, Tabernero J, Burkes R, Barugel M, et al. Panitumumab–FOLFOX4 Treatment and RAS Mutations in Colorectal Cancer. N Engl J Med. 2013;369(11):1023–34. 10.1056/NEJMoa1305275 [DOI] [PubMed] [Google Scholar]
  • 9.Rosty C, Young JP, Walsh MD, Clendenning M, Walters RJ, Pearson S, et al. Colorectal carcinomas with KRAS mutation are associated with distinctive morphological and molecular features. Mod Pathol. juin 2013;26(6):825–34. 10.1038/modpathol.2012.240 [DOI] [PubMed] [Google Scholar]
  • 10.koochak A, Rakhshani N, Niya MHK, Tameshkel FS, Sohrabi MR, Babaee MR, et al. Mutation Analysis of KRAS and BRAF Genes in Metastatic Colorectal Cancer: a First Large Scale Study from Iran. Asian Pac J Cancer Prev. 2016;17(2):603–8. 10.7314/apjcp.2016.17.2.603 [DOI] [PubMed] [Google Scholar]
  • 11.Li W, Zhu T, Guan K-L. Withdrawal: Transformation potential of Ras isoforms correlates with activation of phosphatidylinositol 3-kinase but not ERK. J Biol Chem. 17 Mai 2019;294(20):8310. 10.1074/jbc.W119.009032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Conlin A, Smith G, Carey FA, Wolf CR, Steele RJC. The prognostic significance of K-ras, p53, and APC mutations in colorectal carcinoma. Gut. 2005;54(9):1283–6. 10.1136/gut.2005.066514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Andersen SN, Løvig T, Breivik J, Lund E, Gaudernack G, Meling GI, et al. K-ras Mutations and Prognosis in Large-Bowel Carcinomas. Scand J Gastroenterol. 1 Janv 1997;32(1):62–9. 10.3109/00365529709025065 [DOI] [PubMed] [Google Scholar]
  • 14.Hsieh L-L, Er T-K, Chen C-C, Hsieh J-S, Chang J-G, Liu T-C. Characteristics and prevalence of KRAS, BRAF, and PIK3CA mutations in colorectal cancer by high-resolution melting analysis in Taiwanese population. Clin Chim Acta. 9 October 2012;413(19):1605–11. [DOI] [PubMed] [Google Scholar]
  • 15.Rimbert J, Tachon G, Junca A, Villalva C, Karayan-tapon L, Tougeron D. Association between clinicopathological characteristics and RAS mutation in colorectal cancer. 2017;1–10. 10.1038/modpathol.2017.119 [DOI] [PubMed] [Google Scholar]
  • 16.Neumann J, Wehweck L, Maatz S, Engel J, Kirchner T, Jung A. Alterations in the EGFR pathway coincide in colorectal cancer and impact on prognosis. Virchows Arch Int J Pathol. oct 2013;463(4):509–23. 10.1007/s00428-013-1450-0 [DOI] [PubMed] [Google Scholar]
  • 17.Kawazoe A, Shitara K, Fukuoka S, Kuboki Y, Bando H, Okamoto W, et al. A retrospective observational study of clinicopathological features of KRAS, NRAS, BRAF and PIK3CA mutations in Japanese patients with metastatic colorectal cancer. BMC Cancer. 11 Avr 2015;15:258. 10.1186/s12885-015-1276-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gil Ferreira C, Aran V, Zalcberg-Renault I, Victorino AP, Salem JH, Bonamino MH, et al. KRAS mutations: variable incidences in a Brazilian cohort of 8,234 metastatic colorectal cancer patients. BMC Gastroenterol. 10 Avr 2014;14:73. 10.1186/1471-230X-14-73 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ye J-X, Liu Y, Qin Y, Zhong H-H, Yi W-N, Shi X-Y. KRAS and BRAF gene mutations and DNA mismatch repair status in Chinese colorectal carcinoma patients. World J Gastroenterol WJG. 7 Févr 2015;21(5):1595–605. 10.3748/wjg.v21.i5.1595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Niu W, Wang G, Feng J, Li Z, Li C, Shan B. Correlation between microsatellite instability and RAS gene mutation and stage III colorectal cancer. Oncol Lett. janv 2019;17(1):332–8. 10.3892/ol.2018.9611 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Omidifar N, Geramizadeh B, Mirzai M. K-ras Mutation in Colorectal Cancer, A Report from Southern Iran. Iran J Med Sci. September 2015;40(5):454–60. [PMC free article] [PubMed] [Google Scholar]
  • 22.Koochak A, Rakhshani N, Karbalaie Niya MH, Tameshkel FS, Sohrabi MR, Babaee MR, et al. Mutation Analysis of KRAS and BRAF Genes in Metastatic Colorectal Cancer: a First Large Scale Study from Iran. Asian Pac J Cancer Prev APJCP. 2016;17(2):603–8. 10.7314/apjcp.2016.17.2.603 [DOI] [PubMed] [Google Scholar]
  • 23.Tougeron D, Lecomte T, Pagès JC, Villalva C, Collin C, Ferru A, et al. Effect of low-frequency KRAS mutations on the response to anti-EGFR therapy in metastatic colorectal cancer. Ann Oncol Off J Eur Soc Med Oncol. Mai 2013;24(5):1267–73. 10.1093/annonc/mds620 [DOI] [PubMed] [Google Scholar]
  • 24.De Roock W, Claes B, Bernasconi D, De Schutter J, Biesmans B, Fountzilas G, et al. Effects of KRAS, BRAF, NRAS, and PIK3CA mutations on the efficacy of cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal cancer: a retrospective consortium analysis. Lancet Oncol. Août 2010;11(8):753–62. 10.1016/S1470-2045(10)70130-3 [DOI] [PubMed] [Google Scholar]
  • 25.Guo F, Gong H, Zhao H, Chen J, Zhang Y, Zhang L, et al. Mutation status and prognostic values of KRAS, NRAS, BRAF and PIK3CA in 353 Chinese colorectal cancer patients. Sci Rep. 17 Avr 2018;8(1):1–11. 10.1038/s41598-017-17765-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Jeantet M, Tougeron D, Tachon G, Cortes U, Archambaut C, Fromont G, et al. High Intra- and Inter-Tumoral Heterogeneity of RAS Mutations in Colorectal Cancer. Int J Mol Sci. Déc 2016;17(12):2015. 10.3390/ijms17122015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Barras D, Missiaglia E, Wirapati P, Sieber OM, Robert N, Love C, et al. BRAF V600E mutant colorectal cancer subtypes based on gene expression. 2016. 10.1158/1078-0432.CCR-16-0140 [DOI] [PubMed] [Google Scholar]
  • 28.Li W, Li H, Liu R, Yang X, Gao Y, Niu Y, et al. Comprehensive Analysis of the Relationship Between RAS and RAF Mutations and MSI Status of Colorectal Cancer in Northeastern China. Cell Physiol Biochem. 2018;50(4):1496–509. 10.1159/000494649 [DOI] [PubMed] [Google Scholar]
  • 29.Garde Noguera J, Jantus-Lewintre E, Gil-Raga M, Evgenyeva E, Maciá Escalante S, Llombart-Cussac A, et al. Role of RAS mutation status as a prognostic factor for patients with advanced colorectal cancer treated with first-line chemotherapy based on fluoropyrimidines and oxaliplatin, with or without bevavizumab: A retrospective analysis. Mol Clin Oncol. Mars 2017;6(3):403–8. 10.3892/mco.2017.1149 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mannan A, Hahn-Strömberg V. K-ras mutations are correlated to lymph node metastasis and tumor stage, but not to the growth pattern of colon carcinoma. APMIS Acta Pathol Microbiol Immunol Scand. Juin 2012;120(6):459–68. [DOI] [PubMed] [Google Scholar]
  • 31.Oliveira C, Velho S, Moutinho C, Ferreira A, Preto A, Domingo E, et al. KRAS and BRAF oncogenic mutations in MSS colorectal carcinoma progression. Oncogene. Janv 2007;26(1):158–63. 10.1038/sj.onc.1209758 [DOI] [PubMed] [Google Scholar]
  • 32.Zhang J, Zheng J, Yang Y, Lu J, Gao J, Lu T, et al. Molecular spectrum of KRAS, NRAS, BRAF and PIK3CA mutations in Chinese colorectal cancer patients: analysis of 1,110 cases. Sci Rep [Internet]. 22 Déc 2015. [cité 22 juill 2020];5. Disponible sur: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4687048/. 10.1038/srep18678 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Blons H, Emile JF, Malicot KL, Julié C, Zaanan A, Tabernero J, et al. Prognostic value of KRAS mutations in stage III colon cancer: post hoc analysis of the PETACC8 phase III trial dataset. Ann Oncol. 1 Déc 2014;25(12):2378–85. 10.1093/annonc/mdu464 [DOI] [PubMed] [Google Scholar]
  • 34.Baltruškevičienė E, Mickys U. Significance of KRAS, NRAS, BRAF and PIK3CA mutations in metastatic colorectal cancer patients receiving Bevacizumab: a single institution experience. 2016;23(1):24–34. 10.6001/actamedica.v23i1.3267 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Serebriiskii IG, Connelly C, Frampton G, Newberg J, Cooke M, Miller V, et al. Comprehensive characterization of RAS mutations in colon and rectal cancers in old and young patients. Nat Commun. 19 Août 2019;10(1):1–12. 10.1038/s41467-018-07882-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Gonsalves WI, Mahoney MR, Sargent DJ, Nelson GD, Alberts SR, Sinicrope FA, et al. Patient and Tumor Characteristics and BRAF and KRAS Mutations in Colon Cancer, NCCTG/Alliance N0147. JNCI J Natl Cancer Inst [Internet]. 12 Juin 2014. [cité 23 juill 2020];106(7). Disponible sur: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4110470/. 10.1093/jnci/dju106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.El Agy F, Otmani IE, Mazti A, Lahmidani N, Oussaden A, El Abkari M, et al. Implication of Microsatellite Instability Pathway in Outcome of Colon Cancer in Moroccan Population [Internet]. Vol. 2019, Disease Markers. Hindawi; 2019. [cité 23 juill 2020]. p. e3210710. Disponible sur: https://www.hindawi.com/journals/dm/2019/3210710/. 10.1155/2019/3210710 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Modest DP, Stintzing S, Laubender RP, Neumann J, Jung A, Giessen C, et al. Clinical characterization of patients with metastatic colorectal cancer depending on the KRAS status. Anticancer Drugs. October 2011;22(9):913–918. 10.1097/CAD.0b013e3283493160 [DOI] [PubMed] [Google Scholar]
  • 39.Mannan A, Hahn‐Strömberg V. K-ras mutations are correlated to lymph node metastasis and tumor stage, but not to the growth pattern of colon carcinoma. APMIS. 2012;120(6):459–68. 10.1111/j.1600-0463.2011.02852.x [DOI] [PubMed] [Google Scholar]
  • 40.Yaeger R, Cowell E, Chou JF, Gewirtz AN, Borsu L, Vakiani E, et al. RAS mutations affect pattern of metastatic spread and increase propensity for brain metastasis in colorectal cancer. Cancer. 2015;121(8):1195–203. 10.1002/cncr.29196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Andreyev HJN, Norman AR, Cunningham D, Oates J, Dix BR, Iacopetta BJ, et al. Kirsten ras mutations in patients with colorectal cancer: the ‘RASCAL II’ study. Br J Cancer. Août 2001;85(5):692–6. 10.1054/bjoc.2001.1964 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Pentheroudakis G, Kotoula V, De Roock W, Kouvatseas G, Papakostas P, Makatsoris T, et al. Biomarkers of benefit from cetuximab-based therapy in metastatic colorectal cancer: interaction of EGFR ligand expression with RAS/RAF, PIK3CA genotypes. BMC Cancer. 2 Févr 2013;13(1):49. 10.1186/1471-2407-13-49 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Palomba G, Doneddu V, Cossu A, Paliogiannis P, Manca A, Casula M, et al. Prognostic impact of KRAS, NRAS, BRAF, and PIK3CA mutations in primary colorectal carcinomas: a population-based study. J Transl Med [Internet]. 13 October 2016. [cité 22 juill 2020];14. Disponible sur: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5064898/. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Ogino S, Nosho K, Kirkner GJ, Kawasaki T, Meyerhardt JA, Loda M, et al. CpG island methylator phenotype, microsatellite instability, BRAF mutation and clinical outcome in colon cancer. Gut. Janv 2009;58(1):90–6. 10.1136/gut.2008.155473 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Sinicrope FA, Mahoney MR, Yoon HH, Smyrk TC, Thibodeau SN, Goldberg RM, et al. Analysis of Molecular Markers by Anatomic Tumor Site in Stage III Colon Carcinomas from Adjuvant Chemotherapy Trial NCCTG N0147 (Alliance). Clin Cancer Res Off J Am Assoc Cancer Res. 1 Déc 2015;21(23):5294–304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Reinacher-Schick A, Schulmann K, Modest DP, Bruns N, Graeven U, Jaworska M, et al. Effect of KRAS codon13 mutations in patients with advanced colorectal cancer (advanced CRC) under oxaliplatin containing chemotherapy. Results from a translational study of the AIO colorectal study group. BMC Cancer. 9 Août 2012;12(1):349. 10.1186/1471-2407-12-349 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.J R, G L, J G, X L, Y Z. Is K-ras gene mutation a prognostic factor for colorectal cancer: a systematic review and meta-analysis. Dis Colon Rectum. 1 Août 2012;55(8):913–23. 10.1097/DCR.0b013e318251d8d9 [DOI] [PubMed] [Google Scholar]
  • 48.Kwak MS, Cha JM, Yoon JY, Jeon JW, Shin HP, Chang HJ, et al. Prognostic value of KRAS codon 13 gene mutation for overall survival in colorectal cancer. Medicine (Baltimore). 2017;96(35):e7882. 10.1097/MD.0000000000007882 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Taieb J, Malicot KL, Shi Q, Lorca P, Tabernero J, Mini E, et al. Prognostic Value of BRAF and KRAS Mutations in MSI and MSS Stage III Colon Cancer. 2017;109:1–12. 10.1093/jnci/djw272 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Imamura Y, Morikawa T, Liao X, Lochhead P, Kuchiba A, Yamauchi M, et al. Specific Mutations in KRAS Codons 12 and 13, and Patient Prognosis in 1075 BRAF Wild-Type Colorectal Cancers. Clin Cancer Res. 1 September 2012;18(17):4753–63. 10.1158/1078-0432.CCR-11-3210 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Modest DP, Ricard I, Heinemann V, Hegewisch-Becker S, Schmiegel W, Porschen R, et al. Outcome according to KRAS-, NRAS- and BRAF-mutation as well as KRAS mutation variants: pooled analysis of five randomized trials in metastatic colorectal cancer by the AIO colorectal cancer study group. Ann Oncol. 1 September 2016;27(9):1746–53. 10.1093/annonc/mdw261 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Schirripa M, Cremolini C, Loupakis F, Morvillo M, Bergamo F, Zoratto F, et al. Role of NRAS mutations as prognostic and predictive markers in metastatic colorectal cancer. Int J Cancer. 2015;136(1):83–90. 10.1002/ijc.28955 [DOI] [PubMed] [Google Scholar]
  • 53.Wang Y, Velho S, Vakiani E, Peng S, Bass AJ, Chu GC, et al. Mutant N-RAS Protects Colorectal Cancer Cells from Stress-Induced Apoptosis and Contributes to Cancer Development and Progression. Cancer Discov. 1 Mars 2013;3(3):294–307. 10.1158/2159-8290.CD-12-0198 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Hassan Ashktorab

10 Dec 2020

PONE-D-20-28747

Mutation status and prognostic value of KRAS and NRAS mutations in Moroccan colon cancer patients: a first report.

PLOS ONE

Dear Dr. Fatima

 The reviewers raised major concerns including: How MIS of CRC established, why an unmethylated control used in Pyrosequencing, since the study is not about methylation?

there different NRAS mutations levels. It should be consistence. 

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by 10 weeks. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Hassan Ashktorab

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Our journal requires that methods are described in enough detail to allow suitably skilled investigators to fully replicate your study. If materials, methods, and protocols are well established, authors may cite articles where those protocols are described in detail, but the submission should include sufficient information to be understood independent of these references. Please revise your manuscript so that you methodology for BRAF molecular testing is briefly but sufficiently described.

In addition, please provide the primer sequences for all primers used.

Also, please change p-values of "0.000" to "<0.001" in your tables.

3. Please also provide additional information about the participant recruitment method and the demographic details of your participants. Please ensure you have provided sufficient details to replicate the analyses such as:

a) a description of any inclusion/exclusion criteria that were applied to participant recruitment,

b) a statement as to whether your sample can be considered representative of a larger population, and

c) a description of how participants were recruited.

4. Please provide additional details regarding participant consent.

In the ethics statement in the Methods and online submission information, please ensure that you have specified what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

5. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

In your revised cover letter, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.

We will update your Data Availability statement on your behalf to reflect the information you provide.

6. Thank you for stating the following financial disclosure:

'The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.'

At this time, please address the following queries:

  1. Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution.

  2. State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

  3. If any authors received a salary from any of your funders, please state which authors and which funders.

  4. If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This paper describes RAS mutations in Moroccan CRC patients (210). While the data is sound and confirms previous findings from other populations, this is the first of its kind in Morrocan patients. Changes need to be made to improve the manuscript. The Abstract is too long and the Discussion needs some revision.

Why is it that an unmethylated control used in Purosequencing, this study is not about methylation?

The authors need to explain how was MSI status established, It is NOT i Methods section?

In Methods , they stated they compared stges I-II vs II-IV, I think you mean I-II vs. III-IV, Pease correct.

What is most important is Positive and examined Lymph nodes, NOT harvested/Collected LN. Please adjust write up to show that mutant Kras generally needed LESS LN to be examined to get positve ones.

For NRAS mutations , is it 2-8 or 2-9%, you are putting different numbers in different places?

Would suggest to drop RAS muataions part from text and directly just state KRAS and NRAS.

I tables, please bolden and underline SIGNIFICANT p VALUES.

The paper also uses many unusual abbreviations amd has many typos and grammatical errors. Please review completely.

Reviewer #2: There is a slight redundancy in the Introduction such as “Ras-family G-proteins transduce signals in growth factor signals, such as EGF receptor (EGFR) signaling pathway (1). I suggest you strike out “signals” that appears before “in growth factor”.

The citation numbers need a single space separation from the words. Make space between the last words before cited reference numbers in your text.

Your statement that “KRAS mutations occur in 45% of colorectal cancer (CRC) and NRAS in only 5-8%(6)” should be clarified to indicate whether this is applicable to the Moroccan patients or is referring to the world-wide CRC patients.

-Essentially, the authors of this article are attempting to mimic the work of the French authors in Molecular Cancer Genetics Platform of Poitiers (French), who have published their results about the clinicopathological characteristics of the RAS mutations in a cohort of over 1500 colorectal cancer patients. Was the French study done exclusively with French CRC patients?

-Table 6. Any reason why the multivariate analysis was not done in some of the metastatic tumors in Table 6, where the molecular and clinical variables associated with overall survivals in the 210 colon cancer patients were shown?

-In the body of the text, especially in the Results section, it was quite difficult to follow the different mutational hotspots from gene site to gene site, it would have been better to display the most common types in tabular format for quicker views and understanding of the cardinal gene alterations.

-The impetus to investigate the WT and mutated RAS gene sites was that mutations in KRAS outside exon 2 (KRAS exons 3,4) and in other downstream effectors of the EGFR signaling pathway (like NRAS) were published to be associated with resistance to anti-EGFR monoclonal antibodies that were used as a standard regimen for CRC patients – meaning that the two Anti-EGFR monoclonal antibodies, panitumumab and cetuximab, used to treat CRC patients with KRAS and NRAS mutations, were not effective. Therefore, the policy was to successfully treat CRC patients, the full RAS WT status had to be confirmed in all mCRC patients before initiating treatment. The question is: Does this study conclusively resolve that issue? If so, that must be clearly stated in the manuscript.

-Compared to NRAS wild-type patients, “NRAS-mutated patients seem to be exhibiting lower total lymph node rate, and were associated with higher lymph node metastasis number”. This statement is confusing. It could be revised to make the right statement without seemingly contradicting itself. Among RAS mutations, KRAS codon 13 mutations seemed to have a poor prognostic value, which may negatively impinge on overall survival of all the stages of CRC patients. Is that a correct statement?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Mar 30;16(3):e0248522. doi: 10.1371/journal.pone.0248522.r002

Author response to Decision Letter 0


18 Jan 2021

Journal requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming:

Response: this point has been verified.

2. Our journal requires that methods are described in enough detail to allow suitably skilled investigators to fully replicate your study. If materials, methods, and protocols are well established, authors may cite articles where those protocols are described in detail, but the submission should include sufficient information to be understood independent of these references. Please revise your manuscript so that you methodology for BRAF molecular testing is briefly but sufficiently described.

In addition, please provide the primer sequences for all primers used.

Also, please change p-values of "0.000" to "<0.001" in your tables.

Response: the methodology of BRAF molecular testing has been briefly and sufficiently described “BRAF testing was performed for 200 patients using Sanger sequencing as described previously (KRAS and NRAS mutations testing). Briefly, DNA was amplified by PCR (Master Mix (2X) kits) according to the manufacturer’s protocols and using the following forward primer (5’-ACGAACGAGACTATCCTTTTAC-3’) and reverse primer (5’- CATTGAGTCGTCGTAGAGTCCC -3’). PCR products were purified using ExoSAP® kit according to the manufacturer’s protocols. The purified PCR products were sequenced using the direct sequencing with BigDye Terminator V3.1 Cycle Sequencing Kit (ABI Prism) and analyzed on Applied Biosystems 3500Dx Genetic Analyzer (Applied Biosystems).”

The primer sequences used for PCR have been added in methods section:

Table 1: Primer sequences used for PCR.

Primer name Primer sequence

KRAS-ex 2- F

KRAS-ex 2- R

5’-GGTGGAGTATTTGATAGTGTA- 3’

5’-TGCATATTACTGGTGCAGACC- 3’

KRAS-ex 3- F

KRAS-ex 3- R 5’-AGTAAAAGGTGCACTGTAATAA-3’

5’-ATAATAAGCTGACATTAAGGAG-3’

KRAS-ex 4- F

KRAS-ex 4- R

5’-TGTTACTAATGACTGTGCTATAACTTTT-3’

5’-TATGCTATACTATACTAGGAAATAAAA-3’

NRAS-ex2-F

NRAS-ex2-R 5’-ATGACTGAGTACAAACTGGTGGTGGTTGGAGCA-3’

5’-CACTTTGTAGATGAATATGATCCCACCATAGAG-3’

NRAS-ex3-F

NRAS-ex3-R 5’-GATTCTTACAGAAAACAAGTGGTTA-3’

5’-CATTTGCGGATATTAACCTCTACAG-3’

NRAS-ex4-F

NRAS-ex4-R 5’-GGAGCAGATTAAGCGAG-3’

5’-TCAGCCAAGACCAGACAG-3’

The p-values of "0.000» have been changed to "<0.001" in all tables.

3. Please also provide additional information about the participant recruitment method and the demographic details of your participants. Please ensure you have provided sufficient details to replicate the analyses such as:

a) a description of any inclusion/exclusion criteria that were applied to participant recruitment,

b) a statement as to whether your sample can be considered representative of a larger population, and

c) a description of how participants were recruited.

Response: This point has been addressed in methods section. Medical charts were prospectively and retrospectively reviewed, and patients were recruited using the following selection criterion: (a) patients with histologically confirmed primary adenocarcinoma (b) all cases with pathologic I-IV stage colon cancer, (c) patients with prognostic information and who underwent surgical resection for CC tumor at the surgery department of Hassan II University Hospital. Patients were excluded if their records were incomplete, without histological confirmation of colon adenocarcinoma and if they had rectal cancer. Demographic and clinicopathological information (e.g. age, gender, tumor grade, tumor site histological subtype, disease stage, and numbers of examined regional lymph nodes…) and follow up data, were obtained from the patient’s medical records and pathology reports. Overall survival was defined as the time from the start of diagnosis until death or until the last follow-up.

4. Please provide additional details regarding participant consent.

In the ethics statement in the Methods and online submission information, please ensure that you have specified what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information

Response: This study protocol was reviewed and approved by Hassan II University Hospital Ethics Committee of FEZ, Morocco, under reference no. 13/18. All patients gave written informed consent before the start of the study.

5. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

Response: this point has been addressed. Data Availability Statement: All relevant data are within the Manuscript.

6. Thank you for stating the following financial disclosure:

'The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.'

At this time, please address the following queries:

a. Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution.

b. State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

c. If any authors received a salary from any of your funders, please state which authors and which funders.

d. If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.”

Response: this point has been addressed. Funding: The authors received no specific funding for this work.

Response to review comments:

Reviewer #1:

This paper describes RAS mutations in Moroccan CRC patients (210). While the data is sound and confirms previous findings from other populations, this is the first of its kind in Morrocan patients. Changes need to be made to improve the manuscript. The Abstract is too long and the Discussion needs some revision.

Response: this point has been addressed in the manuscript.

Abstract: This study aimed to estimate the incidence of KRAS, NRAS, and BRAF mutations in the Moroccan population, and investigate the associations of KRAS and NRAS gene mutations with clinicopathological characteristics and their prognosis value. To achieve these objectives, we reviewed medical and pathology reports for 210 patients. RAS testing was investigated by Sanger sequencing and Pyrosequencing technology. BRAF (exon 15) status was analyzed by the Sanger method. The expression of MMR proteins was evaluated by Immunohistochemistry. KRAS and NRAS mutations were found in 36.7% and 2.9% of 210 patients, respectively. KRAS exon 2 mutations were identified in 76.5% of the cases. RAS-mutated colon cancers were significantly associated with female gender, presence of vascular invasion, classical adenocarcinoma, moderately differentiated tumors, advanced TNM stage III-IV, left colon site, higher incidence of distant metastases at the time of diagnostic, microsatellite stable phenotype, lower number of total lymph nodes, and higher means of positive lymph nodes and lymph node ratio. KRAS exon 2-mutated colon cancers, compared with KRAS wild-type colon cancers were associated with the same clinicopathological features of RAS-mutated colon cancers. NRAS-mutated patients were associated with lower total lymph node rate and the presence of positive lymph node. Rare RAS-mutated tumors, compared with wild-type tumors were more frequently moderately differentiated and associated with lower lymph node rate. We found that KRAS codon 13-mutated, tumors compared to codon 12-mutated tumors were significantly correlated with a higher death cases number, a lower rate of positive lymph, lower follow-up time, and poor overall survival. Our findings show that KRAS and NRAS mutations have distinct clinicopathological features. KRAS codon 13-mutated status was the worst predictor of prognosis at all stages in our population.

Why is it that an unmethylated control used in Purosequencing, this study is not about methylation?

Response: this positive control has been designed by the supplier for use in both methylation and PCR testing.

The authors need to explain how was MSI status established, it is NOT in Methods section?

Response: The mismatch repair tumor status (MSS or MSI) was established by immunohistochemistry (IHC) to detect the intact or the loss expression of the MMR proteins (MLH1, PMS2, MSH2, and MSH6). The IHC study was assessed on unstained formalin-fixed paraffin-embedded (FFPE) tumor tissue sections of 4 μm thickness, on the automated immunostainer Ventana Benchmark ULTRA. We have employed monoclonal antibodies specific for each MMR protein, MLH1 (G168-728/CELL MARQUE), MSH2 (G219-1129/CELL MARQUE), MSH6 (44/CELL MARQUE), and PMS2 (MRQ-28/CELL MARQUE). Adjacent normal tissue (lymphocytes or normal glandular cells) was used as an internal control for positive staining.

In Methods, they stated they compared stges I-II vs II-IV, I think you mean I-II vs. III-IV, Pease correct.

Response: This point has been corrected.

Please adjust write up to show that mutant Kras generally needed LESS LN to be examined to get positve ones.

Response: Furthermore the presence of positive lymph node was significantly associated with KRAS mutated tumors.

For NRAS mutations, is it 2-8 or 2-9%, you are putting different numbers in different places?

Response: This point has been corrected in the text; it is 2.9%.

Would suggest to drop RAS muataions part from text and directly just state KRAS and NRAS.

Response: this point has been addressed in the text.

In tables, please bolden and underline SIGNIFICANT p VALUES.

Response: this point has been addressed in all tables

The paper also uses many unusual abbreviations amd has many typos and grammatical errors. Please review completely.

Response: This point has been checked.

Reviewer #2:

There is a slight redundancy in the Introduction such as “Ras-family G-proteins transduce signals in growth factor signals, such as EGF receptor (EGFR) signaling pathway (1). I suggest you strike out “signals” that appears before “in growth factor”.

Response: Ras-family G-proteins transduce in growth factor signals, such as EGF receptor (EGFR) signaling pathway.

The citation numbers need a single space separation from the words. Make space between the last words before cited reference numbers in your text.

Response: this point has been addressed.

Your statement that “KRAS mutations occur in 45% of colorectal cancer (CRC) and NRAS in only 5-8%(6)” should be clarified to indicate whether this is applicable to the Moroccan patients or is referring to the world-wide CRC patients.

Response: Numerous studies have reported that KRAS and NRAS mutations occur respectively in 45% and 5-8% of worldwide colorectal cancer patients (6).

-Essentially, the authors of this article are attempting to mimic the work of the French authors in Molecular Cancer Genetics Platform of Poitiers (French), who have published their results about the clinicopathological characteristics of the RAS mutations in a cohort of over 1500 colorectal cancer patients. Was the French study done exclusively with French CRC patients?

Response: Recently, the Molecular Cancer Genetics Platform of Poitiers (French) has published interesting results about the clinicopathological features of every KRAS and NRAS mutation in a cohort of 1735 French colorectal cancer patients, enrolled from 28 hospital molecular genetics platforms throughout France (15).

-Table 6. Any reason why the multivariate analysis was not done in some of the metastatic tumors in Table 6, where the molecular and clinical variables associated with overall survivals in the 210 colon cancer patients were shown?

Response: The multivariate analysis was performed; we just forgot to present the results in table 6. 0.34 (0.61-2.77) 0.4

-In the body of the text, especially in the Results section, it was quite difficult to follow the different mutational hotspots from gene site to gene site, it would have been better to display the most common types in tabular format for quicker views and understanding of the cardinal gene alterations.

Response: Table 3: Mutational status of patients with CC by genes.

Gene alterations Number (%)

KRAS (n=210) :

Wildtype (n=133)

Mutated (n=77)

66.3%

36.7%

NRAS (n=210) :

Wildtype (n=204)

Mutated (n=6)

97.1%

2.9%

BRAF (n=200) :

Wildtype

Mutated

100%

0%

-The impetus to investigate the WT and mutated RAS gene sites was that mutations in KRAS outside exon 2 (KRAS exons 3,4) and in other downstream effectors of the EGFR signaling pathway (like NRAS) were published to be associated with resistance to anti-EGFR monoclonal antibodies that were used as a standard regimen for CRC patients – meaning that the two Anti-EGFR monoclonal antibodies, panitumumab and cetuximab, used to treat CRC patients with KRAS and NRAS mutations, were not effective. Therefore, the policy was to successfully treat CRC patients, the full RAS WT status had to be confirmed in all mCRC patients before initiating treatment. The question is: Does this study conclusively resolve that issue? If so, that must be clearly stated in the manuscript.

Response: this point has been reported in methods section; Since 2016, we have started testing complete RAS status systematically, for every metastasis colon cancer patient when considered for anti-EGFR therapy.

-Compared to NRAS wild-type patients, “NRAS-mutated patients seem to be exhibiting lower total lymph node rate, and were associated with higher lymph node metastasis number”. This statement is confusing. It could be revised to make the right statement without seemingly contradicting itself.

Response: Compared to NRAS wild- type patients, NRAS-mutated patients, were more likely to exhibit lower total lymph node rate (P=0.04). This subgroup of tumors was also marked by the presence of positive lymph node (83.3%, P=0.01).

-Among RAS mutations, KRAS codon 13 mutations seemed to have a poor prognostic value, which may negatively impinge on overall survival of all the stages of CRC patients. Is that a correct statement?

Response: this statement has been reviewed; KRAS codon 13-mutated status was the worst predictor of prognosis at all stages in our population.

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Hassan Ashktorab

1 Mar 2021

Mutation status and prognostic value of KRAS and NRAS mutations in Moroccan colon cancer patients: a first report.

PONE-D-20-28747R1

Dear Dr. FATIMA EL AGY

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Hassan Ashktorab

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: No

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: This is a much improved manuscript. However, the English grammar issue still persist throughout the manuscript and especially in the Introduction section stating with the first sentence where "in" before the word "transduce" must be taken out. Also, somewhere further down the paragraphs "gander" was used for "gender..

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Acceptance letter

Hassan Ashktorab

9 Mar 2021

PONE-D-20-28747R1

Mutation status and prognostic value of KRAS and NRAS mutations in Moroccan colon cancer patients: a first report

Dear Dr. El agy:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Hassan Ashktorab

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Attachment

    Submitted filename: Response to Reviewers.docx

    Data Availability Statement

    All relevant data are within the paper.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES