Skip to main content
Journal of Nematology logoLink to Journal of Nematology
. 2021 Jan 16;52:e2020-123. doi: 10.21307/jofnem-2020-123

Occurrence and molecular characterization of Meloidogyne graminicola on rice in Central Punjab, Pakistan

Abdul Jabbar 1, Nazir Javed 1, Anjum Munir 2, Huma Abbas 1, Sajid A Khan 1, Anam Moosa 1, Muhammad Jabran 1, Byron J Adams 3,*, Muhammad A Ali 1,*
PMCID: PMC8015280  PMID: 33829165

Abstract

Meloidogyne graminicola threatens global rice production, yet is understudied for many areas where it is cultivated. To better understand the prevalence and incidence of M. graminicola in central Punjab, Pakistan, we carried out field surveys of rice fields in the districts of Faisalabad and Chiniot. M. graminicola isolates were recovered from soil and root samples and identified on the basis of perineal patterns and rDNA ITS-based sequencing. The severity of nematode attack on rice roots and infested fields at various locations was based on galling index, root-knot nematode juveniles per root system, juveniles per 100 ml of soil, and prevalence of stylet-bearing nematodes and non-stylet-bearing nematodes. Maximum prevalence (22.5 and 27.5%) and minimum prevalence (17.5 and 20%) of M. graminicola was observed in Chiniot and Faisalabad, respectively. Eleven alternate host-plant species were examined in this study revealing varying degrees of M. graminicola infestation. ITS sequencing and phylogenetic analysis indicated that isolates from this study form a well-resolved clade with others from Asia, while another isolate falls outside of this clade in an unresolved polytomy with those from Europe and South America. Though monophyletic with the other M. graminicola, the isolates from Pakistan are distinguished by their high genetic variability and long branch lengths relative to the other isolates of M. graminicola, suggesting Pakistan as a possible ancestral area. Our results indicate that rice is severely attacked by a genetically diverse and aggressive M. graminicola, necessitating the development of appropriate control measures for its management in rice and other graminaceous crops.

Keywords: Alternate hosts, Diagnosis, ITS rDNA, Meloidogyne graminicola, Morphology, Rice root-knot nematode


Rice (Oryza sativa L.) is one of the major cereal crops produced in Pakistan and is cultivated on an area of 2,900,600 hectares with a production of 11,174,700 tons (FAO, 2017). As a staple food, its consumption exceeds 100 kg per capita annually in most of the Asian countries (Seck et al., 2012). Several biotic and abiotic constraints limit the yield and quality of rice. Among biotic constraints, plant-parasitic nematodes are an emerging threat to rice production. Root-knot nematodes (RKNs) are the most destructive plant-parasitic nematodes in upland, lowland, and deep-water rice cultivation systems (Panwar and Rao, 1998; Bridge et al., 2005). RKNs possess the ability to penetrate the roots, induce root galling, suppress plant defense mechanisms, hijack the plant’s metabolic system, and establish giant cells for the sake of their own benefit (Kyndt et al., 2014; Ali et al., 2017a, 2017b, 2018). As an outcome, plants gradually lose vigor, ultimately leading to substantial yield loss (Bridge et al., 2005; Win et al., 2015; Ali et al., 2015). Among various RKNs, Meloidogyne graminicola (Golden and Birchfield) has emerged as the most serious pest of rice (Mantelin et al., 2017). M. graminicola was first reported in Pakistan by Munir and Bridge (2003) during a survey of rice fields of Sheikhupura, Punjab, Pakistan. The subtropical climate of Pakistan and warm sandy soils are favorable for the development and reproduction of RKNs (Khattak, 2008). But plant-parasitic nematodes in these regions have received little attention in the past, and only a few surveys have been conducted to estimate their prevalence and incidence (Kafi, 1963; Ahmad and Khan, 1973; Saeed and Ashrafi, 1973; Khan et al., 2005; Zarina and Shahina, 2010; Anwar and McKenry, 2012). All varieties of rice grown in South Asian and Southeast Asian countries, whether upland or lowland, have exhibited susceptibility to M. graminicola (Padgham et al., 2004; Das et al., 2011; Win et al., 2013). Currently, there is little information about the association of M. graminicola with rice in Pakistan.

Compared with other phytopathogens, nematodes are difficult to control because they attack belowground parts of plants, resulting in reduced growth and yield loss (Williamson and Hussey, 1996). Moreover, nematodes are polyphagous pests that attack over 5,500 plant species, including several economically important crops (Moens and Perry, 2009; Ali et al., 2015; Ali et al., 2019). Successful control of Meloidogyne species can only be achieved by rapid and accurate identification of the nematode. Traditional techniques of nematode identification based on morphological features (Eisenback, 1985) are challenging because they are laborious and require extensive training and expertise. Historically, RKNs have been identified based primarily on morphological features. Currently, there is no information available about the molecular identification of Meloidogyne spp. in Pakistan, especially in regard to M. graminicola.

Several molecular techniques are available for the identification of Meloidogyne species (Blok and Powers, 2009). Among these techniques, the polymerase chain reaction (PCR) is a sensitive, quick, and accurate tool (Niu et al., 2011). Adam et al. (2007) developed a molecular diagnostic key that uses several molecular approaches to identify seven economically important RKNs that are frequently encountered in diagnostic laboratories. Moreover, with the increase in DNA-based sequencing, the tandem repeat unit segments of the 18 S, ITS1, 5.8 S, ITS2, and 28 S regions of the ribosomal DNA array (rDNA) and mitochondrial DNA (mtDNA) have proved to be efficient diagnostic tools for accurately identifying of RKNs (Landa et al., 2008; Naz et al., 2012).

Accurate identification of M. graminicola, as well as its prevalence and distribution spectra, is fundamental for applying management strategies in the field. Therefore, we used morphological and molecular approaches to identify RKNs in order to determine the distribution, prevalence, and disease intensity of M. graminicola in Chiniot and Faisalabad districts of Central Punjab, Pakistan.

Materials and Methods

Survey and sampling

A survey of rice-growing areas of Faisalabad and Chiniot districts of central Punjab, Pakistan, was conducted during September 2014, 2015, and 2016. Five root samples of rice plants and 1000-ml composite soil samples were collected from each sampling site, preserved in polythene bags, and labeled. The samples were transported to the Nematology Lab, Department of Plant Pathology, University of Agriculture, Faisalabad, for further processing. The roots were gently washed with distilled water to remove adhering soil and plant debris. Nematode prevalence was determined by using the formula of Norton (1978):

Nematodeprevalence(%)=NumberoflocationsinfectedwithRKNsTotalnumberoflocationssurveyed×100

Isolation and morphological identification of M. graminicola

Second-stage juveniles (J2s) of M. graminicola were isolated from rice roots. The root samples from each field were pooled, chopped into pieces, and mixed thoroughly. Three subsamples of 5-g roots were taken, and juveniles were isolated from infected roots using the Baermann funnel method and collected in a beaker. Nematode extraction from soil samples was carried out using Whitehead’s tray method (Whitehead and Hemming, 1965). Soil samples were mixed thoroughly, and a 100-ml composite sample was placed in a plastic bucket and 1–2 liters of water were added. Plant debris, heavy soil particles, and rocks were drained manually. The supernatant was sieved through a 50-mesh-size sieve in a separate bucket. The procedure was repeated by adding 1,000-ml water again and agitated properly. After that, the suspension was left to settle and poured again into another basket using a 100-mesh sieve. The process was repeated twice again using 250- and 325-mesh sieves. The final suspension was transferred to a 500-ml beaker and the supernatant was allowed to settle for one hour. Three subsamples of 2 ml each were taken and examined in a counting dish. Second-stage juveniles (J2) were counted using a stereomicroscope (Olympus SZ2-ILGB). Mature females of M. graminicola were identified based on micrographs of the internal and external perineal patterns (Jepson, 1987). Stained hooked gall tissues were teased apart with a pointed needle to separate mature females. The neck region of individual nematodes was excised, and the posterior part was dipped in 45% lactic acid solution to remove body tissues. The perineal patterns were trimmed and transferred on a transparent glass slide in a glycerin drop. External views of the perineal patterns were visualized using scanning electron microscopy (SEM) at Brigham Young University, Provo Utah, USA. Accordingly, specimens were dehydrated via ascending ethanol series prior to critical point drying. The animals were then mounted on stubs and gold-sputtered. Micrographs were recorded via Helios Nanolab 600 SEM (Thermo-Fisher Scientific, Hillsborough, USA).

Statistical analysis

Data were subjected to statistical analysis using Statistix (Ver. 8.1). The experimental design for the analysis of galling index, juveniles/soil sample, juveniles/root sample, stylet, and non-stylet-bearing nematodes was by a completely randomized block design with treatment means separated using a LSD test at P = 0.05.

DNA extraction

Isolates derived from single egg masses were used to extract DNA. Twenty larvae were picked, rinsed thrice with sterile distilled water, transferred to a microcentrifuge tube, and crushed in 500 µL of SDS extraction buffer containing Tris–HCl (1 M, pH 7.5), EDTA (0.5 M, pH 8.0), SDS (10% w/v), and dd H2O with a grinding plastic stick (Mitkowski et al., 2003). Proteins in the solution were digested by adding 20 µL proteinase K, 100 µg ml−1. Later, 500 µL of phenol (25:24:1, phenol/chloroform/isoamyl alcohol) was added and vortexed briefly. The tube was centrifuged at 14,000 rpm for 5 min and the supernatant was collected and transferred to another sterile microcentrifuge tube. Sodium acetate (3 M), 50 µL and ice-cold isopropanol, 500 µL, were added to the supernatant, vortexed gently, and centrifuged at 14,000 rpm for 5 min. The supernatant was discarded to save the pellet. Five-hundred µL of ethanol (96%) was added to the pellet and centrifuged for 3 min at 13,000 rpm. The supernatant was discarded again, and the pellet air-dried in a laminar flow chamber for 2 hr. DNA was dissolved in 30 µL of TE buffer (1 ml of 1 M Tris base (pH 8.0) and 0.2 ml of EDTA (0.5 M), dd H2O) and stored at –20°C until required for PCR reactions.

Internal transcribed spacer region (ITS) amplification

The PCR reaction mixture was prepared by using 10 µL of 10X PCR buffer, 2-µL dNTPs (10 mM), 2-µL forward primer (10 µM), 2-µL reverse primer (10 µM), 2-µL template DNA (>  50 ng), 1-µL Taq polymerase, and 81-µL ddH2O, for a total reaction volume of 100 µL. PCR reactions were carried out in a thermal cycler (BIO-RAD T100TM) under the following conditions: (1) predenaturation at 94 °C for 5 min, (2) denaturation at 94°C for 1 min, (3) annealing at 64°C for 1 min, (4) extension at 72°C for 1 min, (5) 35 cycles of this process, and (6) final extension at 72°C for 5 min. The sequences of primers used for amplification of the internal transcribed spacer region are 1) forward primer rDNA2 (5’–TTGATTACGTCCCTGCCCTTT–3’) (Vrain et al., 1992) and reverse primer rDNA1. 5.8 s (5’–ACGAGCCCGAGTGATCCACCG–3’) (Cherry et al., 1997). Primers were synthesized by Sigma Genosys Inc, St. Louis, MO, USA.

Gel electrophoresis and sequencing

The amplified PCR product was viewed on a gel stained with ethidium bromide under a UV transilluminator. DNA was excised from the gel and purified for sequencing using quick Gel Extraction Kit (Qiagen Gel Extraction Kit, Qiagen, Hilden, Germany). Purified DNA was sent for sequencing to L.G.C. Genomics, Germany, or the DNA sequencing center at Brigham Young University, Provo, Utah, USA.

Phylogenetic analysis

Due to the high degree of interspecific variation in nucleotide sequences of nematodes (Hu and Gasser, 2006), the deduced internal transcribed spacer region sequences were used for phylogenetic study. The ITS sequences of the eight isolates were used to query the most similar curated sequences on GenBank by performing open-nucleotide BLAST (Basic Local Alignment Search Tool, Camacho et al., 2009). The nearest matches as well as those from closely related species of Meloidogyne (McClure et al., 2012) were downloaded from GenBank and used for subsequent phylogenetic analysis. Multiple-sequence alignment was generated using MUSCLE (Edgar, 2004). The alignment settings included optimization of profile-dependent parameters. Sequences were first grouped by similarity with anchor optimization. Iteration 1  =  kmer4_6 with pctid_kimura for subsequent interactions using the UPMGB clustering method and pseudo-tree rooting. CLUSTALW was used for the distance weighting scheme, with 32-base anchor spacing and 24-base minimum diagonals. Bayesian analyses were carried out using MrBayes 3.2.6 (Huelsenbeck and Ronquist, 2001). A general time-reversible model of sequence evolution with four categories of gamma rate variation was chosen as the optimal model of sequence evolution as per Posada and Crandall (1998). Bayesian analysis was initiated with a random starting tree with four heated chains of chain length 1,100,000, burn-in length of 100,000, and subsampling frequency of 200. Branch lengths were unconstrained.

Results

Prevalence of M. graminicola

The field survey data during the rice cropping season of 2014, 2015, and 2016 indicated that both districts Chiniot and Faisalabad have M. graminicola infestation during all the seasons. The GPS coordinates for each sample were used to plot the presence and absence of M. graminicola at the sampled sites in Faisalabad and Chiniot (Figure 1). The prevalence of M. graminicola at forty surveyed locations of Chiniot and Faisalabad is given in Tables 1 and 2. Maximum prevalence of M. graminicola (22.5 and 27.5%) was observed in Chiniot and Faisalabad, respectively, during the rice-growing season of 2016, while the minimum prevalence (17.5 and 20%, respectively) was recorded in Chiniot and Faisalabad during the cropping season of 2014. During 2014 to 2016 at Chiniot among 40 surveyed locations, the presence of M. graminicola was observed at 7, 8, and 9 locations respectively. Similarly, 40 locations were surveyed in Faisalabad during 2014–2016, and M. graminicola prevalence was recorded at 8, 10, and 11 locations, respectively. M. graminicola showed typical hook-shaped galls on rice roots that are a characteristic feature of M. graminicola infection (Figure 2).

Figure 1:

Figure 1:

GPS map of Faisalabad and Chiniot districts. Red dots indicate locations of samples infested with M. graminicola.

Table 1.

Prevalence of M. graminicola in Chiniot district.

Prevalence
Sr # Locations Elevation Latitude Longitude 2014 2015 2016
1 133 J.B. 178 V 31.57931 072.97683
2 134 J.B. 173 V 31.59705 072.96338 + + +
3 223 J.B. 169 V 31.62043 072.96727
4 Moza Rajoya 176 R 31.66198 072.97448 + + +
5 M.Thattian 184 R 31.68778 072.97489
6 M. Johdpur 180 R 31.69026 072.97472
7 Ahmad Nagar 182 R 31.77321 072.89966
8 Ahmad Pur 187 R 31.79090 072.87729
9 M. kanwewala 183 R 31.81763 072.82544
10 Moza Judhi 186 R 31.82471 072.81122
11 202 J.B. 192 V 31.84161 072.83868
12 Kote Qazipur 190 R 31.84774 072.84970
13 Biewal 187 R 31.90920 072.94682
14 Kalowal 182 R 31.90423 072.95624
15 Jand wala 185 R 31.88589 072.99015
16 Pungu Morr 184 R 31.84625 072.96008 + + +
17 Moza Johdabad 183 R 31.83006 072.93907
18 M.Hussainabad 188 R 31.82157 072.92782 + + +
19 M.Mohsanabad 178 R 31.79400 072.89456
20 Moza Vaisaan 176 R 31.78678 072.88346
21 241 J.B. 178 V 31.72044 072.95988
22 Moza Bukharian 177 R 31.70576 072.95381
23 Abbas nagar 180 R 31.68935 72.93636
24 Kandiwal 177 R 31.67671 72.90760
25 241 J.B. 179 V 31.66678 72.87928
26 Thatta Jahania 177 R 31.66310 72.86660 + + +
27 Adil wala bangla 169 V 31.66029 72.85530
28 194 J.B. 171 V 31.65541 72.83943
29 94 J.B. 179 V 31.64864 72.82515
30 202 J.B. 179 V 31.62264 72.77077 + + +
31 Moza Nitthar 167 R 31.59611 72.70949
32 254 J.B. 168 V 31.58803 72.69275
33 Jamya abad 168 T 31.55409 72.64627 + + +
34 Gondlan wali 167 R 31.53430 72.66215
35 Chenab mills Ltd 166 C 31.51384 72.67929
36 Bhawana city 170 C 31.50520 72.68622
37 129 J.B. 172 V 31.50039 72.69027
38 41 J.B. 165 V 31.49171 72.69737 + +
39 223 J.B. 169 V 31.45835 72.72484 +
40 Rahmuana 181 V 31.42409 72.75250

Note: Villages with official code (V), JB, stand for canal irrigation official code. R stands for River Chenab basin areas and C stands for City/Town area. Positive (+) sign indicates presence of RKN; negative (−) indicates absence of RKN in the rice field.

Table 2.

Prevalence of M. graminicola in district Faisalabad.

Prevalence
Sr # Locations Elevation Latitude Longitude 2014 2015 2016
1 217 R.B. 175 V 31.44325 073.00077
2 61 J.B. 176 V 31.45346 072.97887
3 57 J.B. 177 V 31.45328 072.98147
4 58 J.B. 186 V 31.46937 072.99122 + + +
5 52 J.B. 181 V 31.49570 073.00120
6 54 J.B. 186 V 31.500394 072.99582
7 51 J.B. 180 V 31.51203 072.98117
8 53 J.B. 180 V 31.52299 072.97618
9 49 J.B. 186 V 31.56101 072.98678
10 218 J.B. 173 V 31.43074 072.97399 + + +
11 64 J.B. 173 V 31.39198 072.93964
12 68 J.B. 174 V 31.37310 072.92706
13 66 J.B. 178 V 31.40154 72.97310
14 275 J.B. 169 V 31.34735 72.83235
15 70 J.B. 181 V 31.36304 72.90952 + +
16 289 R.B. 172 V 31.33934 072.99238
17 245 R.B. 177 V 31.33586 073.01232
18 296 R.B. 179 V 31.33620 073.04997
19 254 R.B. 166 V 31.33576 073.00168
20 269 R.B. 167 V 31.19880 072.99097
21 135 G.B. 169 V 31.14848 072.98298
22 UAF 179 C 31.43735 073.07427 + + +
23 Samundari City 168 C 31.05557 072.97504
24 71 G.B. 165 V 31.05584 072.97427 +
25 73 G.B. 165 V 31.05005 072.99210
26 442 G.B. 172 V 31.04441 073.00982 + + +
27 393 G.B. 172 V 31.02308 073.07303
28 423 G.B. 178 V 31.07426 073.13823
29 424 G.B. 172 V 31.08084 073.14034 + + +
30 430 G.B. 171 V 31.11562 073.15054
31 172 G.B. 178 V 31.14319 073.14831
32 171 G.B. 178 V 31.16456 073.13882
33 39 G.B. 176 V 31.20585 073.17356 + + +
34 41 G.B. 182 V 31.20572 073.17418
35 54 G.B. 183 V 31.26873 073.29616
36 21 G.B. 191 V 31.30716 073.38556
37 205 R.B. 186 V 31.43253 073.23050 + +
38 66 G.B. 181 V 31.34015 073.33852 + + +
39 216 R.B. 183 V 31.38091 073.22599
40 229 R.B. 184 V 31.39439 073.20733 + + +

Note: Villages with official code (V), JB, RB and GB stand for canal irrigation official code. C indicates a City/Town area. Positive (+) sign indicates presence of RKN and negative (−) indicates absence of RKN in the rice field.

Figure 2:

Figure 2:

Rice roots infected with M. graminicola. The roots are showing typical symptoms of galls or knots.

Infection and infestation severity of M. graminicola

The severity of M. graminicola attack on rice roots in infested fields was based on different attributes like galling index, juveniles per root system, juveniles per 100 mL of soil, number of stylet-bearing nematodes (SBN), and the number non-stylet-bearing nematodes (NSBN) from both of the surveyed districts (Tables 3 and 4). The highest galling index was observed in Chiniot and Faisalabad during 2016 and 2014, respectively. M. graminicola attack was observed at both districts with significantly high galling index indicative of high infestation of M. graminicola. In Chiniot, the highest juvenile/root sample population was recorded in 2016. The highest population of juveniles/soil sample and non-stylet-bearing nematodes was observed in 2014, while the maximum recorded number of stylet-bearing nematodes was from Chiniot in 2015. During 2016, the highest population of juveniles/root sample and stylet-bearing nematodes was observed in Faisalabad, while the highest number of juveniles/soil sample and non-stylet-bearing nematodes was recorded during 2015.

Table 3.

Incidence of M. graminicola at different locations of district Chiniot.

Year Location Galling index Juveniles/root sample Juveniles/soil sample Stylet bearing nematodes Non-stylet bearing nematodes
2014 134 J.B 2.20 b 300.80 b 140.40 d 4.20 bc 2.80 e
Moza Rajoya 3.80 a 348.60 ab 280.80 b 3.80 c 9.40 cd
Pungu Mor 2.60 ab 290.40 b 108.80 d 1.60 d 11.40 bcd
Jamya Abad 3.20 ab 390.40 a 119.00 d 3.80 c 12.00 bc
Jandwala 4.00 a 297.20 b 211.40 c 5.20 ab 8.40 d
223 JB-2 3.80 a 336.60 ab 347.20 a 5.80 a 14.00 ab
Rahmuana 3.20 ab 294.00 b 184.00 c 5.40 ab 17.20 a
2015 134 J.B 3.40 a 172.20 a 117.80 f 6.20 cd 7.20 d
Moza Rajoya 3.20 a 117.40 c 242.60 c 2.80 f 9.20 cd
Pungu Mor 2.80 a 163.20 ab 136.40 e 7.40 bc 13.00 a
Jamya Abad 3.20 a 126.40 bc 135.80 e 9.20 a 10.00 bc
Jandwala 2.80 a 156.80 abc 107.00 g 5.80 de 10.40 bc
223 JB-2 3.20 a 134.00 abc 194.60 d 4.80 e 9.20 cd
Rahmuana 3.60 a 130.80 abc 279.60 b 7.80 b 11.80 ab
202 JB 3.40 a 131.80 abc 292.20 a 7.40 bc 10.40 bc
2016 134 J.B 3.40 ab 278.00 bc 218.00 b 5.20 c 4.00 c
Moza Rajoya 3.20 ab 268.60 c 298.80 a 9.00 a 10.20 ab
Pungu Mor 2.80 b 332.80 abc 185.20 e 8.20 ab 7.20 bc
Jamya Abad 3.00 b 349.40 abc 213.80 bc 7.40 b 9.40 ab
Jandwala 3.40 ab 380.80 a 199.20 d 5.80 c 8.80 b
223 JB-2 4.20 a 292.60 bc 172.60 f 5.20 c 9.00 b
Rahmuana 3.80 ab 280.80 bc 211.40 bc 5.60 c 6.80 bc
202 JB 3.80 ab 362.00 ab 204.80 cd 5.00 c 8.00 b
129 JB 2.80 b 330.60 abc 187.20 e 7.20 b 12.60 a

Note: The means followed by the same letters in a column are not significantly different by LSD test (c level).

Table 4.

Incidence of M. graminicola at different locations of Faisalabad district.

Year Location Galling index Juveniles/root sample Juveniles/soil sample Stylet bearing nematodes Non-stylet bearing nematodes
2014 58 J.B. 2.60 b 334.80 ab 157.20 e 5.60 bc 9.00 c
218 R.B. 3.60 ab 352.20 a 131.60 g 4.80 cd 8.80 c
70 J.B. 1.40 c 340.00 a 219.80 b 4.80 cd 11.00 ab
442 G.B. 3.60 ab 332.40 ab 147.60 f 4.80 cd 10.60 abc
39 G.B. 3.00 b 266.20 b 238.00 a 6.00 abc 10.00 bc
424 G.B. 2.60 b 352.60 a 172.20 d 6.40 ab 9.20 bc
205 R.B. 3.20 ab 320.00 ab 184.00 c 7.00 a 12.00 a
UAF 4.20 a 280.80 ab 113.60 h 4.20 d 10.40 abc
2015 58 J.B. 2.60 ab 336.00 a 205.60 b 5.40 cd 9.20 c
218 R.B. 2.20 b 342.20 a 130.20 e 5.20 cd 8.80 c
70 J.B. 3.00 ab 331.00 a 137.40 e 4.20 d 9.80 bc
442 G.B. 2.40 ab 338.40 a 148.80 de 5.20 cd 9.80 bc
39 G.B. 3.20 ab 276.20 a 185.00 bc 7.80 a 10.00 bc
424 G.B. 3.80 a 339.60 a 128.60 e 4.80 cd 9.20 c
205 R.B. 2.20 b 330.60 a 308.40 a 7.00 ab 10.60 abc
UAF 3.40 ab 292.60 a 127.80 e 5.80 bc 9.40 bc
209 R.B. 2.80 ab 349.40 a 172.60 cd 8.20 a 11.80 ab
66 G.B. 2.60 ab 352.80 a 100.40 f 7.20 a 13.00 a
2016 58 J.B. 2.00 d 361.20 a 106.80 g 5.20 de 9.00 bc
218 R.B. 2.40 cd 340.00 ab 90.60 h 4.80 de 9.60 abc
70 J.B. 4.00 a 340.00 ab 190.80 b 5.20 de 10.40 abc
442 G.B. 2.20 cd 328.40 ab 168.00 c 9.00 a 10.20 abc
39 G.B. 3.20 bc 277.80 b 209.60 a 5.00 de 9.80 abc
424 G.B. 3.40 ab 394.00 a 158.80 d 7.20 abc 8.80 bc
205 R.B. 2.40 bcd 362.00 a 150.60 e 4.20 de 8.40 c
UAF 3.20 abc 380.80 a 207.00 a 6.00 bcd 9.40 abc
209 R.B. 2.80 bcd 360.40 a 120.20 f 5.40 cde 9.20 abc
66 G.B. 3.40 ab 368.60 a 162.60 d 7.60 ab 10.80 ab
71 G.B. 2.60 bcd 358.00 a 123.20 f 3.60 e 11.20 a

Note: The means followed by the same letters in a column are not significantly different by LSD test (P = 0.05 level).

The occurrence of M. graminicola on alternate hosts

The infection of M. graminicola was recorded on eleven alternate hosts. All examined alternate hosts showed varying degrees of M. graminicola infestation (Table 5). Among them, the maximum juveniles/root sample, juveniles/soil sample, number of stylet-bearing nematodes, and number of non-stylet-bearing nematodes were recovered from Echinochloa crusgalli. The lowest number of juveniles/root sample, juveniles/soil sample, and non-stylet-bearing nematodes were observed in Brassica oleracea. The lowest number of stylet-bearing nematodes was recorded in Trigonella foenum-graecum. Most of the infested fields were canal-irrigated and a few were tube-well irrigated. Both types of irrigation systems generally favor nematode attack, but nematode populations were higher for in-canal irrigation than tube-well. Most of the farmers have a wheat-rice cropping system and only a few of them use a rice-vegetable cropping system (data not shown). In cropping systems that include vegetables, nematode infection was higher on alternate hosts. Grasses like Cyperus rotundus, Dactylocteniuma egyptium, Echinochloa crusgalli, Eclipta alba, and Paspalum distichum were reported as alternate hosts for rice-vegetable cropping systems, while Avena fatua, Phalaris minor, and Rumex dentatus were recorded as alternate hosts in the rice-wheat cropping system.

Table 5.

Incidence of M. graminicola on different alternate hosts.

Sr # Local name Botanical name Juveniles /root sample Juveniles/soil sample Stylet bearing nematodes Non-stylet bearing nematodes
1 Della Cyperus rotundus 826.6 bc 145.6 b 11.2 de 6.6 b
2 Madhana Grass Dactyloctenium aegyptium 700.8 cd 100.0 de 11.2 de 4.4 cd
3 Barnyard grass Echinochloa crusgalli, 4914.6 a 424.0 a 29.6 a 9.4 a
4 False Daisy Eclipta alba 646.0 d 100.6 de 22.4 b 6.4 bc
5 Knotgrass Paspalum distchum 494.2 e 91.2 e 14.6 cd 5.4 bcd
6 Toothed Dock Rumex dentatus 783.8 cd 121.0 cd 23.0 b 4.6 bcd
7 Jangli gai Avena fatua, 776.2 cd 101.6 de 18.8 bc 5.0 bcd
8 Dumbi Sitti Phalaris minor 942.8 b 129.4 bc 8.4 e 4.0 d
9 Cauliflower Brassica oleracea 142.2 f 43.4 g 10.6 de 3.4 d
10 Coriander Coriandrum sativum L. 143.8 f 85.4 ef 10.2 de 3.6 d
11 Maithi Trigonella foenum-graecum L. 178.6 f 64.4 fg 7.6 e 5.2 bcd

Note: The means followed by the same letters in a column are not significantly different by LS D test (p = 0.05 level).

Perineal pattern-based morphological characterization

The morphological examination of perineal patterns among obtained isolates showed that they were oval to circular shaped, dorsoventral, moderate in height of the arc, and with no lateral incisures or gaps. The tail tip showed prominent, coarse, and well-separated striae. The obtained perineal patterns were similar to previously described patterns for M. graminicola (Figure 3).

Figure 3:

Figure 3:

Perineal pattern of M. graminicola by light (above) and electron (below) microscopy.

Molecular characterization through ITS amplification and sequencing

PCR amplification and sequencing yielded eight unique sequences. The isolates gave similar-sized bands of 326–328 bp on a gel stained with ethidium bromide (Figure 4). GenBank accession numbers for each of the obtained sequences are given in Tables 3–6. M. graminicola isolates JB1CT, JB2 UAF, JB3FSD1, JB3FSD2, JB3FSD3, JB3FSD4, JB3FSD5, and JB3FSD6 (accessions KX757064, 326 bp, KX757065, 328 bp, KX757066, 326 bp, KX757067, 326 bp, MH057345, 326 bp, MH057346, bp, MH057347, bp, and MH057348, 326 bp, respectively) showed 98–100% similarity with GenBank accession numbers KF250491, DQ909030, KF250491, MG773553, KF250481, KJ572383, JF949754, and DQ909040, which were previously curated as M. graminicola. The multiple-sequence alignment of the eight isolates demonstrates that there were very few single-nucleotide polymorphisms (SNPs) between the ITS sequences of these isolates (Figure 5). When trimmed for phylogenetic analysis, JB3FSD1 was no longer unique and was removed from subsequent analyses.

Figure 4:

Figure 4:

ITS rDNA PCR amplification products using forward primer rDNA2 and reverse primer rDNA1.58 s. Isolate names are given in white text on the upper side of their respective band in the gel; DNA ladder is to the left of the gel.

Table 6.

ITS sequences of M. graminicola isolates with GenBank accession numbers.

Location Elevation Latitude Altitude Isolate GenBank Accession Nucleotide
Rajoya 176 31.66198 072.97448 JB1CT KX757064.1 326 bp
UAF 179 31.43735 073.07427 JB2 UAF KX757065.1 328 bp
58 J.B 186 31.46937 072.99122 JB3FSD1 KX757066.1 326 bp
218 J.B 173 V 31.43074 072.97399 JB3FSD2 KX757067.1 326 bp
442 G.B 172 V 31.04441 073.00982 JB3FSD3 MH057345.1 326 bp
424 G.B 172 V 31.08084 073.14034 JB3FSD4 MH057346.1 326 bp
205 R.B 186 V 31.43253 073.23050 JB3FSD5 MH057347.1 326 bp
70 J.B 181 V 31.36304 72.909520 JB3FSD6 MH057348.1 326 bp

Figure 5:

Figure 5:

Multiple alignment of ITS sequences from different isolates collected in Faisalabad and Chiniot. The NCBI Genbank accession numbers and isolate names are given in the start of sequences. Complete bars at the top of the sequences show the degree of conservation of different nucleotides in the ITS sequence among different isolates. Similarly, base conservation is also denoted by the capitalized nucleotide alphabet.

Phylogenetic analysis

The Bayesian solution is presented in Figure 6. Bayesian posterior probabilities, represented as a percentage, are mapped at nodes where support is greater than 50%. The resulting phylogeny shows that six of the isolates sequenced in this study form a monophyletic clade with the other Asian isolates, including those from India, Nepal, China, and Vietnam. Isolate KX757067 belongs to an unresolved polytomy that contains isolates from Asia as well as Europe and South America. The relationships among the isolates are poorly resolved due to lack of synapomorphies. Three isolates from Pakistan, KX757067, MH057348, and MH057345, have several unique nucleotide substitutions, and thus longer branch lengths, relative to the other isolates of M. graminicola (Figure 6).

Figure 6:

Figure 6:

Phylogenetic tree of M. graminicola isolates based on ITS sequences. Sequences from this study are in bold. Taxon labels are Genbank accession numbers followed by species epithet, isolate code, and geographic location of the sequenced isolates. Scale bar represents 2% sequence divergence.

Discussion

Chiniot and Faisalabad are agriculturally important and are considered some of the most fertile districts in Central Punjab. Rice is also cultivated in these districts with rice-wheat cropping systems. The results of this study reveal variation in the prevalence and infestation rate of M. graminicola in Faisalabad and Chiniot rice fields. Several reports have documented the prevalence of M. graminicola in rice-cropping systems in different countries (Pokharel et al., 2007; Win et al., 2011; Anil et al., 2011; Pascual et al., 2014). M. graminicola has been predominantly reported from lowland production conditions of rice that are common in Chiniot and Faisalabad districts (Pokharel et al., 2007). Most of the rice fields in the present study were infested with M. graminicola that is not common in Punjab, Pakistan, because previously M. incognita has been reported as the predominant RKN prevailing in agroecosystems of Pakistan, which primarily attacks vegetable crops (Anwar et al., 2012). Faisalabad and Chiniot districts have sandy loam soil, a semiarid environment, and are located in the central region of Punjab, Pakistan. The geographic distribution of RKNs depends on environmental factors such as moisture, soil type, and temperature (Sasser and Triantaphyllou, 1977). Nematode abundance and distribution are directly influenced by soil properties and type of irrigation (Nielsen et al., 2014). Sandy soils generally show higher penetration and development of Meloidogyne spp. (Ogbuji, 2004). Soils with a higher percentage of sand had higher abundances of M. incognita (Lawrence et al., 1997). Therefore, sandy loam soil of the surveyed regions could be considered important for enhanced development and penetration of M. graminicola. RKNs are poikilothermic in nature and require elevated temperatures to increase their rates of development on different cropping systems (Van der Waals et al., 2013). The subtropical climate of Chiniot and Faisalabad districts favors the development of M. graminicola in rice-cropping systems.

Meloidogyne species have an extensive host range, including grasses, weeds, field, and vegetable crops (Sasser and Freckman, 1987). During our survey, seven alternate hosts of M. graminicola were also recorded. Plants were classified as alternate hosts based on prevalence, galling index, RKNs per g root, and RKNs per g soil. Previously, we have reported these plant species as alternate hosts of M. graminicola in Pakistan (Jabbar et al., 2016). These alternate hosts help nematodes to persist through summer and winter and act as an important reservoir of nematodes (Queneherve et al., 1995).

Morphological identification based on perineal patterns has been the standard criteria used to identify Meloidogyne species since 1949 (Chitwood, 1949). Based on light and scanning electron microscopy, the perineal pattern of isolates from Pakistan is similar to previously described patterns of M. graminicola (Yik and Birchfield, 1978; Bernard and Eisenback, 1997) with slight variation, overlapping with the patterns of M. trifoliophila and M. oryzae. However, perineal patterns alone are insufficient to confirm the identity of Meloidogyne spp. as perineal patterns for M. graminicola, M. oryzae, and M. trifoliophila may be conflated (Maas et al., 1978; Pokharel et al., 2007).

To the best of our knowledge, this is the first report of ITS sequences of M. graminicola from Pakistan. Sequence similarity analysis was concordant with morphological analyses, and phylogenetic analysis confirmed that our isolates nested well within the other M. graminicola sequences available in GenBank, confirming that they are conspecific.

Several studies have demonstrated that ITS sequencing is not only a useful diagnostic approach for Meloidogyne, Globodera, Heterodera, Longidorus, Xiphinema, and Pratylenchus spp. (Powers, 2004), but also for phylogenetic analysis of a number of species in Heterodera, Meloidogyne, and Bursaphelenchus (Hugall et al., 1999; Powers, 2004). Variability in ITS sequences among the isolates of Pakistan was also observed based on SNPs. The variability in the ITS sequences indicated that amplified ITS regions of Meloidogyne species might be useful for population studies. The variability in ITS sequences within an isolate observed in this study could be due to the presence of multiple alleles and/or multiple copies of the sequences that are reported previously in other RKN species (Powers, 2004). Indeed, the high degree of genetic diversity among the Pakistani isolates relative to other regions suggests Pakistan as a possible ancestral area for the Asian isolates of this species (Figure 6).

Our results confirmed that all Pakistani sequenced isolates of root-knot nematode collected from rice were M. graminicola. The populations are quite morphologically homogeneous, with only slight variations in morphometric characters and virulence. Our results also confirm the utility of ITS sequences to differentiate M. graminicola from other common species of RKNs and reveal considerable variation among Pakistani isolates and relative isolates from other parts of Asia. Our findings confirm the need for further studies on M. graminicola biology, genetics, and management.

Conclusion

The rice-growing fields of Chiniot and Faisalabad, Central Punjab, Pakistan are infested with M. graminicola. The subtropical climate, monoculture, high cropping intensity, and sandy loam soils of the areas surveyed likely contribute to the widespread prevalence of M. graminicola in Pakistan. M. graminicola from our survey displayed infestation on seven alternate hosts in rice-wheat and rice-vegetable cropping systems that provide an alternate means for survival in the absence of agricultural crops. We show that a combination of molecular and morphological traits is a quick and reliable means to accurately identify M. graminicola. Phylogenetic analysis and genetic diversity suggests Pakistan as a putative ancestral area. M. graminicola is a significant pest of the rice-cropping system of Central Punjab, Pakistan, warranting the adoption of necessary control measures for its management.

Acknowledgments

The authors acknowledge Dr. Farooq Ahmad, Assistant Professor, ‘COMSATS Institute of Information Technology Islamabad’ for assistance generating Figure 1. This project was supported in part by funding from the Monte L. Bean Life Science Museum and by the Higher Education Commission, Pakistan for IRSIP scholarship and HEC project 6367/21 Punjab/NRPU/R&D/HEC/2016, “Molecular characterization of rice root-knot nematode (Meloidogyne graminicola) in rice-wheat cropping system in central Punjab for its management’.

References

  1. Adam, M. A. , Phillips, M. M. S. and Block, V. C. . 2007. Molecular diagnostic key for identification of single juveniles of seven common and economically important species of root-knot nematode (Meloidogyne spp.). Plant Pathology 56:190–197. [Google Scholar]
  2. Ahmad, R. and Khan, I. U. . 1973. Root-knot of potato in West Pakistan. Plant Disease Reporter 57:505–506. [Google Scholar]
  3. Ali, M. A. , Abbas, A. , Azeem, F. , Javed, N. and Bohlmann, H. . 2015. Plant-nematode interactions: from genomics to metabolomics. International Journal of Agriculture and Biology 17:1071–1082. [Google Scholar]
  4. Ali, M. A. , Anjam, M. S. , Nawaz, M. A. , Lam, H. M. and Chung, G. . 2018. Signal transduction in plant–nematode interactions. International Journal of Molecular Sciences 19:1648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Ali, M. A. , Azeem, F. , Li, H. and Bohlmann, H. . 2017b. Smart parasitic worms use multifaceted strategies to parasitize plants. Frontiers in Plant Science 8:1699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Ali, M. A. , Azeem, F. , Abbas, A. , Joiya, F. A. , Li, H. and Dababat, A. A. . 2017a. Transgenic strategies for enhancement of nematode resistance in plants. Frontiers in Plant Science 8:750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ali, M. A. , Shahzadi, M. , Zahoor, A. , Dababat, A. A. , Toktay, H. , Bakhsh, A. , Nawaz, M. A. and Li, H. . 2019. Resistance to cereal cyst nematodes in wheat and barley: an emphasis on classical and modern approaches. International Journal of Molecular Sciences 20:432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Anil, S. , Jain, R. K. and Khajan, S. . 2011. Incidence of Meloidogyne graminicola on rice in Andaman Islands. Annals of Plant Protection Sciences 19:259–260. [Google Scholar]
  9. Anwar, S. A. and McKenry, M. V. . 2012. Incidence and population density of plant parasitic nematodes infecting vegetable crops and associated yield losses in Punjab, Pakistan. Pakistan Journal of Zoology 44:327–333. [Google Scholar]
  10. Bernard, E. C. and Eisenback, J. D. . 1997. Meloidogyne trifoliophila n. sp. (Nemata: Meloidogynidae), a parasite of clover from Tennessee. Journal of Nematology 29:43. [PMC free article] [PubMed] [Google Scholar]
  11. Blok, V. C. and Powers, T. O. . 2009. “Biochemical and molecular identification”, In Perry, R. N. , Moens, M. and Starr, J. L. (Eds), Root-knot Nematodes CABI Publishing, Wallingford, pp. 98–112. [Google Scholar]
  12. Bridge, J. , Plowright, R. A. and Peng, D. . 2005. “Nematode parasites of rice”, In Luc, M. , Sikora, R. A. and Bridge, J. (Eds), Plant Parasitic Nematodes in Subtropical and Tropical Agriculture, 2nd Ed., CABI Publishing, Wallingford, pp. 87–130. [Google Scholar]
  13. Camacho, C. , Coulouris, G. , Avagyan, V. , Ma, N. , Papadopoulos, J. , Bealer, K. and Madden, T. L. . 2009. BLAST+: architecture and applications. BMC Bioinformatics 10:421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Cherry, T. , Szalanski, A. L. , Todd, T. C. and Powers, T. O. . 1997. The internal transcribed spacer region of Belonolaimus (Nemata: Belonolaimidae). Journal of Nematology 29:23. [PMC free article] [PubMed] [Google Scholar]
  15. Chitwood, B. G. 1949. Root-knot nematodes, part I. A revision of the genus Meloidogyne Goeldi, 1887. Proceedings of the Helminthological Society of Washington 16:90–104. [Google Scholar]
  16. Das, K. , Zhao, D. , De Waele, D. , Tiwari, R. K. S. , Shrivastava, D. K. and Kumar, A . 2011. Reactions of traditional upland and aerobic rice genotypes to rice root knot nematode (Meloidogyne graminicola). Journal of Plant Breeding and Crop Science 3:131–113. [Google Scholar]
  17. Edgar, R. C. 2004. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32:1792–1797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Eisenback, J. D. 1985. “Diagnostic characters useful in the identification of the four most common species of root-knot nematodes (Meloidogyne spp.)”, In Sasser, J. N., Carter, C. C. (Eds), An advanced treatise on Meloidogyne, Vol. 1, Raleigh/North Carolina State University Graphics, pp. 95–112.
  19. FAO 2017. Food and Agricultural Organization, available at: http://www.fao.org/faostat/en/#compare (accessed November 1, 2017).
  20. Hu, M. and Gasser, R. B. . 2006. Mitochondrial genomes of parasitic nematodes–progress and perspectives. Trends in Parasitology 22:78–84. [DOI] [PubMed] [Google Scholar]
  21. Hugall, A. , Stanton, J. and Moritz, C. . 1999. Reticulate evaluation and the origins of ribosomal internal transcribed spacer diversity in apomictic Meloidogyne . Molecular Biology and Evolution 16:157–164. [DOI] [PubMed] [Google Scholar]
  22. Huelsenbeck, J. P. and Ronquist., F. . 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17:754–755. [DOI] [PubMed] [Google Scholar]
  23. Jabbar, A. , Javed, N. , Munir, A. , Khan, S. A. and Abbas, H. . 2016. New host record of root-knot nematode (Meloidogyne graminicola) in Pakistan. Pakistan. Journal of Nematology 34:101. [Google Scholar]
  24. Jepson, S. B. 1987. Identification of root-knot nematodes (Meloidogyne species) CAB International, Wallingford. [Google Scholar]
  25. Kafi, A. 1963. Plant parasitic nematodes in Pakistan. FAO Technical Bulletin No. 32.
  26. Khan, H. U. , Mukhtar, T. and Ahmad, R. . 2005. Geographical distribution of root-knot nematodes (Meloidogyne spp.) in the Punjab Province of Pakistan. Pakistan Journal of Nematology 23:133–140. [Google Scholar]
  27. Khattak, B. 2008. Biological management of root knot nematode Meloidogyne javanica (Treub) with Trichoderma harzianum Rifai in tomato. PhD dissertation, Khyber Pakhtunkhwa Agricultural University, Peshawar.
  28. Kyndt, T. , Fernandez, D. and Gheysen, G. . 2014. Plant-parasitic nematode infections in rice: molecular and cellular insights. Annual Reviews of Phytopathology 52:135–153. [DOI] [PubMed] [Google Scholar]
  29. Landa, B. B. , Rius, J. E. P. , Vovlas, N. , Carneiro, R. M. D. G. , Maleita, C. M. N. , Abrantes, I. M. de, O. and Castillo, P. . 2008. Molecular characterization of Meloidogyne hispanica (Nematoda, Meloidogynidae) by phylogenetic analysis of genes within the rDNA in Meloidogyne spp. Plant Disease 92:1104–1110. [DOI] [PubMed] [Google Scholar]
  30. Lawrence, G. W. , McLean, K. S. and Hankins, G. . 1997. Root-knot and reniform nematodes associated with cotton production in Mississippi. Proceedings of Beltwide Cotton Conference, New Orleans, LA. National Cotton Council of America, Memphis, TN, pp. 98–99.
  31. Maas, P. W. , Sanders, H. and Dede, J. . 1978. Meloidogyne oryzae n. sp. (Nematoda, Meloidogynidae) infesting irrigated rice in Surinam (South America). Nematologica 24:305–312. [Google Scholar]
  32. Mantelin, S. , Bellafiore, S. and Kyndt, T. . 2017. Meloidogyne graminicola: a major threat to rice agriculture. Molecular Plant Pathology 18:3–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. McClure, M. A. , Nischwitz, C. , Skantar, A. M. , Schmitt, M. E. and Subbotin, S. A. . 2012. Root-knot nematodes in Golf Course Greens of the Western United States. Plant Disease 96:635–647. [DOI] [PubMed] [Google Scholar]
  34. Mitkowski, N. A. , Van Der Breek, J. G. and Abawi, G. S. . 2003. Characterization of root-knot nematode populations associated with vegetables in New York State. Plant Disease 86:840–847. [DOI] [PubMed] [Google Scholar]
  35. Moens, M. and Perry, R. N. . 2009. Migratory plant endoparasitic nematodes: a group rich in contrasts and divergence. Annual Review of Phytopathology 47:313–332. [DOI] [PubMed] [Google Scholar]
  36. Munir, A. and Bridge, J. . 2003. Rice root-knot nematode Meloidogyne graminicola Golden and Birchfield, 1965 from rice in Pakistan. Pakistan Journal of Nematology 21:133–135. [Google Scholar]
  37. Naz, I. , Palomares-Rius, J. E. , Blok, V. , Saifullah, S. A. and Ahmed, M. . 2012. Prevalence, incidence and molecular identification of root-knot nematodes of tomato in Pakistan. African Journal of Biotechnology 11:16546–16556. [Google Scholar]
  38. Nielsen, U. N. , Ayres, E. , Wall, D. H. , Li, G. , Bardgett, R. D. , Wu, T. and Garey, J. R. . 2014. Global-scale patterns of assemblage structure of soil nematodes in relation to climate and ecosystem properties. Global Ecology and Biogeography 23:968–978. [Google Scholar]
  39. Niu, J. H. , Jian, H. , Guo, Q. X. , Chen, C. L. , Wang, X. Y. , Liu, Q. and Guo, Y. D. . 2011. Evaluation of loop-mediated isothermal amplification (LAMP) assays based on 5S rDNA-IGS2 regions for detecting Meloidogyne enterolobii. Plant Pathology 61:809–819. [Google Scholar]
  40. Norton, D. C. 1978. Ecology of plant parasitic nematodes 268 Wiley, New York, NY. [Google Scholar]
  41. Ogbuji, R. O. 2004. Soil depth distribution of the root-knot nematode (Meloidogyne incognita) from two farmlands in a humid tropical environment. Geo Journal 5:79–80. [Google Scholar]
  42. Padgham, J. L. , Duxbury, J. M. , Mazid, A. M. , Abawi, G. S. and Hossain, H. . 2004. Yield loss caused by Meloidogyne graminicola on lowland rainfed rice in Bangladesh. Journal of Nematology 36:42–48. [PMC free article] [PubMed] [Google Scholar]
  43. Panwar, M. S. and Rao, Y. S. . 1998. “Status of phytonematodes as pests of rice”, In Trivedi, P. C. (Ed.), Nematode disease in plant”, CBS Publishers and Distributors, New Delhi, pp. 49–81. [Google Scholar]
  44. Pascual, M. L. D. , Decraemer, W. , De Ley, I. T. , Vierstraete, A. , Steel, H. and Bert, W. . 2014. Prevalence and characterization of plant-parasitic nematodes in lowland and upland rice agro-ecosystems in Luzon, Philippines. Nematropica 44:166–180. [Google Scholar]
  45. Pokharel, R. R. , Abawi, G. S. , Zhang, N. , Duxbury, J. M. and Smart, C. D. . 2007. Characterization of isolates of Meloidogyne from rice-wheat production fields in Nepal. Journal of Nematology 39:221. [PMC free article] [PubMed] [Google Scholar]
  46. Posada, D. and Crandall, K. A. . 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14:817–818. [DOI] [PubMed] [Google Scholar]
  47. Powers, T. O. 2004. Nematode molecular diagnostics: from bands to barcodes. Annual Review of Phytopathology 42:367–383. [DOI] [PubMed] [Google Scholar]
  48. Queneherve, P. , Drob, F. and Topart, P. . 1995. Host status of some weeds to Meloidogyne spp., Pratylenchus spp., Helicotylenchus spp. and Rotylenchulus reniformis associated with vegetables cultivated in polytunnels in Martinique. Nematropica 25:149–157. [Google Scholar]
  49. Saeed, M. and Ashrafi, S. H. . 1973. On the occurrence of some plant parasitic nematodes with special reference to new hosts in West Pakistan. Pakistan Journal of Scientific and Industrial Research 16:128–129. [Google Scholar]
  50. Sasser, J. N. and Freckman, D. W. . 1987. “A world perspective on nematology: the role of the society”, In Veech, J. A. and Dickson, D. W. (Eds), Vistas on Nematology Society of Nematologists, Hyattsville, MD, pp. 7–14. [Google Scholar]
  51. Sasser, J. N. and Triantaphyllou, A. C. . 1977. Identification of Meloidogyne species and races. Journal of Nematology 9:283. [PMC free article] [PubMed] [Google Scholar]
  52. Seck, P. A. , Diagne, A. , Mohanty, S. and Wopereis, M. C. . 2012. Crops that feed the world 7: Rice. Food Security 4:7–24. [Google Scholar]
  53. Thompson, J. D. , Higgins, D. G. and Gibson, T. J. . 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acid Research 22:4673–4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Van der Waals, J. E. , Krüger, K. , Franke, A. C. , Haverkort, A. J. and Steyn, J. M. . 2013. Climate change and potato production in contrasting South African agro-ecosystems 3. Effects on relative development rates of selected pathogens and pests. Potato Research 56:67–84. [Google Scholar]
  55. Vrain, T. C. , Wakarchuk, D. A. , Levesque, A. C. and Hamilton, R. I. . 1992. Intraspecific rDNA restriction fragment length polymorphism in the Xiphinema americanum group. Fundamental and Applied Nematology 15:563–573. [Google Scholar]
  56. Whitehead, A. G. and Hemming, J. R. . 1965. A comparison of some quantitative methods of extracting small vermiform nematodes from soil. Annals of Applied Biology 55:25–38. [Google Scholar]
  57. Williamson, V. M. and Hussey, R. S. . 1996. Nematode pathogenesis and resistance in plants. Plant Cell 8:1735–1745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Win, P. P. , Kyi, P. P. and De Waele, D. . 2011. Effect of agro-ecosystem on the occurrence of the rice root-knot nematode Meloidogyne graminicola on rice in Myanmar. Australasian Plant Pathology 40:187–196. [Google Scholar]
  59. Win, P. P. , Kyi, P. P. , Maung, Z. T. Z. and De Waele, D. . 2013. Evaluation of the host response of lowland and upland rice varieties from Myanmar to the rice root-knot nematode Meloidogyne graminicola . Archives of Phytopathology and Plant Protection 47:869–891. [Google Scholar]
  60. Win, P. P. , Kyi, P. P. , Maung, Z. T. Z. , Myint, Y. Y. and De Waele, D. . 2015. Comparison of the damage potential and yield loss of the rice root-knot nematode, Meloidogyne graminicola, on lowland and upland rice varieties from Myanmar. Russian Journal of Nematology 23:53–72. [Google Scholar]
  61. Yik, C. P. and Birchfield, W. . 1978. Scanning electron microscopy of perineal patterns of three species of Meloidogyne . Journal of Nematology 10:118. [PMC free article] [PubMed] [Google Scholar]
  62. Zarina, B. and Shahina, F. . 2010. Research work carried out on the management of root-knot nematode diseases in Pakistan. Pakistan Journal of Nematology 28:153–239. [Google Scholar]

Articles from Journal of Nematology are provided here courtesy of Society of Nematologists

RESOURCES