Skip to main content
Journal of Nematology logoLink to Journal of Nematology
. 2021 Feb 2;52:e2020-128. doi: 10.21307/jofnem-2020-128

Hemicycliophora ahvasiensis n. sp. (Nematoda: Hemicycliophoridae), and data on a known species, from Iran

Sedighe Azimi 1,*, Joaquín Abolafia 2, Majid Pedram 3
PMCID: PMC8015286  PMID: 33829170

Abstract

Hemicycliophora ahvasiensis n. sp., recovered from the rhizospheric soil of date palm in Khuzestan province, southwest Iran, is described and illustrated based upon morphological, morphometric and molecular data. The new species is characterized by its sheath, closely fitting most of the body, cuticle with or without numerous irregular lines, sometimes appearing as blocks in distal body region. Lateral field without discrete longitudinal lines, but often with continuous broken striae or anastomoses. Continuous lip region with single annulus, slightly elevated labial disc, stylet with posteriorly sloping knobs. Vulva with or without slightly modified lips, spermatheca with sperm and tail conoid, symmetrically narrowing at distal region to form a narrow conical region. Morphologically, the new species looks similar to H. indica, H. labiata, H. siddiqii, H. tenuistriata and H. typica. The latter species appears more similar to the new species under light microscopy, but could be separated using the scanning electron microscopy and molecular data. The new species was also compared with H. epicharoides and H. dulli, two species with close phylogenetic affinities to it. The phylogenetic relationships of the new species were reconstructed and discussed using partial sequences of the D2-D3 expansion segments of large subunit, and internal transcribed spacer regions (LSU D2-D3 and ITS rDNA). Hemicycliophora conida, the second studied species, was recovered from north Iran and characterized by morphological and molecular data.

Keywords: D2-D3-LSU, Hemicycliophora, H. conida, ITS, morphology, morphometrics, phylogeny, sheath nematode, taxonomy


In their excellent contribution to the systematics of the superfamily Hemicycliophoroidea Skarbilovich, 1959 (Siddiqi, 1980), Chitambar and Subbotin (2014) reviewed the taxonomy of the genus Hemicycliophora (De Man, 1921) and updated data of the currently valid species. In the same year, Subbotin et al. (2014) addressed aspects of the pathogenicity of Hemicycliophora species on associated host plants, the difficulties of morphological identifications due to morphological plasticity, and the lack of scanning electron microscopic (SEM) and molecular data. Currently the genus contains 133 species (132 listed in Chitambar and Subbotin, 2014 and one in Maria et al., 2018).

There are 12 species of Hemicycliophora have been reported from different provinces in Iran. They are H. belemnis Germani & Luc, 1973, H. chilensis Brzeski, 1974, H. conida Thorne, 1955, H. iranica Loof, 1984, H. lutosa Loof & Heyns, 1969, H. megalodiscus Loof, 1984, H. poranga Monteiro & Lordello, 1978, H. ripa Van den Berg, 1981, H. sculpturata Loof, 1984, H. spinituberculata Loof, 1984, H. sturhani Loof, 1984 and H. vaccinii Reed & Jenkins, 1963. All of these species were characterized using traditional taxonomic methods (Eskandari, 2018). In an effort to document Hemicycliophora species occurring in Iran, two populations were recovered from soil samples obtained from different geographical locations in northern and southern regions. The preliminary morphological studies revealed the population recovered from south Iran resembled H. typica de Man, 1921 under light microscope (LM), but further studies using SEM and molecular data, and comparisons with all known species of the genus, revealed it to be an unknown species, described herein as H. ahvasiensis n. sp. The second species recovered from north Iran belonged to H. conida Thorne, 1955.

Materials and methods

Nematode extraction and morphological observations

Several soil samples were collected from date palm and fruit tree gardens in Khuzestan and Gilan provinces, Iran. The relevant information of the presently studied nematode populations, and those included in phylogenetic analyses, are given in Table 1. Jenkins’ method (Jenkins, 1964) was used to extract the nematodes from soil samples. The collected specimens were killed in hot 4% formaldehyde solution and transferred to anhydrous glycerin according to De Grisse (1969). Observations and measurements were conducted using a Leitz SM-LUX light microscope equipped with a drawing tube. Some of the specimens were photographed using an Olympus DP72 digital camera attached to an Olympus BX51 light microscope equipped with differential interference contrast (DIC).

Table 1.

Information of the species/populations of Hemicycliophora studied in present paper and those of ingroup and outgroup taxa used in phylogenetic analyses.

GenBank accession numbers
Species Host Locality D2-D3 of LSU rDNA ITS Reference or identifier
H. ahvasiensis n. sp. Phoenix dactylifera Khuzestan province, Iran MT901580, MT901581 MT901582, MT901583 Present study
H. californica Salix sp. Yolo County, CA, USA KF430518, KF430519 KF430576 Subbotin et al. (2014)
H. conida Punica granatum Gilan province, Iran MT901584 Present study
H. conida Unknown plant Belgium FN433875 I. Tandingan De Ley et al. (unpub.)
H. conida Turf grasses Football pitch, Madrid, Spain KF430447 KF430580 P. Castillo; Subbotin et al. (2014)
H. conida Unknown plant Clallam County, WA, USA KF430448 KF430579 Subbotin et al. (2014)
H. dulli Peat South Africa MT329669, MT329670 MT329671, MT329672 M. Rashidifard (unpub.)
H. epicharoides Ammophila arenaria Serranova, Brindisi, Italy KF430512 Subbotin et al. (2014)
H. epicharoides Ammophila arenaria S. Barrameda, Cádiz, Spain KF430608 Subbotin et al. (2014)
H. epicharoides Pragmites sp. Epiros, Greece KF430606 Subbotin et al. (2014)
H. floridensis Pinus elliotti Lake City, FL, USA KF430506 KF430536 Subbotin et al. (2014)
H. gracilis Prunus domestica Hamilton City, Glenn County, CA, USA KF430480 KF430562 Subbotin et al. (2014)
H. gracilis Prunus domestica Butte City, Glenn County, CA, USA KF430481 Subbotin et al. (2014)
H. gracilis Unknown plant Brooklyn Park, MN, USA KF430482 Subbotin et al. (2014)
H. gracilis Unknown plant California, USA FN435301 I. Tandingan De Ley et al. (unpub.)
H. gracilis Unknown plant Sacramento County, CA, USA MG019827 Van den Berg et al. (2018)
H. halophila Desmoschoenus spiralis Taylors Mistake, New Zealand KF430444, KF430445 KF430582, KF430583 Subbotin et al. (2014)
H. hellenica Arundo donax Filippias, Epirus, Greece KF430453 KF430584 Subbotin et al. (2014)
H. iberica Populus nigra Arroyo Frío, Jaén, Spain KF430461 KF430539, KF430540 Subbotin et al. (2014)
H. iberica Quercus suber Hinojos, Huelva, Spain KF430462 Subbotin et al. (2014)
H. iberica Quercus suber Santa Elena, Jaén, Spain KF430463 KF430541 Subbotin et al. (2014)
H. italiae Ammophila arenaria Zapponeta, Foggia, Italy KF430458 Subbotin et al. (2014)
H. labiata Poa pratensis South Korea MK305971, MK305972 MK305973, MK305974 Mwamula et al. (2020)
H. lutosa Unknown plant Gauteng province, South Africa GQ406240, GQ406241 GQ406237 Van den Berg et al. (2010)
H. lutosoides Turf grasses Madrid, Spain KF430454 Subbotin et al. (2014)
H. lutosoides Juncus sp. Cádiz, Spain KF430537, KF430538 Subbotin et al. (2014)
H. obtusa Pinus pinea Moguer, Huelva, Spain KF430521 KF430578 Subbotin et al. (2014)
H. onubensis1 Pinus pinea Moguer, Huelva, Spain KF430449, KF430450 KF430587, KF430588 Subbotin et al. (2014); Van den Berg et al. (2018)
H. parvana2 Turf grasses New Hanover County, NC, USA KF430501 Subbotin et al. (2014); Van den Berg et al. (2018)
H. parvana2 Turf grasses Carteret County, NC, USA KF430502 Subbotin et al. (2014); Van den Berg et al. (2018)
H. parvana2 Bentgrass Texas, USA KC329574 KC329575 Ma and Agudelo (2015)
H. parvana Prunus persica Punta Gorda, FL, USA MG019825 Van den Berg et al. (2018)
H. parvana2 Andropogon virginicus Paines Praire, FL, USA KF430524, KF430526 Subbotin et al. (2014); Van den Berg et al. (2018)
H. parvana2 Turf grasses New Hanover County, NC, USA KF430528 Subbotin et al. (2014); Van den Berg et al. (2018)
H. poranga Poa annua Monterey County, CA, USA KF430432, KF430434 KF430598 Subbotin et al. (2014)
H. poranga Turf grasses San Francisco, CA, USA MG019815 Van den Berg et al. (2018)
H. poranga Unknown plants Marin County, CA, USA MG019816 Van den Berg et al. (2018)
H. poranga Salix sp. Santa Rosa, CA, USA KF430590 Subbotin et al. (2014)
H. poranga Apium graveolens Argentina KF430596 Subbotin et al. (2014)
H. poranga Lepidorrhachis mooreana San Francisco, CA, USA KF430600 Subbotin et al. (2014)
H. raskii Grasses Sacramento County, CA, USA KF430520 KF430577 Subbotin et al. (2014)
H. robbinsi3 Turf grasses Brunswick, NC, USA KF430488, KF430492 Subbotin et al. (2014); Van den Berg et al. (2018)
H. robbinsi3 Turf grasses Indian Hills, CA, USA KF430491 Subbotin et al. (2014); Van den Berg et al. (2018)
H. robbinsi3 Turf grasses San Antonio, TX, USA KF430544 Subbotin et al. (2014); Van den Berg et al. (2018)
H. robbinsi3 Borrichia sp. St Augustine, FL, USA KF430550 Subbotin et al. (2014); Van den Berg et al. (2018)
H. robbinsi3 Phoenix roebelenii Fort Lauderdale, FL, USA KF430552 Subbotin et al. (2014); Van den Berg et al. (2018)
H. signata Grasses Chemba District, Mozambique MG019824 Van den Berg et al. (2018)
H. similis Fragaria x ananassa Cartaya, Huelva, Spain KF430465 Subbotin et al. (2014)
H. subbotini Cinnamomum camphora Zhejiang Province, China MG701275–MG701277 MG701272, MG701273 Maria et al. (2018)
H. thienemanni Salix sp. Moscow, Russia KF430469–KF430471 KF430570–KF430572 Subbotin et al. (2014)
H. thienemanni Populus nigra Castillo de Locubin, Jaén, Spain KF430568 Subbotin et al. (2014)
H. thornei Vitis vinifera La Rambla, Córdoba, Spain KF430452 KF430581 Subbotin et al. (2014)
H. typica Grasses Gauteng province, South Africa KF430515 KF430603 Subbotin et al. (2014)
H. typica Sugarcane South Africa GQ406238, GQ406239 Van den Berg et al. (2010)
H. vaccinii Pinus pinaster Carnota, Coruña, Spain KF430542 Subbotin et al. (2014)
H. vaccinii Pinus pinaster Monteagudo Isl., Pontevedra, Spain KF430459, KF430460 Subbotin et al. (2014)
H. vidua Camellia sp. South Carolina, USA JQ708147 Cordero López et al. (2013)
Hemicycliophora sp. Unknown plant Iran KY284835 E. Miraeiz, R. Heydari (unpub.)
Hemicycliophora sp. 1 Grasses Terovo, Epirus, Greece AY780974 KF430602 Subbotin et al. (2005); Subbotin et al. (2014)
Hemicycliophora sp. 2 Unknown plant Birdlings Flat, New Zealand KF430516, KF430517 KF430609, KF430610 Subbotin et al. (2014)
Hemicycliophora sp. 3 Zea mays Tingle Farms, Willcox, AZ, USA KF430573, KF430574 Subbotin et al. (2014)
Hemicycliophora sp. 5 Turf grasses Carteret County, NC, USA KF430575 Subbotin et al. (2014)
Hemicycliophora sp. 6 Nothofagus forest Kaitoke Waterworks, New Zealand KF430446 KF430585, KF430586 Subbotin et al. (2014)
Hemicycliophora sp. 7 Pinus pinea Almonte, Huelva, Spain KF430451 KF430589 Subbotin et al. (2014)
Hemicycliophora sp. 8 Unknown plant Henrieville, UT, USA KF444173 Subbotin et al. (2014)
Hemicycliophora sp. 8 Turf grasses Monterey, CA, USA KF430494 KF430559 Subbotin et al. (2014)
Hemicycliophora sp. 9 Trifolium repens Preveza, Greece KF430509, KF430511, KF430514 KF430605 Subbotin et al. (2014)
Hemicycliophora sp. 9 Agrostis sp. Jaroslavl region, Russia KF430604 Subbotin et al. (2014)
Hemicycliophora sp. 9 Unknown plant Brake, Germany AY780973 Subbotin et al. (2005); Subbotin et al. (2014)
Hemicycliophora sp. 10 Salix sp. Yolo County, CA, USA KF430483, KF430485–KF430486 KF430566, MG019828 Subbotin et al. (2014); Van den Berg et al. (2018)
Hemicycliophora sp. 11 Andropogon virginicus Paines Prairie, FL, USA KF430493 KF430557, KF430558 Subbotin et al. (2014)
Hemicycliophora sp. 12 Grasses Saint Paul, MN, USA KF430474 Subbotin et al. (2014)
Hemicycliophora sp. 12 Unknown plant Brooklyn Park, MN, USA KF430475 Subbotin et al. (2014)
Hemicycliophora sp. 12 Unknown plant Sedona, AZ, USA KF430476 Subbotin et al. (2014)
Hemicycliophora sp. 13 Neoregelia sp. Los Angeles County, CA, USA KF430507, KF430508 Subbotin et al. (2014)
Hemicycliophora sp. 15 Unknown plant Vicinity of Trois–Rivières, Quebec, Canada MG019819 Van den Berg et al. (2018)
Hemicycliophora sp. 16 Unknown tree east of Temecula, CA, USA MG019818 MG019829 Van den Berg et al. (2018)
Hemicycliophora sp. 17 Unknown tree Pismo Beach, San Luis Obispo County, CA, USA MG019830 Van den Berg et al. (2018)
Hemicycliophora sp. 18 Unknown plant Vicinity of Quebec City, Quebec, Canada MG019820 Van den Berg et al. (2018)
Gracilacus bilineata Bambusa sp. Taiwan EU247525 Chen et al. (2008)
Paratylenchus bukowinensis Unknown plant Monopoli, Italy AY780943 Subbotin et al. (2005)
Paratylenchus minutus Annona squamosa Taiwan EF126180 Chen et al. (2009)
Paratylenchus nanus Unknown plant Niebüll, Germany AY780946 Subbotin et al. (2005)
Trophotylenchulus floridensis Pinus elliottii Crystal river, Florida, USA JN112261 Tanha Maafi et al. (2012)

Note: 1Originally identified as H. ripa 2Originally identified as H. wyei 3Originally identified as Hemicycliophora sp. 4.

Scanning electron microscopy (SEM)

Specimens preserved in glycerin were selected for observation according to Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded mixture of ethanol-acetone series, critical point-dried with liquid carbon dioxide, and coated with gold. The mounts were examined with a Zeiss Merlin microscope (5 kV).

DNA extraction, PCR and sequencing

For molecular analyses, single female specimens were picked out, examined in a drop of distilled water on a temporary slide under the light microscope, transferred to 3 μl of TE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0) on a clean slide, and then crushed using a cover slip. The suspension was collected by adding 20 μl TE buffer. One DNA sample for the Gilan population and two DNA samples for the Khuzestan population were prepared in this manner. The DNA samples were stored at –20°C until used as a PCR template. Primers for LSU rDNA D2-D3 amplification were forward primer D2A (5’–ACAAGTACCGTGAGGGAAAGT–3’) and reverse primer D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (Nunn, 1992). Primers for amplification of ITS rDNA were forward primer TW81 (5’–GTTTCCGTAGGTGAACCTGC–3’) and reverse primer AB28 (5’–ATATGCTTAAGTTCAGCGGGT–3’) as described in Vovlas et al. (2008). The 25 μl PCR mixture contained 14.5 μl of distilled water, 3 μl of 10 × PCR buffer, 0.5 μl of 10 mM dNTP mixture, 1.5 μl of 50 mM MgCl2, 1 μl of each primer (10 pmol/μl), 0.5 μl of Taq DNA polymerase (Cinna Gen, Tehran, Iran, 5 U/μl), and 3 μl of DNA template. The thermal cycling program was as follows: denaturation at 95°C for 4 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 52°C for 40 s, and extension at 72°C for 80 s. A final extension was performed at 72°C for 10 min. Amplification success was evaluated by electrophoresis on 1% agarose gel (Aliramaji et al., 2018, 2020). The PCR products were purified using the QIAquick PCR purification kit (Qiagen®) following the manufacturer’s protocol and sequenced directly using the PCR primers with an ABI 3730XL sequencer (Bioneer Corporation, South Korea). The newly obtained sequences of the studied species were deposited into the GenBank database (accession numbers LSU D2-D3 MT901580/MT901581 and ITS rDNA MT901582 /MT901583 for the new species and MT901584 for ITS rDNA of H. conida, as indicated in Table 1).

Table 2.

Morphometrics of Hemicycliophora ahvasiensis n. sp. from Khuzestan province, Iran.

Character Female holotype Female paratypes Juvenile
n 1 20 1
L 868.7 830.3 ± 48.3 (767–893) 600
a 22.2 21.5 ± 2.1 (17.9–24.5) 18.0
b 5.9 5.8 ± 0.3 (5.4–6.5) 4.8
c 10.7 10.1 ± 1.2 (8.3–11.5) 9.8
c' 2.9 3.0 ± 0.3 (2.5–3.5) 2.6
o 11.5 12.2 ± 0.9 (9.4–15.3) 9.0
DGO 7.9 8.1 ± 0.9 (7.4–10.0) 5.5
V 85.5 84.1 ± 0.9 (82.6–85.5)
St 68.4 66.5 ± 2.3 (63.3–71.0) 60.8
m 81.5 80.6 ± 1.4 (77.4–83.7) 80.7
Stylet knob height 4 4.1 ± 0.5 (4–5) 3.8
Stylet knob width 7 6.6 ± 0.7 (6–8) 6.6
Excretory pore from anterior end 171 168.3 ± 6.1 (159–180) 168
Diam. at mid-body 39 38.4 ± 3.6 (32–46) 33
Diam. at anus (ABD) 27 26.8 ± 1.7 (24–29) 23
Diam. at vulva 38 38.4 ± 2.1 (35–43)
Vulva-anterior body distance 744 700 ± 43 (653–751)
Vulva-tail terminus distance 125 129.5 ± 6.0 (113–142)
Spermatheca-vulva distance 89 87.6 ± 13.2 (74–121)
Lip diam. 15 15.7 ± 0.9 (14–18) 14
Lip height 7 6.7 ± 0.7 (6–9) 6
First body annulus diam. 16 16.9 ± 0.9 (15–19) 15
Second body annulus diam. 18 18.6 ± 1.1 (16–21) 16
Pharynx length 145 142.6 ± 4.8 (134–151) 125
Annulus width 4 4.1 ± 0.3 (3.4–4.7) 2.8
Tail length 81 83.3 ± 7.9 (74–92) 61
V-anus distance 45 47.9 ± 9.9 (32–64)
R 245 221.3 ± 8.6 (212–247) 216
RSt 19 19.5 ± 1.1 (18–21) 22
Rph 41 41.1 ± 3.2 (35–48) 46
Rex 48 47.4 ± 3.6 (42–50) 58
RV(ant) 193 185.3 ± 8.4 (167–198)
RV 52 47.8 ± 6.9 (38–59)
RVan 15 15.0 ± 3.8 (10–22)
Ran 37 32.9 ± 4.9 (25–47)
VL/VB 3.3 3.4 ± 0.3 (2.8–3.9)
Spermatheca length 29 19.8 ± 5.4 (14–29)
Spermatheca diam. 15 15.5 ± 1.6 (12–22)
St%L 7.8 7.9 ± 0.4 (7.5–8.4) 10

Phylogenetic analyses

The newly obtained sequences of the D2-D3 fragments of LSU rDNA of the both populations, and the selected sequences from GenBank, were aligned by Clustal X2 (http://www.clustal.org/) using the default parameters. The ITS dataset was aligned using MUSCLE as implemented in MEGA6 (Tamura et al., 2013). The editing of both alignments was performed manually. The outgroup taxa were chosen according to previous studies (Subbotin et al., 2014; Van den Berg et al., 2018; Maria et al., 2018). The base substitution model was selected using MrModeltest 2 (Nylander, 2004) based on the Akaike information criteria. A general time reversible model, including among-site rate heterogeneity and estimates of invariant sites (GTR + G + I), was selected for the both phylogenies.

The Bayesian analysis was performed to infer the phylogenetic trees using MrBayes v3.1.2 (Ronquist and Huelsenbeck, 2003), running the chains for two million generations. After discarding burn-in samples and evaluating convergence, the remaining samples were retained for further analyses. The Markov chain Monte Carlo (MCMC) method within the Bayesian framework were used to determine equilibrium distribution and help estimate the posterior probabilities of the phylogenetic trees (Larget and Simon, 1999) using the 50% majority rule. Bayesian posterior probability (BPP) values higher than 0.50 are given on appropriate clades. The output files of the phylogenetic program was visualized using Dendroscope v3.2.8 (Huson and Scornavacca, 2012) and re-drawn in CorelDRAW software version 17.

Results

Systematics

Hemicycliophora ahvasiensis n. sp.(Figures 1–4; Table 2).

Description

Female

Body straight to slightly ventrally arcuate following heat fixation. Cuticular sheath closely appressed over entire or most of body. Under LM, annuli rounded, with or without longitudinal lines, appearing as blocks mostly in the distal body region. Block-like differentiations are more prominent in distal body region under SEM. Lateral field with no longitudinal lines, but having broken or continuous striae or anastomoses. Amphidial openings large, partly plugged. Lip region continuous with body contour, bearing one wide annulus. Labial disc slightly elevated. Stylet with posteriorly sloping knobs, having moderate to large cavity at base. Pharynx criconematoid, with pharyngeal corpus absent, metacorpus (median bulb) ovoid bearing central valves, short isthmus surrounded by the nerve ring and reduced pyriform basal bulb. Cardia short, surrounded by intestinal tissue. Excretory pore five to 10 annuli posterior to the pharynx base. Hemizonid indistinct. Reproductive system monodelphic-prodelphic, outstretched, composed by long ovary with oocytes arranged in one or two rows, spermatheca round to oval, filled with spheroid sperm cells, vulva with not or slightly modified lips, vulval sleeve slightly elongate, one to two annuli long. Body portion behind vulva slightly narrowing towards distal region. Distance between vulva to anus about five anal body diam. Tail conoid, symmetrically narrowing at about 35% of its length at distal region to form a narrower conical section ending to a finely rounded to sharp terminus.

Male

Not found.

Juvenile

One juvenile specimen was found in the population that is similar to female except by a smaller body size and undeveloped sexual organs.

Type host and locality

This population was recovered from the rhizospheric soil of date palm (Phoenix dactylifera L.) collected from Ahvaz city in Khuzestan province, southwest Iran. The GPS information of the sampling site is 31°18´11.1˝N, 48°39´10.1˝E.

Etymology

The specific epithet of the new species refers to the original city name in Latin where it was discovered.

Type material

The holotype and 12 paratype females were deposited into the nematology laboratory of the Department of Plant Protection, Shahid Chamran University of Ahvaz, Ahvaz, Iran. Three paratype females deposited at the Wageningen Nematode Collection (WaNeCo), Wageningen, The Netherlands. Two paratype females deposited at the Nematode Collection of the Department of Animal Biology, Plant Biology and Ecology of the University of Jaén, Jaén, Spain. The ZooBank Life Science Identifier (LSID) for this publication is as follows: http://zoobank.org/urn:lsid:zoobank.org:pub:EEF9C9E9-90B8-4EC1-8BD9-A403FD8D58E4.

Diagnosis and relationships

Hemicycliophora ahvasiensis n. sp. is mainly characterized by a cuticle with or without longitudinal lines on annuli. Instead of lateral lines there may be broken or continuous striae or anastomoses on lateral sides of the body. The lip region is continuous with body contour and has a single annulus, slightly elevated labial disc, and plugged amphidial openings. Other characters include posteriorly sloping stylet knobs, vulva with or without slightly modified lips and short vulval sleeve, spermatheca full of sperm and conoid tail, symmetrically narrowing at about 35% of its length at the distal region to form a narrower conical region. The polytomous identification codes of the new species from Chitambar and Subbotin (2014) are: A4, B2, C3, D1, E1, F1, G23, H1, I12, J1, K23, L3, M2, N1, O1, P1, Q2, R2, S3, T1, U2, V1, W1, X1, Y-.

In general morphology, the new species is close to H. indica Siddiqi, 1961, H. labiata Colbran, 1960, H. siddiqii Deswal & Bajaj, 1987, H. tenuistriata Doucet, 1982 and H. typica. A comparison of the new species with the aforementioned species is as follows:

From H. indica, by a shorter body (767–893 vs 800–1500 μm), lower R, Rph, Rex and RV (212–247 vs 270–320, 35–48 vs 47–69, 42–50 vs 51–67 and 38–59 vs 64–81), respectively, lateral field without line(s) (vs with three lines), lip region with one annulus (vs two or three annuli), short vulval sleeve (vs elongate) and tail symmetrically narrowing at about 35% of its length at distal region to form a narrower conical section (vs uniformly narrowing).

From H. labiata, by annuli with or without longitudinal lines (vs not), lateral field lacking line(s) (vs having one line), lip region with one annulus (vs two or three annuli), short vulval sleeve (vs moderately long) and body not constricted immediately posterior to vulva (vs constricted).

From H. siddiqii, by lateral field lacking line(s) (vs having one line), a longer body (767–893 vs 650–780 μm), lower a ratio (17.9–24.5 vs 27–31), higher c ratio (8.3–11.5 vs 7), longer stylet (63.3–71.0 vs 57–59 μm), posteriorly located excretory pore (159–180 vs 127–146 μm from anterior end), higher R, Rph and Rex (212–247 vs 185–198, 35–48 vs 30–32 and 42–50 vs 35–39, respectively), shorter vulval sleeve (vs moderately elongate) and tail symmetrically narrowing at about 35% of its length at distal region to form a narrower conical section (vs uniformly narrowing).

From H. tenuistriata, by shorter stylet (63.3–71.0 vs 70–79 μm), posteriorly located excretory pore (159–180 vs 136–158 μm from anterior end), higher R, Rph, RV(ant) and Rex (212–247 vs 179–205, 35–48 vs 31–37, 167–198 vs 146–162 and 42–50 vs 33–40, respectively), shorter vulval sleeve (vs moderately elongate) and vulval lips not modified (vs modified, well developed, extending posteriorly).

From H. typica, by cuticle lacking distinct blocks (vs having blocks), lateral field lacking line(s) (vs having two lines), body not constricted immediately posterior to vulva (vs constricted) and short vulval sleeve (vs moderately elongate).

From H. epicharoides Loof, 1968, a species with close phylogenetic affinities in both LSU and ITS phylogenies, by higher R, RV(ant) and Rex (212–247 vs 144–209, 167–198 vs 129–167 and 42–50 vs 32–43, respectively), lip region with one annulus (vs two or three annuli), lower St%L (7.5–8.4 vs 9–11), excretory pore located posterior to pharynx base (vs anterior or posterior) and tail symmetrically narrowing at about 35% of its length at distal region to form a narrower conical section (vs cylindroid anteriorly, mostly narrowing to a bluntly triangular or wedge-shaped posterior part).

From H. dulli Van den Berg & Tiedt, 2001, a species with close phylogenetic affinities in ITS phylogeny, by shorter stylet (63.3–71.0 vs 73–79 μm), lower Rst (18–21 vs 21–25), lateral field lacking line(s) (vs having one or two lines), lip region continuous with one annulus (vs set off with two annuli), excretory pore located posterior to pharynx base (vs anterior or posterior) and vulva with not or slightly modified lips (vs vulval lips elongated).

Hemicycliophora conida Thorne, 1955(

Figure 5; Table 3).

Figure 5:

Figure 5:

Light photomicrographs of Hemicycliophora conida Thorne, 1955 from Gilan province, Iran. A–G: Female. A: Anterior body region; B: Pharyngeal region; C: Lateral field at mid-body; D, E: Annuli ornamentation; F, G: Posterior body region; H, I: Male. H: Anterior body region; I: Posterior body region. (Scale bar = 20 μm).

Table 3.

Morphometrics of Hemicycliophora conida Thorne, 1955 from Gilan province, Iran, and comparison with other population from East Azarbaijan province, Iran.

Reference Present study Loof (1984)
Province Gilan province East Azarbaijan province
Character Female Male Female
n 10 5 11
L 912.0 ± 21.4 (881–928) 809.0 ± 13.6 (795–822) 820–1020
a 21.2 ± 2.5 (18.6–24.3) 37.3 ± 5.7 (31.8–43.3) 26–30
b 5.3 ± 0.2 (5.2–5.6) 5.0–5.6
c 11.6 ± 2.0 (10.1–14.5) 8.2 ± 0.4 (7.8–8.6) 9.7–13.6
c' 2.3 ± 0.4 (1.7–2.6) 5.2 ± 0.5 (4.6–5.6)
V 86.7 ± 1.0 (85.5–87.6) 86–89
St 92.5 ± 2.1 (90–97) 90–103
m 78.3 ± 4.0 (75.3–84.2)
Stylet knob height 5.0 ± 0.4 (4.3–5.6)
Stylet knob width 7.8 ± 0.5 (6.9–8.6)
Excretory pore from anterior end 178.0 ± 8.9 (169–192) 140.2 ± 13.4 (127–164)
Diam. at mid-body 43.5 ± 5.5 (38–50) 22 ± 3 (19–25)
Diam. at anus/cloaca 35.3 ± 4.3 (30–40) 19 ± 1 (18–20)
Diam. at vulva 46.4 ± 5.8 (40–55)
Vulva-anterior body distance 791 ± 16 (770–809)
Vulva-tail terminus distance 124.5 ± 7.8 (115–136)
Spermatheca-vulva distance 82.2 ± 10.1 (72–96)
Lip diam. 21.3 ± 2.2 (19–24) 10.7 ± 1.5 (9–12)
Lip height 7.5 ± 0.6 (7–8) 6.2 ± 0.8 (6–7)
First body annulus diam. 23.8 ± 1.9 (20–26)
Second body annulus diam. 26.1 ± 2.7 (21–30)
Pharynx length 171.0 ± 4.7 (167–176)
Annulus width 4.1 ± 0.5 (3.6–5.1) 1.9 ± 0.1 (1.8–2.0)
Tail length 88.0 ± 6.5 (79–94) 98.7 ± 6.1 (92–104)
V-anus distance 42.0 ± 19.7 (28–71)
R 230.0 ± 9.2 (224–237) 259–286
RSt 21.0 ± 0.9 (18–23)
Rph 38.0 ± 0.2 (38–39)
Rex 41.4 ± 1.4 (39–43) 48–52
RV(ant) 187.0 ± 3.5 (185–190) 207–226
RV 46.0 ± 4.9 (37–54)
RVan 16.0 ± 8.5 (10–22) 11–17
Ran 27.0 ± 2.8 (25–29) 35–41
VL/VB 2.7 ± 0.3 (2.2–3.4) 4.0–5.3
Spermatheca length 22.7 ± 5.9 (12–30)
Spermatheca diam. 31.8 ± 8.1 (15–39)
Spicules length 54.3 ± 2.1 (52–56)
Gubernaculum length 20.3 ± 0.6 (20–21)
Bursa length 41.7 ± 6.4 (37–49)

Figure 1:

Figure 1:

Line drawings of Hemicycliophora ahvasiensis n. sp. Female. A: Anterior body region; B: Spermatheca; C: Vulval region; D–F: Variation of posterior body end morphology. (Scale bar = 20 μm).

Figure 2:

Figure 2:

Light photomicrographs of Hemicycliophora ahvasiensis n. sp. Female. A: Entire body; B, C: Anterior body region; D: Reproductive system (the arrow indicates the spermatheca); E: Spermatheca; F: Vagina; G: Posterior body region.

Figure 3:

Figure 3:

Scanning electron micrographs of Hemicycliophora ahvasiensis n. sp. Female. A: Entire body; B, C: Anterior end showing labial region; D, E: En face view of labial area; F, G: Annuli ornamentation (the arrows indicate the excretory pore); H–L: Posterior body region.

Figure 4:

Figure 4:

Scanning electron micrographs of Hemicycliophora ahvasiensis n. sp. Female. A–F: Mid-body annuli ornamentation.

Description

Female

Body straight or ventrally arcuate. Cuticular sheath fitting closely to loosely to body. Lateral fields with two distinct longitudinal lines forming a band, with irregularities and breaks of striae or with anastomosis, an additional central line appears due to four ellipsoid markings on each annulus forming four blocks. Annuli outside lateral field with scratches. Labial region broad, anterior margins rounded, with two distinct annuli and elevated labial disc. Stylet long and slender, knobs posteriorly directed. Pharynx typical of the genus. Nerve ring encircling isthmus. Excretory pore, four annuli posterior and opposite to pharynx base. Reproductive system monodelphic-prodelphic, outstretched, spermatheca rounded to ovate, filled with spheroid sperm cells, vulval lips modified, vulval sleeve absent. Tail conical, symmetrically narrowing at distal region, tip rounded.

Male

Cuticle annulation fine at midbody. Lateral fields marked by three longitudinal lines. Labial region distinctly trapezoid. Stylet and pharynx degenerated. Spicules semi-circular, tip slightly recurved. Gubernaculum linear, slightly thickened proximally. Bursa with crenate margin. Tail elongate, uniformly narrowing, annuli at distal end irregular.

Host and locality

This population was recovered from the rhizospheric soil of pomegranate (Punica granatum L.) collected from Rasht city, Gilan province, in north Iran. The geographical position of the sampling site is N36°54´1.687˝, E49°28´37.923˝.

Remarks

H. conida was originally described by Thorne (1955) from a sugar beet field in Ireland. It was later reported from several countries (Chitambar and Subbotin, 2014). In the report of Loof (1984), the species was recovered from East Azarbaijan province of Iran. Males, however, were not recovered in this study. Later, the species was again recovered from Azarbaijan province, but no morphometric or morphological data were provided (Barooti, 1998). The presently recovered population agreed well with other populations of the species that have been reported from different regions, based upon the morphometric data and morphology (Chitambar and Subbotin, 2014). The spicules length in The Netherlands populations was measured as 18–29 μm by Loof (1968) (Chitambar and Subbotin, 2014), but it was calculated about 55 μm after the drawings, which is in accordance with the presently studied population.

Molecular characterization and phylogenetic relationships

Two 673 and 682 nt long D2-D3 expansion segments of LSU (MT901580, MT901581), one from each female specimen, were generated for the new species. A BLAST search using these sequences revealed they have 99.34% identity with Hemicycliophora sp. 9 and Hemicycliophora sp. 13 (KF430509 and KF430508, respectively). The efforts to get the LSU sequences of H. conida failed. A total of 77 sequences of Hemicycliophora spp. and two sequences of Paratylenchus nanus Cobb, 1923 and P. bukowinensis Micoletzky, 1922 (AY780946 and AY780943, respectively), as outgroup taxa, were selected for a LSU phylogeny. This dataset comprised 750 total characters. The phylogenetic tree inferred using this dataset is presented in Figure 6. The major clade including the new species, also includes Hemicycliophora sp. 13 (KF430507, KF430508), the putative closest relative of it, based upon currently available data, H. epicharoides (KF430512), H. labiata (MK305971, MK305972) and Helicycliophora sp. 9 (KF430509, KF430511, KF430514, AY780973). H. typica (KF430515) is in a sister relation to the aforementioned major clade.

Figure 6:

Figure 6:

Bayesian 50% majority rule consensus tree inferred from analysis of the D2-D3 domains of the LSU rDNA sequences of Hemicycliophora ahvasiensis n. sp. under the GTR + G + I model. (lnL = 6023.6660; freqA = 0.2165; freqC = 0.2342; freqG = 0.3064; freqT = 0.2429; R(a) = 0.4542; R(b) = 1.5000; R(c) = 1.0798; R(d) = 0.4155; R(e) = 4.2300; R(f) = 1; Pinvar = 0.3122; Shape = 0.7157). Bayesian posterior probability values more than 0.50 are given for appropriate clades. New sequences are indicated in bold.

Two 904 and 907 nt long sequences of ITS rDNA (MT901582, MT901583) were generated for the new species. A single 683 nt long ITS rDNA sequence (MT901584) was obtained for the Iranian population of H. conida. A BLAST search using the ITS sequences of the new species revealed they have 98.93% identity with Hemicycliophora sp. 9 (KF430605). The BLAST search using ITS sequence of Iranian population of H. conida revealed it has 99.55% and 98.21% identity with two other ITS sequences of H. conida (KF430580 and KF430579, respectively).

A total of 70 sequences of Hemicycliophora spp. and three sequences of Paratylenchus minutus Linford in Linford, Oliveira & Ishii, 1949, Trophotylenchulus floridensis Raski, 1957 and Gracilacus bilineata Brzeski, 1995 as outgroup taxa (EF126180, JN112261 and EU247525, respectively) were selected for an ITS phylogeny. This dataset comprised 1164 total characters. The phylogenetic tree inferred using this dataset is presented in Figure 7. The major clade including the new species, also includes Hemicycliophora sp. 9 (KF430604, KF430605) that represents the putative closest relative of the new species, H. epicharoides (KF430606, KF430608) and H. labiata (MK305973, MK305974). The clade including two species H. typica (GQ406238, GQ406239, KF430603) and H. dulli (MT329671, MT329672) is in sister relation to the aforementioned clade. The ITS sequence of the Iranian isolate of H. conida formed a clade with two previously available sequences (KF430579, KF430580) of the species.

Figure 7:

Figure 7:

Bayesian 50% majority rule consensus tree inferred from analysis of the ITS rRNA gene of Hemicycliophora ahvasiensis n. sp. and Iranian population of H. conida under the GTR + G + I model. (lnL = 13525.0293; freqA = 0.2348; freqC = 0.2548; freqG = 0.2520; freqT = 0.2583; R(a) = 1.6876; R(b) = 2.3417; R(c) = 1.8416; R(d) = 0.8470; R(e) = 3.6304; R(f) = 1; Pinvar = 0.1024; Shape = 0.4967). Bayesian posterior probability values more than 0.50 are given for appropriate clades. New sequences are indicated in bold.

Discussion

The objectives of this study were to characterize one new and one known species of the genus Hemicycliophora from Iran. As common in reliable identifications of Hemicycliophora spp., the new species was studied using an integrative approach exploiting both morphological (including SEM) and molecular data (Subbotin et al., 2014).

In both inferred LSU and ITS phylogenies, Hemicycliophora ahvasiensis n. sp. belonged to a clade including Hemicycliophora sp. 9, H. labiata, H. epicharoides, H. typica and H. dulli. The close affinity of the aforementioned species was already observed (Subbotin et al., 2014; Van den Berg et al., 2018; Maria et al., 2018; Mwamula et al., 2020).

The newly described species in present study appeared similar to H. typica under LM, however, the SEM and molecular data revealed they differ. Sequences of LSU D2-D3, and ITS rDNA sequences of H. ahvasiensis n. sp. differed from those of H. typica by 6 bp (1.4%) and 31 bp (1.5%), respectively. In the inferred phylogenies, it formed a subclade separate from H. typica and other Hemicycliophora species.

The new species was isolated from the rhizosphere of date palm tree, that is a major food source for local populations in the Middle East, and plays important roles in their culture and economy (Chao and Krueger, 2007). Additional study is required to clarify if the parasitism of high nematode populations of H. ahvasiensis n. sp. can cause damages to this plant.

Acknowledgments

The authors thank the Iranian National Science Foundation (INSF) and the Research Council of Shahid Chamran University of Ahvaz, Iran (Grant no. SCU.AP99.638) for financial supports. The authors thank the University of Jaén, Spain, for financial support received for the Research Support Plan” PAIUJA 2019/2020: EI_RNM02_2019”. SEM pictures were obtained with the assistance of technical staff (Amparo Martínez-Morales) and equipment of “Centro de Instrumentación Científico-Técnica (CICT)” from University of Jaén.

References

  1. Abolafia, J. 2015. A low-cost technique to manufacture a container to process meiofauna for scanning electron microscopy. Microscopy Research and Technique 78:771–776. [DOI] [PubMed] [Google Scholar]
  2. Aliramaji, F. , Pourjam, E. , Álvarez-Ortega, S. , Jahanshahi Afshar, F. and Pedram, M. . 2018. Description of Aphelenchoides giblindavisi n. sp. (Nematoda: Aphelenchoididae), and proposal for a new combination. Journal of Nematology 50:437–452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aliramaji, F. , Mirzaie Fouladvand, Z. , Pourjam, E. , Mortazavi, P. , Jahanshahi Afshar, F. , Kanzaki, N. , Giblin-Davis, R. M. and Pedram, M. . 2020. A new species of Basilaphelenchus Pedram, Kanzaki, Giblin-Davis and Pourjam, 2018 (Aphelenchoidea: Tylaphelenchinae), from natural forests of Golestan province, Iran. Nematology 22:361–371. [Google Scholar]
  4. Barooti, S. 1998. The plant nematode fauna of cultivated soil of East- Azarbaijan, Ardabil and Moghan. Applied Entomology and Phytopathology 66:79–98. [Google Scholar]
  5. Brzeski, M. W. 1974. Taxonomy of Hemicycliophorinae (Nematoda, Tylenchida). Problemowe Postepow Nauk Rolniczych 154:237–330. [Google Scholar]
  6. Brzeski, M. W. 1995. Paratylenchinae: morphology of some known species and descriptions of Gracilacus bilineata sp. n. and G. vera sp. n. (Nematoda: Tylenchulidae). Nematologica 41:535–565. [Google Scholar]
  7. Chao, C. T. and Krueger, R. R. . 2007. The Date Palm (Phoenix dactylifera L.): overview of biology, uses, and cultivation. Hortscience 42:1077–1082. [Google Scholar]
  8. Chen, D. Y. , Ni, H. F. , Tsay, T. T. and Yen, J. H. . 2008. Identification of Gracilacus bilineata and G. aculenta (Nematoda: Criconematoidea, Tylenchulidae) among bamboo plantations in Taiwan. Plant Pathology Bulletin 17:209–219. [Google Scholar]
  9. Chen, D. Y. , Ni, H. F. , Yen, J. H. and Tsay, T. T. . 2009. Identification of a new recorded pin nematode Paratylenchus minutus (Nematoda: Criconematoidea, Tylenchulidae) in Taiwan. Plant Pathology Bulletin 18:167–174. [Google Scholar]
  10. Chitambar, J. J. and Subbotin, S. A. . 2014. “Systematics of the sheath nematodes of the superfamily Hemicycliophoroidea”, Nematology monographs and perspectives, Vol. 10, Brill, Leiden. [Google Scholar]
  11. Cobb, N. A. 1923. Notes on Paratylenchus, a genus of nemas. Journal of the Washington Academy and Sciences 13:254–257. [Google Scholar]
  12. Colbran, R. C. 1960. Studies of plant and soil nematodes. 3. Belonolaimus hastulatus, Psilenchus tumidus and Hemicycliophora labiata, three new species from Queensland. Queensland Journal of Agricultural Science 17:175–181. [Google Scholar]
  13. Cordero López, M. A. , Robbins, R. T. and Szalanski, A. L. . 2013. Taxonomic and molecular identification of Hemicycliophora, Caloosia, Gracilacus and Paratylenchus species (Nematoda: Criconematidae). Journal of Nematology 45:145–171. [PMC free article] [PubMed] [Google Scholar]
  14. De Grisse, A. T. 1969. Redescription ou modification de quelques techniques utilissée dans l’étude des nematodes phytoparasitaires. Mededelingen Rijksfaculteit Landbouwwetenschappen Gent 34:351–369. [Google Scholar]
  15. De Man, J. G. 1921. Nouvelles recherches sur les nématodes libres terricolesde la Hollande. Capita Zoologica 1:3–62. [Google Scholar]
  16. Deswal, P. and Bajaj, H. K. . 1987. Species of criconematids (Nematoda: Criconematina) from Haryana, India. Systematic Parasitology 9:185–197. [Google Scholar]
  17. Doucet, M. E. 1982. Quatre nouvelles espèces du genre Hemicycliophora de Man, 1921 (Nematoda: Tylenchida) provenant d’Argentine. Revue de Nématologie 5:309–320. [Google Scholar]
  18. Eskandari, A. 2018. “Nematodes of the families Criconematidae and Hemicycliophoridae”, In Ghaderi, R. , Kashi, L. and Karegar, A. (Eds), Plant-parasitic nematodes in Iran. Science Reference in collaboration with the Iranian Society of Nematology, pp. 113–158. [Google Scholar]
  19. Germani, G. and Luc, M. . 1973. Contribution a l’étude du genre Hemicycliophora de Man 1921 (Nematoda: Tylenchida) comportant la description de cinq nouvelles espèces. Cahiers ORSTOM. Série Biologie (21 spécial ‘Nématologie’), pp. 67–84. [Google Scholar]
  20. Huson, D. H. and Scornavacca, C. . 2012. Dendroscope 3: an interactive tool for rooted phylogenetic trees and networks. Systematic Biology 61:1061–1067. [DOI] [PubMed] [Google Scholar]
  21. Jenkins, W. R. 1964. A rapid centrifugal flotation technique for separating nematodes from soil. Plant Disease Reporter 48:692. [Google Scholar]
  22. Larget, B. and Simon, D. L. . 1999. Markov chain Monte Carlo algorithms for the Bayesian analysis of phylogenetic trees. Molecular Biology and Evolution 16:750–759. [Google Scholar]
  23. Linford, M. B. , Oliveira, J. M. and Ishii, M. . 1949. Paratylenchus minutus n. sp. a nematode parasitic on roots. Pacific Science 3:111–119. [Google Scholar]
  24. Loof, P. A. A. 1968. Taxonomy of Hemicycliophora species from west and central Europe (Nematoda: Criconematoidea). Mededelingen Landbouwhogeschool Wageningen 68–14:52. [Google Scholar]
  25. Loof, P. A. A. 1984. Hemicycliophora species from Iran (Nematoda: Criconematoidea). Nematologica 30:22–41. [Google Scholar]
  26. Loof, P. A. A. and Heyns, J. . 1969. Taxonomy of Hemicycliophora species from South Africa (Nematoda: Criconematoidea). Nematologica 15:464–472. [Google Scholar]
  27. Ma, X. and Agudelo, P. . 2015. First report of Hemicycliophora wyei on bentgrass in Texas. Plant Disease 99:732. [Google Scholar]
  28. Maria, M. , Cai, R. , Qu, N. , Castillo, P. and Zheng, J. . 2018. Morphological and molecular characterization of Hemicycliophora subbotini n. sp. (Tylenchida: Hemicycliophoridae) from China. Zootaxa 4433:161–173. [DOI] [PubMed] [Google Scholar]
  29. Micoletzky, H. 1922. Die freilebenden Erd-Nematoden. Archiv für Naturgeschichte, Berlin. A 87:1–650. [Google Scholar]
  30. Monteiro, A. R. and Lordello, L. G. E. . 1978. A description of Hemicycliophora poranga n. sp. from Brazil (Nemata). Revista Brasileira de Biologia 38:569–571. [Google Scholar]
  31. Mwamula, A. O. , Kim, Y. H. , Na, H. , An, H. J. , Kim, Y. H. and Lee, D. W. . 2020. Molecular characterisation and phylogenetic position of Hemicycliophora labiata Colbran, 1960, from turfgrass in Korea, with comments on its morphology. Nematology 22:927–938. [Google Scholar]
  32. Nunn, G. B. 1992. Nematode molecular evolution PhD Thesis, University of Nottingham, oxfordjournals.molbev.a026160.
  33. Nylander, J. A. A. 2004. MrModeltest v2. Evolutionary Biology Centre Uppsala University, Sweden. [Google Scholar]
  34. Raski, D. J. 1957. Trophotylenchulus and Trophonema two new genera of Tylenchulidae n. fam. (Nematoda). Nematologica 2:85–90. [Google Scholar]
  35. Reed, J. P. and Jenkins, W. R. . 1963. Hemicycliophora vaccinium n. sp. (Nematoda: Criconematidae) from cranberry. Proceedings of the Helminthological Society of Washington 30:211–212. [Google Scholar]
  36. Ronquist, F. and Huelsenbeck, J. P. . 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574. [DOI] [PubMed] [Google Scholar]
  37. Siddiqi, M. R. 1961. Studies on species of Criconematinae (Nematoda: Tylenchida) from India. Proceedings of the Helminthological Society of Washington 28:19–34. [Google Scholar]
  38. Siddiqi, M. R. 1980. Taxonomy of the plant nematode superfamily Hemicycliophoroidea, with a proposal for Criconematina, new suborder. Revue de Nématologie 3:179–199. [Google Scholar]
  39. Skarbilovich, T. S. 1959. On the structure of systematics of nematodes order Tylenchida Thorne, 1949. Acta Parasitologica Polonica 7:117–132. [Google Scholar]
  40. Subbotin, S. A. , Vovlas, N. , Crozzoli, R. , Sturhan, D. , Lamberti, F. , Moens, M. and Baldwin, J. G. . 2005. Phylogeny of Criconematina Siddiqi, 1980 (Nematoda: Tylenchida) based on morphology and D2-D3 expansion segments of the 28S-rRNA gene sequences with application of a secondary structure model. Nematology 7:927–944. [Google Scholar]
  41. Subbotin, S. A. , Chitambar, J. J. , Chizhov, V. N. , Stanley, J. D. , Inserra, R. N. , Doucet, M. E. , Mcclure, M. , Ye, W. , Yeates, G. W. , Mollov, D. S. , Cantalapiedra-Navarrete, C. , Vovlas, N. , Van den Berg, E. and Castillo, P. . 2014. Molecular phylogeny, diagnostics, and diversity of plant-parasitic nematodes of the genus Hemicycliophora (Nematoda: Hemicycliophoridae). Zoological Journal of the Linnean Society 171:475–506. [Google Scholar]
  42. Tamura, K. , Stecher, G. , Peterson, D. , Filipski, A. and Kumar, S. . 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30:2725–2729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tanha Maafi, Z. , Amani, M. , Stanley, J. D. , Inserra, R. N. , Van den Berg, E. and Subbotin, S. A. . 2012. Description of Tylenchulus musicola sp. n. (Nematoda: Tylenchulidae) from banana in Iran with molecular phylogeny and characterisation of species of Tylenchulus Cobb, 1913. Journal of Nematology 14:353–369. [Google Scholar]
  44. Thorne, G. 1955. Fifteen new species of the genus Hemicycliophora with an emended description of H. typica de Man (Tylenchida, Criconematidae). Proceedings of the Helminthological Society of Washington 22:1–16. [Google Scholar]
  45. Van den Berg, E. 1981. Further studies on the genus Hemicycliophora de Man, 1921 in South Africa (Nematoda: Hemicycliophoroidea) with description of a new species. Phytophylactica 13:181–194. [Google Scholar]
  46. Van den Berg, E. and Tiedt, L. R. . 2001. One new and some known species of Hemicycliophora de Man, 1921 (Nemata: Hemicycliophorinae) from South Africa. Journal of Nematode Morphology and Systematics 3:175–190. [Google Scholar]
  47. Van den Berg, E. , Subbotin, S. A. and Tiedt, L. R. . 2010. Morphological and molecular characterisation of Hemicycliophora lutosa Loof & Heyns, 1969 and H. typica de Man, 1921 from South Africa (Nematoda: Hemicycliophoridae). Nematology 12:303–308. [Google Scholar]
  48. Van den Berg, E. , Tiedt, L. R. , Liébanas, G. , Chitambar, J. J. , Stanley, J. D. , Inserra, R. N. , Castillo, P. and Subbotin, S. A. . 2018. Morphological and molecular characterisation of two new Hemicycliophora species (Tylenchida: Hemicycliophoridae) with a revision of the taxonomic status of some known species and a phylogeny of the genus. Nematology 20:319–354. [Google Scholar]
  49. Vovlas, N. , Subbotin, S. A. , Troccoli, A. , Liébanas, G. and Castillo, P. . 2008. Molecular phylogeny of the genus Rotylenchus (Nematoda, Tylenchida) and description of a new species. Zoologica Scripta 37:521–537. [Google Scholar]

Articles from Journal of Nematology are provided here courtesy of Society of Nematologists

RESOURCES