Abstract
Objective: To investigate the diagnostic value of miRNA-145 (miR-145) and miRNA-205 (miR-205) in cervical cancer patients. Methods: Cervical tissue samples were collected from 144 patients diagnosed with and suspected to have cervical cancer in our hospital. Confirmed by pathology, 84 samples were obtained from cervical cancer patients and 60 samples were from patients with cervical intraepithelial neoplasia. Meanwhile, 30 patients with cervicitis were also selected, and the expression levels of miR-145, miR-205 and human papillomavirus (HPV) were detected in cervical lesions and normal cervical tissue. Results: In comparison to normal cervical tissue, cervicitis and cervical intraepithelial neoplasia groups, the relative expression level of miR-145 was significantly lower, whereas the relative expression level of miR-205 was notably higher in the cervical cancer group, respectively (P<0.001). The area under the receiver operating characteristic (ROC) curve of miR-145 for diagnosis of cervical cancer in patients was 0.878, of which the sensitivity and the specificity were 0.905 and 0.822, respectively. The area under the ROC curve of miR-205 was 0.881, of which the sensitivity and the specificity was 0.869 and 0.889, respectively. Among all patients, the relative expression level of miR-145 was significantly lower while the relative expression level of miR-205 was considerably higher in HPV-positive patients than those of HPV-negative groups (P<0.001). Parauterine invasion, FIGO stage III-IV and lymphatic metastasis were considered as independent factors that affect the expression of miR-145. FIGO stage III-IV and lymphatic metastasis were independent factors affecting the expression of miR-205. Conclusion: The low expression level of miR-145 and the high expression level of miR-205 in patients with cervical cancer demonstrate a certain diagnostic value in cervical cancer. The expression level of miR-145 and miR-205 is correlated with HPV infection and cervical tumor malignancy.
Keywords: miRNA-145, miRNA-205, cervical cancer, human papillomavirus infection, diagnosis, pathological features
Introduction
Cervical cancer is a common gynecological malignancy, whose incidence ranks fourth among all female tumors worldwide [1,2]. The incidence of cervical cancer has been found to be high in low- and middle-income countries, ranking second in gynecological tumors, and the diagnosis of this disease is often in the late stages in these countries [3,4]. Studies have shown that a considerable number of patients with cervical cancer in China are already in advanced stages when diagnosed, they are then prone to relapse after surgery, leading to poor prognosis. Therefore, early diagnosis and early radical resection can be of great importance to the good prognosis of cervical cancer patients [5,6]. Studies have revealed that more that 94% of cervical cancer patients are positive for human papillomavirus (HPV), but clinical studies have reported that less than 1% of HPV-positive patients will develop cervical cancer [7].
MicroRNA (miRNA) is widely studied in tumors, and over 50% of human malignant tumors are related to miRNAs [8,9]. MiRNA-145 (miR-145) is highly expressed in ovarian, uterine, heart and other embryonic tissues and in the genitals [10]. However, some studies have demonstrated that miR-145 is not only downregulated and has anti-tumor effect in breast cancer, colon cancer, etc., but also has been proven to play an important role in the initiation and development of heart disease [11-14]. MiRNA-205 (miR-205) is a double-edged sword, which can either promote or suppress cancer development depending on tumor types. Previous studies have reported that low expression level of miR-205 exerts a tumor suppressive effect in breast cancer, colorectal cancer, and ovarian cancer [15-17]. While in liver cancer, it functions as both tumor suppressor and promoter [18,19]. However, studies on the expression and dynamic changes of these miRNAs in cervical cancer are very limited. This study investigated the expression levels of miR-145 and miR-205 in patients with cervical cancer, and leveraged the data to analyze their diagnostic value in cervical cancer. In addition, the correlation between miR-145, miR-205 and clinicopathological characteristics of cervical cancer or HPV infection were also studied.
Materials and methods
General information
One hundred and forty-four cervical tissue samples were collected from diagnosed and suspected patients in The First Affiliated Hospital of University of South China (March 2015 to August 2020). The patients were 25-71 years old, in which 84 patients were confirmed by pathology with cervical cancer, with an average age of 43.1±10.0 years, and 60 patients were diagnosed with cervical intraepithelial neoplasia, with an average age of 42.8±9.8 years. Thirty patients with cervicitis, with an average age of 43.6±9.7 years, were also selected for prospective research purposes. All participants signed an informed consent form. The study was approved by the Ethics Committee of The First Affiliated Hospital of University of South China.
Inclusion and exclusion criteria
Inclusion criteria: (1) Diagnosis of cervical cancer or cervical intraepithelial neoplasia or cervicitis; (2) Age between 18-75 years old; (3) All patients were underwent cervical biopsy or radical cervical cervix surgery in The First Affiliated Hospital of University of South China to obtain cervical tissues. The specimens were collected from pathological and normal tissues, respectively, which were stored in a -80°C freezer [20].
Exclusion criteria: (1) Patients with incomplete clinical data; (2) Patients with severe heart, liver, kidney and other diseases; (3) Patients with mental illness or cerebrovascular disease; (4) Patients with other cancers or who were without primary cervical cancer.
Clinical and pathological staging
The clinical staging and pathological staging of 84 cervical cancer samples were evaluated according to the diagnostic criteria in UICC/AJCC, 7th edition [21].
Methods
Detection of the relative expression levels of miR-145 and miR-205 in cervical tissues
Cervical tissue specimens, 2-3mm, were removed from the freezer. The expression levels of the miRNAs were measured via fluorescence real-time quantitative polymerase chain reaction (Q-PCR; ABI 7500, ABI Applied Biosystems, USA). Trizol kit (Molecular Research Center, USA) was applied to extract total RNA. Forward and reverse primers were designed and provided by Guangzhou Ruibo Biotechnology Company. Then, reverse transcription kit (Fernentas, Canada) was used to reverse transcribe miRNA into cDNA by reverse transcription PCR (RT-PCR), by which cDNA was used as a template for DNA amplification. Finally, the expression levels of miR-145 and miR-205 in cervical tissue samples were determined by fluorescence Q-PCR. The reaction system of reverse transcription kit (Fernentas, Canada) was 25 μL, including SYBR premix (2X) 12.5 μL, forward and reverse primers of target genes 0.5 μL each, cDNA template 2.0 μL, ddH2O 9.5 μL. Reaction conditions were set up as pre-denaturation for 5 min at 95°C, 1 cycle, then denaturation for 10 s at 98°C, annealing for 10 s at 60°C, extension for 30 s at 68°C, with 40 cycles in total, finally 10 min at 72°C. PCR-amplified products were measured via fluorescence Q-PCR. The relative expression levels were quantified by the 2-ΔΔCT method using U6 miRNA as a reference. Primer sequences were shown in Table 1.
Table 1.
Q-PCR primer sequences
| Primer | Forward primer 5’-3’ | Reverse primer 5’-3’ |
|---|---|---|
| miR-145 | TGCGCGTCCAGTTTTCCCAGGAA | CCAGTGCAGGGTCCGAGGTATT |
| miR-205 | TCCACCGGAGTCTGTCTCAT | GCTGTCAACGATACGCTACG |
| U6 | CGGGTTTGTTTTGCATTTGT | AGTCCCAGCATGAACAGCTT |
Note: miR-145, miRNA-145; miR-205, miRNA-205.
HPV-DNA detection in cervical specimens
PCR was conducted on cervical specimens, and the second generation hybrid capture method was used to identify 14 high-risk types of HPV. DNA level was used to determine whether there was infection or not, by which DNA level was equal to or greater than 1 ng/L was regarded as positive, otherwise it was considered as negative.
Outcome measures
Expression levels of miR-145, miR-205 and HPV-DNA were compared in the three groups of patients.
Receiver operating characteristic (ROC) curve was used to predict the diagnostic value of miR-145 and miR-205 for cervical cancer between the cervical cancer group and the combined group in relation to the other three.
Pathological characteristics and expression levels of miR-145 and miR-205 were investigated in 84 cervical cancer samples.
Statistical analysis
SPSS 17.0 software was applied for statistical analysis. The quantitative data were expressed as mean ± standard deviation (x̅ ± sd). The t test was used to analyze the data that was normally distributed with equal variance. If the data was not in a normal distribution or without equal variance, the rank sum test was carried out. Data among multiple groups was analyzed via one-way analysis of variance (ANOVA) and Tukey’s post hoc test. ROC diagnostic curve was applied to evaluate the diagnostic value of miR-145 and miR-205 in cervical cancer. Figures were created with Medcalc software. AUC greater than 0.7 was considered as the better diagnostic value, and P<0.05 indicated a statistically significant difference.
Results
Comparison of miR-145 and miR-205 expression levels in three groups of patients and the normal group
The relative expression level of miR-145 in the cervical cancer group was significantly lower than that of the normal group, cervicitis group and cervical intraepithelial neoplasia group, while the relative expression level of miR-205 was considerably higher in the cervical cancer group than that of the normal group, cervicitis group and cervical intraepithelial neoplasia group (P<0.001). The relative expression level of miR-145 was notably lower, whereas the relative expression level of miR-205 was remarkably higher in the cervical intraepithelial neoplasia group, respectively, compared with the normal group and cervicitis group (P<0.001; Table 2 and Figure 1).
Table 2.
Comparison of miR-145 and miR-205 expression levels in three groups of patients and the normal group (x̅ ± sd)
| Group | Case | miR-145 expression level | miR-205 expression level |
|---|---|---|---|
| Normal | 174 | 1.956±0.792 | 0.564±0.205 |
| Cervicitis | 30 | 1.868±0.840 | 0.507±0.191 |
| Cervical intraepithelial neoplasia | 60 | 0.888±0.423***,### | 0.814±0.318***,### |
| Cervical cancer | 84 | 0.449±0.198***,###,@@@ | 1.245±0.349***,###,@@@ |
| F | - | 111.462 | 71.123 |
| P | - | <0.001 | <0.001 |
Note: Compared with the normal group;
P<0.001.
Compared with the cervicitis group;
P<0.001.
Compared with the cervical intraepithelial neoplasia group;
P<0.001.
miR-145, miRNA-145; miR-205, miRNA-205.
Figure 1.
Comparison of miR-145 and miR-205 expression levels in three groups of patients and the normal group. A: The comparison of miR-145 expression levels in different groups; B: The comparison of miR-205 expression levels in different groups. Compared with the normal group, ***P<0.001; compared with the cervicitis group, ###P<0.001; compared with the cervical intraepithelial neoplasia group, @@@P<0.001. miR-145, miRNA-145; miR-205, miRNA-205.
The diagnostic value of miR-145 and miR-205 for cervical cancer
The area under the ROC curve of miR-145 for diagnosis of cervical cancer was 0.878 (95% CI: 0.724-0.933), P<0.001. When miR-145 was at the cut-off value of 0.675, the Youden index was 0.727, the specificity was 0.822, and the sensitivity was 0.905. The area under the ROC curve of miR-205 for diagnosis of cervical cancer was 0.881 (95% CI: 0.825-0.938), P<0.001. When miR-205 was at the cut-off value of 1.005, the Youden index was 0.758, specificity was 0.889 and the sensitivity was 0.869 (Figure 2).
Figure 2.
The ROC curve of miR-145 and miR-205 for the diagnosis of cervical cancer. ROC: receiver operating characteristic; miR-145, miRNA-145; miR-205, miRNA-205.
Comparison of HPV infection among the three groups of patients
The HPV infection rates of the cervical cancer group and cervical intraepithelial neoplasia group were significantly higher compared with the cervicitis group (P<0.001), and the HPV infection rate of the cervical cancer group was considerably higher in comparison to cervical intraepithelial neoplasia group (P<0.001; Table 3).
Table 3.
Comparison of HPV infection among three groups of patients (x̅ ± sd)
| Group | HPV-positive rate |
|---|---|
| Cervicitis (n=30) | 6 (20.00) |
| Cervical intraepithelial neoplasia (n=60) | 29 (48.33)*** |
| Cervical cancer (n=84) | 83 (98.81)***,### |
| χ2 | 78.831 |
| P | <0.001 |
Note: Compared with the cervicitis group;
P<0.001.
Compared with the cervical intraepithelial neoplasia group;
P<0.001.
miR-145, miRNA-145; miR-205, miRNA-205; HPV, human papillomavirus.
Comparison of miR-145 and miR-205 expression levels in HPV-positive and -negative groups
The relative expression level of miR-145 was significantly lower, whereas the relative expression level of miR-205 was considerably higher in HPV-positive patients compared with the negative group (P<0.001), see Table 4.
Table 4.
Comparison of miR-145 and miR-205 expression levels in HPV-positive and -negative groups (x̅ ± sd)
| Group | miR-145 expression level | miR-205 expression level |
|---|---|---|
| HPV-positive (n=118) | 0.619±0.467 | 1.107±0.411 |
| HPV-negative (n=56) | 1.311±0.794 | 0.708±0.328 |
| t | 7.029 | 6.363 |
| P | <0.001 | <0.001 |
Note: miR-145, miRNA-145; miR-205, miRNA-205; HPV, human papillomavirus.
Comparison of clinical and pathological features and miR-145 and miR-205 relative expression levels among 84 cervical cancer patients
In the scenarios of tumor volume equal to or greater than 5 cm, parauterine invasion, FIGO stage III-IV, and lymphatic metastasis, miR-145 expression was significantly downregulated whereas miR-205 expression was notably upregulated (P<0.05; Table 5).
Table 5.
Comparison of clinical and pathological features and miR-145 and miR-205 relative expression levels among 84 cervical cancer patients (x̅ ± sd)
| Category | Case | miR-145 | T | P | miR-205 | t | P |
|---|---|---|---|---|---|---|---|
| Age | 0.573 | 0.568 | 0.241 | 0.810 | |||
| ≥50 years | 48 | 0.412±0.254 | 1.244±0.349 | ||||
| <50 years | 36 | 0.442±0.213 | 1.262±0.323 | ||||
| Pathological type | 0.099 | 0.921 | 0.250 | 0.803 | |||
| Squamous cell carcinoma | 75 | 0.425±0.259 | 1.238±0.342 | ||||
| Adenocarcinoma | 9 | 0.434±0.241 | 1.268±0.324 | ||||
| Tumor volume | 3.928 | <0.001 | 3.937 | <0.001 | |||
| ≥5 cm | 49 | 0.325±0.178 | 1.426±0.398 | ||||
| <5 cm | 35 | 0.521±0.279 | 1.124±0.257 | ||||
| Histological grade | 0.691 | 0.492 | 1.642 | 0.105 | |||
| Well-differentiated | 18 | 0.439±0.264 | 1.196±0.287 | ||||
| Moderately- and poorly-differentiated | 66 | 0.399±0.204 | 1.352±0.374 | ||||
| Parauterine invasion | 2.567 | 0.012 | 2.570 | 0.012 | |||
| Yes | 15 | 0.315±0.186 | 1.389±0.373 | ||||
| No | 69 | 0.513±0.284 | 1.168±0.285 | ||||
| FIGO staging | 3.217 | 0.002 | 3.472 | <0.001 | |||
| I-II | 68 | 0.547±0.297 | 1.154±0.269 | ||||
| III-IV | 16 | 0.307±0.178 | 1.439±0.371 | ||||
| Lymphatic metastasis | 3.439 | <0.001 | 4.115 | <0.001 | |||
| Yes | 64 | 0.529±0.257 | 1.162±0.254 | ||||
| No | 20 | 0.315±0.189 | 1.468±0.387 |
Note: miR-145, miRNA-145; miR-205, miRNA-205.
Multivariate logistic regression analysis of the expression levels of miR-145 and miR-205 and the clinical and pathological characteristics of cervical cancer
If the expression level of miR-145 was greater than 0.449 (mean value) or miR-205 expression level was greater than 1.245 (mean value), it was considered as high expression, otherwise as low expression. The expression levels of miR-145 and miR-205 were used as dependent variables, and variables with differences in univariate analysis were selected as independent variables, including tumor size, parauterine invasion, FIGO staging, and lymphatic metastasis. After variable screening via the Ward method, multivariate logistic regression analysis was carried out, which found that parainvasion, FIGO stage III-IV and the presence of lymphatic metastasis were independent factors that affected the expression of miR-145, while FIGO stage III-IV and the presence of lymphatic metastasis were independent factors affecting the expression of miR-205 (Tables 6, 7 and 8).
Table 6.
Multivariate logistic regression analysis of the expression of miR-145 and miR-205 and the clinical and pathological characteristics of cervical cancer
| Factor | Independent variable | Outcome |
|---|---|---|
| Tumor volume | X1 | ≥5 cm=1, <5 cm=0 |
| Parauterine invasion | X2 | Yes=1, No=0 |
| FIGO staging | X3 | III-IV=1, I-III-II=0 |
| Lymphatic metastasis | X4 | No=1, Yes=0 |
Note: miR-145, miRNA-145; miR-205, miRNA-205.
Table 7.
Multivariate logistic regression analysis of miR-145
| Factor | β | SE | Wald value | OR value (95% CI) | P |
|---|---|---|---|---|---|
| Tumor volume | 0.706 | 0.854 | 0.156 | 0.065 (0.023-0.223) | 0.417 |
| Parauterine invasion | 1.941 | 0.702 | 7.832 | 7.102 (1.726-27.369) | 0.004 |
| FIGO staging | 1.125 | 0.312 | 3.214 | 3.954 (1.769-8.246) | 0.016 |
| Lymphatic metastasis | 1.016 | 0.279 | 3.123 | 3.792 (1.742-7.693) | 0.002 |
Note: miR-145, miRNA-145.
Table 8.
Multivariate logistic regression analysis of miR-205
| Factor | β | SE | Wald value | OR value (95% CI) | P |
|---|---|---|---|---|---|
| Tumor volume | 0.763 | 0.821 | 0.169 | 0.079 (0.037-0.236) | 0.427 |
| Parauterine invasion | 0.674 | 0.849 | 0.579 | 1.841 (0.379-10.268) | 0.423 |
| FIGO staging | 1.243 | 0.436 | 3.436 | 3.469 (1.462-9.025) | 0.027 |
| Lymphatic metastasis | 1.123 | 0.302 | 3.256 | 3.687 (1.982-9.743) | 0.016 |
Note: miR-205, miRNA-205.
Discussion
The early diagnosis of malignant tumors has gained increasing attention in clinical practice. Reliable and accurate biomarkers in patients’ serum that are applied in early diagnosis csn have a positive impact on the prognosis of patients. The diagnosis of cervical cancer patients using clinical signs, symptoms and commonly used tumor indicators can lead to a lack of specificity in the tumor diagnosis. As a result, some patients miss the best time for the early diagnosis and treatment, causing the delay of the treatment [3,4].
With the development of gene sequencing, it has been found that some non-coding RNAs (MicroRNAs, miRNAs) suppress or promote the process of tumor initiation, development, invasion and metastasis [22]. Studies have reported the abnormal expression of miRNAs in patients with cervical cancer as well, in which miRNAs can also inhibit or promote the proliferation of cervical cancer cells [23]. Research on the role of miR-145 in tumors has found that it mainly inhibits cancer cell development; however, miR-145 expression is downregulated in patients [24]. A study has demonstrated that the expression level of miR-145 is low in lung cancer tissues, and has further found that the lower the expression level of miR-145, the shorter the recurrence time, therefore, the low expression level of miR-145 is an indicator of poor prognosis [25]. Another study has also demonstrated that the expression level of miR-145 is low in colorectal cancer tissues. Restoration of miR-145 to the normal expression level has revealed a significant inhibitory effect on the proliferation of cancer cells [26]. Investigation of cervical cancer has found that miR-145 can downregulate myosin VI expression to inhibit the proliferation and migration of cervical cancer cells and reduce the invasion of cancer cells [27]. Previous studies on miR-205 have demonstrated the abnormal expression of miR-205 in endometrial cancer and non-small cell lung cancer, which promotes the proliferation and migration of cancer cells and can be used as a biomarker for early diagnosis [28]. Another study has reported that knockout of the suppressor of miR-205 results in the upregulation of its expression, which promotes the proliferation and malignant progression of cancer cells [29]. This study has also revealed the downregulation of miR-145 and upregulation of miR-205 in cervical cancer tissues. Further investigation has shown that miR-145 and miR-205 have a diagnostic value in cervical cancer and can serve as biomarkers in the early diagnosis of cervical cancer, which is consistent with the previous studies.
Research on HPV infection has reported that more than 94% of cervical cancer patients who are tested are HPV-positive [7]. Our study has also showed that HPV infection is positive in 98.81% of cervical cancer cases, which is consistent with previous investigations. Studies have demonstrated that HPV infection can inhibit the expression of miR-145, whose overexpression can inhibit the replication of HPV genes [30]. For HPV-positive cervical cancer patients, the expression level of miR-205 is significantly higher in cervical cancer tissues than that of normal tissues [31]. In this paper, we also reported that the expression level of miR-145 is low in HPV-positive patients, whereas the expression level of miR-205 is high, which is in accordance with previous results. Previous studies on the relationship between the clinical and pathological characteristics of cervical cancer and miR-145 have found that the low expression level of miR-145 is correlated with clinical staging, lymphatic metastasis, and peripheral vascular infiltration [32]. High expression level of miR-205 can promote cervical cancer progression, and the expression of miR-205 is associated with tumor staging, lymphatic metastasis, and the depth of tissue invasion [33]. Our study has elucidated that tumors≥5 cm, parauterine invasion, FIGO stage III-IV, and lymphatic metastasis are correlated with the expression of miR-145 and miR-205, and multivariate logistic regression analysis demonstrates that parauterine invasion, FIGO stage III-IV and the lymphatic metastasis are independent factors that affect the expression of miR-145, while FIGO stage III-IV and the lymphatic metastasis are independent factors that influence the expression of miR-205.
There are some caveats in our study. For example, the sample size is small, our study is only done in a single-center, and the mechanism has not been studied. Thus, the molecular mechanism investigation and a multi-center randomized controlled research is warranted future studies.
In summary, the low expression level of miR-145 and abnormally high expression level of miR-205 in patients with cervical cancer have shown a clear diagnostic value in cervical cancer. The expression of miR-145 and miR-205 is correlated with HPV infection and tumor malignancy.
Disclosure of conflict of interest
None.
References
- 1.Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394–424. doi: 10.3322/caac.21492. [DOI] [PubMed] [Google Scholar]
- 2.Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. 2019;69:7–34. doi: 10.3322/caac.21551. [DOI] [PubMed] [Google Scholar]
- 3.Kim JY, Byun SJ, Kim YS, Nam JH. Disease courses in patients with residual tumor following concurrent chemoradiotherapy for locally advanced cervical cancer. Gynecol Oncol. 2017;144:34–39. doi: 10.1016/j.ygyno.2016.10.032. [DOI] [PubMed] [Google Scholar]
- 4.Velentzis LS, Smith MA, Simms KT, Lew JB, Hall M, Hughes S, Yuill S, Killen J, Keane A, Butler K, Darlington-Brown J, Hui H, Brotherton JML, Skinner R, Brand A, Roeske L, Heley S, Carter J, Bateson D, Frazer I, Garland SM, Guy R, Hammond I, Grogan P, Arbyn M, Castle PE, Saville M, Armstrong BK, Canfell K. Pathways to a cancer-free future: a protocol for modelled evaluations to maximize the future impact of interventions on cervical cancer in Australia. Gynecol Oncol. 2019;152:465–471. doi: 10.1016/j.ygyno.2018.12.019. [DOI] [PubMed] [Google Scholar]
- 5.Lyu YJ, Ding L, Gao T, Li Y, Li L, Wang M, Han Y, Wang JT. Influencing factors of high-risk human papillomavirus infection and DNA load according to the severity of cervical lesions in female coal mine workers of China. J Cancer. 2019;10:5764–5769. doi: 10.7150/jca.29034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Burki TK. Outcomes after minimally invasive surgery in cervical cancer. Lancet Oncol. 2018;19:e674. doi: 10.1016/S1470-2045(18)30840-4. [DOI] [PubMed] [Google Scholar]
- 7.Chan CK, Aimagambetova G, Ukybassova T, Kongrtay K, Azizan A. Human papillomavirus infection and cervical cancer: epidemiology, screening, and vaccination-review of current perspectives. J Oncol. 2019;2019:3257939. doi: 10.1155/2019/3257939. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Aquino-Jarquin G. Emerging role of CRISPR/Cas9 technology for microRNAs editing in cancer research. Cancer Res. 2017;77:6812–6817. doi: 10.1158/0008-5472.CAN-17-2142. [DOI] [PubMed] [Google Scholar]
- 9.Liu SS, Chan KKL, Chu DKH, Wei TN, Lau LSK, Ngu SF, Chu MMY, Tse KY, Ip PPC, Ng EKO, Cheung ANY, Ngan HYS. Oncogenic microRNA signature for early diagnosis of cervical intraepithelial neoplasia and cancer. Mol Oncol. 2018;12:2009–2022. doi: 10.1002/1878-0261.12383. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Anton L, DeVine A, Sierra LJ, Brown AG, Elovitz MA. miR-143 and miR-145 disrupt the cervical epithelial barrier through dysregulation of cell adhesion, apoptosis and proliferation. Sci Rep. 2017;7:3020. doi: 10.1038/s41598-017-03217-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Liu SY, Li XY, Chen WQ, Hu H, Luo B, Shi YX, Wu TW, Li Y, Kong QZ, Lu HD, Lu ZX. Demethylation of the MIR145 promoter suppresses migration and invasion in breast cancer. Oncotarget. 2017;8:61731–61741. doi: 10.18632/oncotarget.18686. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wu QB, Sheng X, Zhang N, Yang MW, Wang F. Role of microRNAs in the resistance of colorectal cancer to chemoradiotherapy. Mol Clin Oncol. 2018;8:523–527. doi: 10.3892/mco.2018.1578. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Vacante F, Denby L, Sluimer JC, Baker AH. The function of miR-143, miR-145 and the MiR-143 host gene in cardiovascular development and disease. Vascul Pharmacol. 2019;112:24–30. doi: 10.1016/j.vph.2018.11.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ren LF, Wei CX, Li K, Lu ZN. LncRNA MALAT1 up-regulates VEGF-A and ANGPT2 to promote angiogenesis in brain microvascular endothelial cells against oxygen-glucose deprivation via targetting miR-145. Biosci Rep. 2019;39:BSR20180226. doi: 10.1042/BSR20180226. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 15.Xiao YJ, Li YF, Tao H, Humphries B, Li AM, Jiang YG, Yang CF, Luo RC, Wang ZS. Integrin α5 down-regulation by miR-205 suppresses triple negative breast cancer stemness and metastasis by inhibiting the Src/Vav2/Rac1 pathway. Cancer Lett. 2018;433:199–209. doi: 10.1016/j.canlet.2018.06.037. [DOI] [PubMed] [Google Scholar]
- 16.Yang X, Yang L, Ma YM, Zhao XH, Wang HY. MicroRNA-205 mediates proteinase-activated receptor 2 (PAR(2)) -promoted cancer cell migration. Cancer Invest. 2017;35:601–609. doi: 10.1080/07357907.2017.1378671. [DOI] [PubMed] [Google Scholar]
- 17.Chu P, Liang AH, Jiang AL, Zong L. miR-205 regulates the proliferation and invasion of ovarian cancer cells via suppressing PTEN/SMAD4 expression. Oncol Lett. 2018;15:7571–7578. doi: 10.3892/ol.2018.8313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zhao XY, Zhou S, Wang DZ, He W, Li JX, Zhang S. MicroRNA-205 is downregulated in hepatocellular carcinoma and inhibits cell growth and metastasis via directly targeting vascular endothelial growth factor A. Oncol Lett. 2018;16:2207–2214. doi: 10.3892/ol.2018.8933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Zhu L, Liu R, Zhang W, Qian S, Wang JH. MicroRNA-205 regulates ubiquitin specific peptidase 7 protein expression in hepatocellular carcinoma cells. Mol Med Rep. 2015;12:4652–4656. doi: 10.3892/mmr.2015.3998. [DOI] [PubMed] [Google Scholar]
- 20.Perkins RB, Guido RS, Castle PE, Chelmow D, Einstein MH, Garcia F, Huh WK, Kim JJ, Moscicki AB, Nayar R, Saraiya M, Sawaya GF, Wentzensen N, Schiffman M. 2019 ASCCP risk-based management consensus guidelines for abnormal cervical cancer screening tests and cancer precursors. J Low Genit Tract Dis. 2020;24:102–131. doi: 10.1097/LGT.0000000000000628. [DOI] [PubMed] [Google Scholar]
- 21.Amin MB, Edge S, Greene F, Byrd DR, Brookland RK, Washington MK, Gershenwald JE. In: AJCC Cancer Staging Manual. Amin MB, Edge S, Greene F, Byrd DR, Brookland RK, Washington MK, Gershenwald JE, editors. New York: Springer International Publishing; 2017. [Google Scholar]
- 22.Wang JM, Ju BH, Pan CJ, Gu Y, Li MQ, Sun L, Xu YY, Yin LR. MiR-214 inhibits cell migration, invasion and promotes the drug sensitivity in human cervical cancer by targeting FOXM1. Am J Transl Res. 2017;9:3541–3557. [PMC free article] [PubMed] [Google Scholar]
- 23.Ribeiro J, Marinho-Dias J, Monteiro P, Loureiro J, Baldaque I, Medeiros R, Sousa H. miR-34a and miR-125b expression in hpv infection and cervical cancer development. Biomed Res Int. 2015;2015:304584. doi: 10.1155/2015/304584. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ma L, Li LL. miR-145 contributes to the progression of cervical carcinoma by directly regulating FSCN1. Cell Transplant. 2019;28:1299–1305. doi: 10.1177/0963689719861063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Campayo M, Navarro A, Viñolas N, Diaz T, Tejero R, Gimferrer JM, Molins L, Cabanas ML, Ramirez J, Monzo M, Marrades R. Low miR-145 and high miR-367 are associated with unfavourable prognosis in resected nonsmall cell lung cancer. Eur Respir J. 2013;41:1172–1178. doi: 10.1183/09031936.00048712. [DOI] [PubMed] [Google Scholar]
- 26.Pagliuca A, Valvo C, Fabrizi E, di Martino S, Biffoni M, Runci D, Forte S, De Maria R, Ricci-Vitiani L. Analysis of the combined action of miR-143 and miR-145 on oncogenic pathways in colorectal cancer cells reveals a coordinate program of gene repression. Oncogene. 2013;32:4806–4813. doi: 10.1038/onc.2012.495. [DOI] [PubMed] [Google Scholar]
- 27.He J, Sun YX, Bao H. Effects of miR-145 on the proliferation, migration and invasion of cervical cancer cells. J Trop Med. 2018;18:1409–1413. [Google Scholar]
- 28.Zhang YQ, Sui J, Shen X, Li CY, Yao WZ, Hong WW, Peng H, Pu YP, Yin LH, Liang GY. Differential expression profiles of microRNAs as potential biomarkers for the early diagnosis of lung cancer. Oncol Rep. 2017;37:3543–3553. doi: 10.3892/or.2017.5612. [DOI] [PubMed] [Google Scholar]
- 29.He BM, Bai Y, Kang W, Zhang XP, Jiang XJ. LncRNA SNHG5 regulates imatinib resistance in chronic myeloid leukemia via acting as a CeRNA against MiR-205-5p. Am J Cancer Res. 2017;7:1704–1713. [PMC free article] [PubMed] [Google Scholar]
- 30.Lu HZ, He Y, Lin L, Qi ZQ, Ma L, Li L, Su Y. Long non-coding RNA MALAT1 modulates radiosensitivity of HR-HPV+ cervical cancer via sponging miR-145. Tumour Biol. 2016;37:1683–1691. doi: 10.1007/s13277-015-3946-5. [DOI] [PubMed] [Google Scholar]
- 31.Zhang W, Liu Z, Hu XX, Lin YX, Li MY, Wang LL. Correlation analysis of abnormal expression of microRNA and HPV-16 E6/E7 genes in cervical cancer. J Chin Pract Diagn Ther. 2016;30:120–123. [Google Scholar]
- 32.Azizmohammadi S, Safari A, Azizmohammadi S, Kaghazian M, Sadrkhanlo M, Yahaghi E, Farshgar R, Seifoleslami M. Molecular identification of miR-145 and miR-9 expression level as prognostic biomarkers for early-stage cervical cancer detection. QJM. 2017;110:11–15. doi: 10.1093/qjmed/hcw101. [DOI] [PubMed] [Google Scholar]
- 33.Ma Q, Wan G, Wang S, Yang W, Zhang J, Yao X. Serum microRNA-205 as a novel biomarker for cervical cancer patients. Cancer Cell Int. 2014;14:81. doi: 10.1186/s12935-014-0081-0. [DOI] [PMC free article] [PubMed] [Google Scholar]