Skip to main content
Journal of Nematology logoLink to Journal of Nematology
. 2021 Jan 13;52:e2020-124. doi: 10.21307/jofnem-2020-124

Morphological and molecular characterization of Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher 1963 with its first report on Zea mays roots in Namibia

Mariette Marais 1,*, Esther van den Berg 1, Hendrika Fourie 2, Milad Rashidifard 2
PMCID: PMC8015359  PMID: 33829197

Abstract

In the summer of 2018, specimens of a Hoplolaimus population were extracted from a maize root sample collected near Stampriet, Namibia. This population was identified as Hoplolaimus pararobustus and is described and illustrated based on its morphological, morphometric, and molecular characteristics. To our knowledge, this is the first report H. pararobustus from maize roots. Females of the population had a mean body and stylet length of 1,100 µm and 36 µm, respectively. Esophagus with three nuclei in three pharyngeal glands. Lateral field reduced, ranging from a very faint line to just breaks in striae. The males were shorter than the females with a mean body length of 925 µm and the stylet slightly shorter, with a mean length of 34 µm. Phylogenetic analyses using partial sequences of 18 S and the expansion fragment D2–D3 of 28 S rDNA genes showed the close relation of this species and H. columbus. This Namibian population of H. pararobustus is the first Hoplolaimus species from Africa to be molecularly characterized.

Keywords: Hoplolaimus, H. pararobustus, Lance nematode, Maize, Morphology, Molecular identification, Ribosomal DNA, Taxonomy, Phylogeny


Lance nematodes, Hoplolaimus spp., are robust nematodes with a very distinct lip region and well-developed stylet with distinctly shaped stylet knobs (Fortuner, 1991) that feed on a wide range of plants and have a global distribution. Bae et al. (2009) reported that Handoo and Golden (1992) recognized 29 species in the genus Hoplolaimus Von Daday, 1905. Siddiqi (2000) listed 32 species in three subgenera with two species Hoplolaimus johani Tiwari, Mishra and Malhotra, 2001 and Hoplolaimus caudifurcatus Tiwari, Mishra and Malhotra, 2001, described in 2001 (Tiwari et al., 2001). Since the 2009 publication, three species namely Hoplolaimus bachlongviensis Nguyen, Bui and Trinh, 2015, Hoplolaimus puriensis Ali, Shaheen and Pervez, 2009 and Hoplolaimus smokyensis Ma, Robbins, Bernard, Holgun and Agudela, 2019 were described from Vietnam, India, and the United States of America, respectively (Ali et al., 2009; Nguyen et al., 2015; Ma et al., 2019). Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher (1963) was described from the Democratic Republic of the Congo and since then, the species had been reported from 25 African countries, including Namibia (Loubana et al., 2007; EPPO, 2020).

Hoplolaimus pararobustus is associated with many plant species like grasses from bowling greens and lawns, fynbos, Adansonia digitata L., Ananas comosus (L.) Merr., Annona reticulata L., Amaranthus sp., Beta vulgaris L., Camellia sinensis (L.) Kuntze, Carica papaya L., Chloris gayana Kunth, Coffea arabica L., Citrus sp., Daucus carotae L., Digitaria abyssinica (A.Rich.) Stapf, Dioscorea spp., Elaeis spp., Eucalyptus sp., Gossypium hirsutum L., Mangifera indica L., Musa spp., Oryza sativa L., Paspalanum notatum Flügge, Phaseolus vulgaris L., Psidium guajava L., Pueraria phaseoloides var. javanica (Benth.) Baker; Triticum aestivum L., Saccharum officinarum L., Solanum tuberosum L., Vigna unguiculata (L.) Walp., Vitis vinifera L., and Zea mays L. (Caveness, 1967; Van den Berg and Heyns, 1970; Siddiqi, 1974; Bridge et al., 1995; Vovlas and Lamberti, 1985; CABI, 2014; Sikora et al., 2018). This semi-endoparasitic nematode (Yeates et al., 1993) has a broad distribution in Namibia, according to the South African Plant-Parasitic Nematode Survey (SAPPNS) database (De Waele et al., 1998; Marais et al., 2017) and it had been reported in soil around Acacia millefolia S.Watson, Brassica oleracea L., Cenchrus ciliaris L., Cucurbita maxima Duchesne, Gossypium hirsutum L., Medicago sativa L., Pennisetum glaucum (L.) R.Br., Solanum lycopersicum L., Vitis vinifera L., and Z. mays.

Hoplolaimus pararobustus has been reported from inside roots of banana (Whitehead, 1959) giving rise to dark-brown pustules that eventually result in necrotic cortical tissue situated around the heads of the feeding sites of the nematodes and eventually elongated ulcerated lesions on the roots (Siddiqi, 1974). It has also been reported, at a population density of 200 individuals per gram of tissue, in corms and roots of banana where they were likely to cause damage to the crop (Sikora et al., 2018). Phylogenetic analysis of Hoplolaimus spp. using D2–D3 expansion of 28 S and internal transcribed spacer (ITS1) ribosomal DNA sequences resolved the phylogeny of the genus and were useful in molecular identification of Hoplolaimus spp. (Bae et al., 2008). In addition, the PCR-RFLP method was applied by different researchers to evaluate the genetic diversity of Hoplolaimus spp. (Robbins et al., 2009; Bae et al., 2009). Later, a species-specific primer was developed to distinguish Hoplolaimus stephanus Sher, 1963 from another similar species viz. Hoplolaimus galeatus (Cobb, 1913) Thorne, 1935 (Ma et al., 2011). Moreover, sequences of the actin gene were successfully used for phylogenetic studies of Hoplolaimus spp. (Ma et al., 2011). High genetic variability among the Hoplolaimus populations in soybean-growing areas in the USA was reported when their genetic diversity was evaluated based on sequences of ITS1 ribosomal DNA and COI mitochondrial DNA genes (Holguin et al., 2015). Although the evolutionary relationships of Hoplolaimus spp. have been studied, phylogenetic analyses of this genus within the subfamily Hoplolaiminae are still lacking. Therefore, this study aimed to characterize a population of a Hoplolaimus isolated in Namibia using both morphological and molecular approaches, which is presented herein as H. pararobustus. To our knowledge, this is the first report of H. pararobustus from maize (Z. mays) roots.

Materials and methods

Nematode extraction and morphological studies

Nematodes were extracted from roots using an adapted sugar centrifugal flotation method (Marais et al., 2017). Females and males were fixed in a heated 4% formaldehyde plus 1% propionic acid (FPG) solution, dehydrated in a glycerine solution, and mounted in glycerine on glass slides using a wax ring method (Marais et al., 2017). Measurements and drawings of the mounted specimens were done with a Nikon LABOPHOT-2 microscope equipped with a Nikon 1.25× drawing tube. All measurements were done at ×1,000 magnification. Curved structures were measured along the median line. Morphometrics were used in the descriptions with standard morphometric calculations and terms used throughout the paper (Siddiqi, 2000). Specimens were deposited in the National Collection of Nematodes (NCN), Biosystematics, Agricultural Research Council (ARC) – Plant Health and Protection (PHP), Pretoria.

DNA extraction, PCR reaction, and gel electrophoresis

DNA from previously selected living males and females was extracted using chelex-100 as described by Rashidifard et al. (2019). Polymerase chain reaction (PCR) conditions followed the protocol of Swart et al. (2020) with the following DNA markers used for DNA amplification: 28 S rDNA: D2A (5–ACAAGTACCGTGAGGGAAAGTTG–3), D3B (5–TCGGAAGGAACCAGCTACTA–3) (Subbotin et al., 2006), and 18 S rDNA: SSU F04 (GCTTGTCTCAAAGATTAAGCC), SSU R26 (CATTCTTGGCAAATGCTTTCG) (Blaxter et al., 1998). DNA of the nematode specimens was stained using GelRed, loaded on 1% agarose gel, and visualized under UV transilluminator before sequencing by Inqaba Biotec (Pty) Ltd South Africa.

Taxonomy and phylogenetic analyses

The newly generated 18 S and 28 S rDNA sequences of the Namibian nematode population were compared to those available in GenBank using a BLAST search. For phylogenetic tree construction, available sequences of the subfamily Hoplolaiminae were retrieved from GenBank for 18 S and 28 S data sets. Both data sets were aligned using MUSCLE (Edgar, 2004) in Geneious Prime 2020.0.4 (https//:www.geneious.com). The jModelTest 2.1.10 program (Darriba et al., 2012) was used to identify the best nucleotide substitution model. The General Time Reversible with an invariable site and a gamma distribution (GTR + I + G) and General Time Reversible with a Gamma distribution (GTR + G) were the most suitable models for 18 S and 28 S data sets, respectively. Bayesian analysis was accomplished using MrBayes 3.2.2 (Huelsenbeck and Ronquist, 2001) in Geneious Prime 2020.0.4 (https//:www.geneious.com); the chain was run for 3×106 generations for each locus. After discarding burn-in samples (25%), posterior probability (PB) of the Bayesian trees was estimated using the Markov chain Monte Carlo (MCMC) algorithm (Larget and Simon, 1999) based on the 50% majority rule. Heterodera schachtii Schmidt, 1871 and Globodera rostochiensis (Wollenweber, 1923) Skarbilovich, 1959 were, respectively, used as outgroups for the 18 S and 28 S phylogenetic trees.

Results

Systematics

Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher, 1963 (Figure 1 and Table 1).

Figure 1:

Figure 1:

Hoplolaimus pararobustus. Female 1: Anterior part of the body; 2: Oesophageal overlap with an excretory pore; 3: Vulval area with posterior spermatheca; 4: Phasmid and lateral field in the anterior part of the body; 5: Tail with the lateral field; Male: 6: Phasmid with the lateral field at the posterior end; 7: Posterior end with spicules and bursa; 8: Anterior part of the body; 9: Lateral field opposite vulva. Scale bar = 20 µm.

Table 1.

Measurements of Hoplolaimus pararobustus females and males from maize in Namibia.

Hoplolaimus pararobustus (Namibian specimens) Hoplolaimus pararobustus (acc. to Fortuner (1991) Hoplolaimus pararobustus (acc. to Van den Berg and Quénéhervé, 2012) Hoplolaimus columbus (acc. to Fortuner, 1991) Hoplolaimus dubius (acc. to Chaturvedi and Khera, 1979; Zarina and Maqbool, 1998) Hoplolaimus galeatus (acc. to Van den Berg and Quénéhervé, 2012) Hoplolaimus seinhorsti (acc. to Van den Berg and Quénéhervé, 2012 Hoplolaimus seinhorsti (acc. to Mansourabad et al., 2016)
Characters Females Males Females Males Females Males Females Males Females Males Females Males
n 21 21 17 14 20 8 8
L 1,100±76.1 (957–1,245) 925±65 (818–1,018) 1,314±0.127 (910–1,800) 1,158±0.102 (930–1,500) 940–1,800 920–1,500 1,260–1800 1,150–1,400 780–1,600 940–1,100 1,100–1,940 1,050–1,560 1,000–1,600 1,480–1,738
a 29±3.5 (23.7–36) 29.2±4.2 (22–38.3) 27.3±2.689 (20–39) 29.2±2.2227 (21–37.2) 20–39 21–37.2 30–38 31.9 (25.9–39.2) 31.94–51.29 32.78–43.87 22–34 23–32 24.1–40 25.5–33.8
b 7.4±0.7 (6.2–8.6) 6.7±0.4 (6–7.5) 8.98±1.361 (6–14) 8.5±1.328 (6.2–13.8) 6–14.1 6.2–13.8 9.1–12.4 10.9 (9.58–12.18) 8.16–12.49 8.0–9.45 6.3–10.8 8.3–10.3 5.2–14.2
b’ 9.5±0.8 (7.9–11) 8.5±0.7 (7.1–10.1) 7.1±0.682 (5.1–10) 6.6±0.57 (5–8.7) 6.3–9.7 6.04–9.42 5.95–6.76
c 59.7±10.5 (46.9–80.6) 34.7±4.3 (25–41) 60.8±15.185 (10–164) 36.9±6.605 (22.2–51.9) 40–164 22.2–51.9 39–57 29.9 (26.8–33.1) 1.321.41 35.08–41.21 0.6–0.7 1.5–1.7 38–74
c’ 0.8±0.1 (0.6–1.1) 1.5±0.2 (1.3–2) 0.67±0.135 (0.4–0.9) 1.6±0.206 (1.4–2.1) 0.4–0.9 1.4–2.1 0.61–1.17 0.7–0.9
o (%) 13±2 (8–17) 13±2.5 (8–18) 6.8–13.4 7.1–12.5 9–13 5.2 (4.8–5.2) 7.55–16.28 12.5–17.7 8.5–17 10–17
M 51±1.5 (48–54) 51±1.8 (50–53)
V (%) 55±2.5 (49–67) 52.68±2.609 (51–62) 51–62 51–60 41.56–59.16 52–60
OV1 (%) 31±14.0 (18–51)
OV2 (%)
h 13±2.5 (10–19)
Annulus width 2±0.3 (2–3) 2±0.3 (2–3) 2 2–3
Lip region height 7±0.5 (6–8) 6±0.6 (5–7)
Lip region width 13±1 (12–15) 12±0.9 (11–13)
Stylet length 36±1.6 (34–40) 34±1.3 (32–38) 42.3±2.378 (37.5–49) 40.8±2.673 (35–46) 37.5–49.7 35–48 40–48 42 (40.2–43.7) 34.4–42.4 41.5–54 40–48 38–45
Metenchium length 18±1.1 (17–21) 17±0.6 (16–18)
Telenchium length 18±0.8 (17–19) 17±1 (15–20)
Stylet knob height 6±0.5 (5–7) 5±0.6 (4–6)
Stylet knob width 6±0.8 (5–9) 6±0.5 (5–7) 6.0–6.8
Dorsal gland opening posterior to stylet knobs 5±0.7 (3–6) 4±0.9 (3–6) 5.6±1.377 (4–8) 3.2–5.6
Median bulb length 17±1.3 (15–20) 16±1.5 (13–19)
Median bulb width 15±1.3 (13–17) 12±1 (11–15)
Medan bulb valve length 6±0.7 (4–6) 5±0.7 (4–7)
Median bulb valve width 4±0.6 (3–5) 4±0.4 (3–4)
Excretory pore from anterior end 108±11.9 (82–123) 93±13.6 (74–121)
Esophagus length 148±7.6 (136–161) 139±10.4 (124–163)
Esophagus overlap 31±7.2 (15–44) 30±5.7 (20–38)
Body width at excretory pore 33±3.5 (27–40) 26±2.4 (23–30)
Body width at midbody 39±4 (32–46) 32±2.9 (27–38)
Body width at anus/cloaca 25±2.2 (21–29) 17±1.3 (15–20)
Position of excretory pore/Esophagus length (%) 73±7.5 (61–85) 67±9.6 (61–85)
Position of excretory pore/Body length (%) 10±1.3 (8–12) 10±(8–13)
Anterior genital track length 241±69.2 (171–301)
Testes length 350±34.6 (322–400) (n=4)
Spicule length 38±2.3 (35–42) 46.9±3.318 (40–57) 40–57 46.8 (36.6–52.5) 368–43.36 40–52
Gubernaculum length 17±2.3 (11–20) 21.9±2.4296 (15.4–31) 15.4–31 14.4–18.4 20–28
Capitulum length 11 ±0.8 (10–13)
Phasmid diameter 4±0.3 (3–4) 3±0.5 (3–4) 5.3 (4.1–6)
Anterior phasmid as % from anterior end 36±6.9 (28–40) (n=3) 36±3.5 (28–43) 22–52 23.7–50.4 29–47 38 (35.4–42.2) 23.90–41.34 21.18–44.35 23–46 29–45 24–46
Posterior phasmid as % from anterior end tail 79±4.1 (70–85) 81±4.7 (72–87) 58–89 68.9–85.4 79–90 82 (79.7–83.2) 82.20–96.44 76.69–85.99 72–88 75–89 68–90
Tail length 19±3.1 (15–24) 27±3.5 (22–35) 7–15 16–28 26.1–35.1 17.5–36.2 32.3–44.2 22–28
Number of tail annules 12–18

All measurements are given in μm.

Description

Female

Habitus slightly curved ventrad, C-shape, S-shape or curved into a complete spiral with head and tail end overlapping. Body length of (957– 1,245 μm). Cuticular annules distinct about 2 µm wide. Lip region broadly rounded and well set off from body usually with four distinct annules but sometimes with three on the one side and four on the other side. Basal annulus sometimes larger than others. Longitudinal striae on basal annulus faint. Labial framework well sclerotized. Stylet well-developed (34–40 μm) long with metenchium and telenchium almost equal in length. Stylet knobs tulip-shaped with two or more projections anteriorly. Median bulb round, muscular (15–20 μm long), 13–17 μm wide with a prominent centrally located valve, 4–6 μm long and 3–5 μm wide. Nerve ring encircling the isthmus. Excretory pore situated from opposite anterior part of median bulb to opposite the middle of the esophagus, 82–123 μm from anterior end, at 61–85% of esophagus length. Esophagus with three nuclei in each of the three esophageal glands extending dorsally over the intestine. Hemizonid two annules long and situated from opposite excretory pore, nine annules posterior to it. Hemizonion not seen. Esophagus glands overlap 15–44 μm long. Vulva a transverse slit with epiptygma folded into the vagina. Spermatheca small, oval or round, empty or filled with rounded sperm. Lateral field reduced; very faint line to just breaks in striae. Two or three very faint incomplete incisures can sometimes be seen in the lateral field area. Caudalid not seen. Intestine does not overlap the rectum. Phasmids: two enlarged scutella situated anterior and posterior to the vulva (3–4 μm in diameter). Tail short (15–24 μm), rounded with 6–12 annules.

Male

Habitus conforms to that of females, body 818–1018 μm long. Lip region rounded with three or four annuli, slightly offset from the body. Position and morphology of excretory pore, hemizonid, stylet, lateral field and phasmids similar to that of the females. Stylet slightly shorter, 32–38 µm long. Testis 322–400 μm long. Spicules ventrally arcuate (35–42 μm), gubernaculum protrusible through the cloaca with titillae (11–20 μm). Bursa large with crenate margin and enclosing the conoid tail tip.

Diagnosis and relationships

Hoplolaimus pararobustus belongs to the group in which the lateral field is degenerate, not showing the regular compliment of four incisures and three and not six esophageal gland nuclei (Van den Berg and Quénéhervé, 2012). The current Namibian specimens are considered to be H. pararobustus because of the presence of a well set off, broadly round lip region with four annuli, lateral field represented by a single incisura, and two or three very faint incomplete incisures that can sometimes be seen in the lateral field area. Esophagus with three nuclei in three pharyngeal glands, no overlap of the rectum, and presence of males. The Namibian specimens correspond to the descriptions of Fortuner (1991), Larizza et al. (1998), and Van den Berg and Quénéhervé (2012), but for the lower range of stylet length of females (34–40 µm vs 37.5–49 µm) and males (32–42 µm vs 35–46 µm), expansion of the reported range for the position of the vulva (V = 49–67% vs V = 51–62.1%), and a shorter spicule (35–42 µm vs 40–57µm) than that reported (Van den Berg and Buckley, 1987; Fortuner, 1991; Larizza et al., 1998). Molecular analyses indicated that H. columbus Sher, 1963 is the closest to the Namibian population of H. pararobustus. Hoplolaimus columbus was described from soybean in the USA and is currently reported from India, Pakistan, Vietnam, Egypt, and the USA (Shafiee and Osman, 1971; Fortuner, 1991). This lance nematode belongs to the group in which the lateral field is represented by one indistinct incisure and six esophageal gland nuclei, one or two sometimes indistinct (Fortuner, 1991), this is in contrast with the three nuclei observed in the Namibian specimens. The current H. pararobustus female specimens differ from H. columbus females in short body length (957–1,245 µm vs 1,260–1,800 µm), shorter stylet length (34-40 µm vs 40-48 µm; b-value (6.2–8.6 vs 9.1–12.4)). The Namibian H. pararobustus differs from H. columbus males in shorter body length (808–1,018 µm vs 1150–1,400 µm), shorter stylet length (32–38 µm vs 40.2–43.7 µm), b-value (6–7.5 vs 9.58–12.18), and o-value (8–18 vs 4.8–5.2). The constructed Bayesian tree showed that H. pararobustus also grouped in a clade with H. galeatus that is representative of the group of species with four incisures in the lateral field and three esophageal gland nuclei (Van den Berg and Quénéhervé, 2012). Hoplolaimus seinhorsti reported from Africa, Asia, and Central and South America is representative of a group with one or no incisures in the lateral field and with six pharyngeal gland nuclei.

Molecular characterization

Nucleotide BLAST search using partial 18 S sequence of H. pararobustus (MT302753, 908 bp) showed the maximum identity of 98.4% to Hoplolaimus sp. (MK292131) and 98.1% to H. galeatus (KJ934131). BLAST search based on a partial 28 S sequence of H. pararobustus (MT302643, 700 bp) revealed a maximum identity of 96.6% to Hoplolaimus sp. (KY639326) and 95.9% to a population of H. seinhorsti Luc, 1958 (KF443213). During this study, one 908-bp-long 18 S sequence (MT302753) and one 700-bp-long 28 S sequence (MT302643) were obtained and deposited into GenBank. The 18 S alignment includes 50 sequences with 777 nucleotides in length, while the 28 S alignment includes 60 sequences with 644 nucleotides in length. The constructed Bayesian tree using 18 S data set showed that H. pararobustus is in a well-supported clade with two populations of H. galeatus and one population of H. columbus with H. columbus being the closest to the Namibian population of H. pararobustus (Figure 2). The inferred Bayesian tree using the 28 S data set indicated that H. pararobustus is in a maximally supported sister relation with H. columbus, H. dubius Chaturvedi, Singh & Khera, 1979, H. indicus Sher, 1963, and H. sienhorsti of which H. columbus was the closest taxa to the Namibian population of H. pararobustus. The molecular phylogeny of the Hoplolaiminae subfamily also indicated that, based on 18 S and 28 S data sets, Rotylenchus Filipjev, 1936 and Peltamigratus Sher, 1963 were the closest genera to the genus Hoplolaimus, respectively (Figure 3).

Figure 2:

Figure 2:

Bayesian tree inferred from partial 18 S rDNA sequence of Hoplolaimus pararobustus obtained from the rhizosphere of maize from Namibia under GTR + I + G (partition = 010020; lnL = 3717.3614; rAC = 1.0000; rAG = 2.0466; rAT = 1.0000; rCG = 1.0000; rCT = 5.6942; rGT = 1.0000; p-inv = 0.4370; gama shape = 0.3390) based on 50% majority role. The newly obtained sequence is indicated by bold font.

Figure 3:

Figure 3:

Bayesian tree inferred from partial 28 S rDNA sequence of Hoplolaimus pararobustus obtained from the rhizosphere of maize from Namibia under GTR + G (partition = 012314; lnL = 5311.5111; rAC = 0.9205; rAG = 4.5584; rAT = 2.2804; rCG = 0.4018; rCT = 4.5584; rGT = 1.0000; gamma shape = 0.2940) based on 50% majority role. The newly obtained sequence is indicated by bold font.

Conclusion

A population of H. pararobustus was recovered from maize roots in Namibia. Hoplolaimus pararobustus belongs to the group in which the lateral field is degenerate, not showing the regular complement of four incisures and with three and not six esophageal gland nuclei (Van den Berg and Quénéhervé, 2012). The Namibian specimens correspond to the redescription of Fortuner (1991), but the lower range of the body and stylet length of females and males, the position of the vulva more anterior, and spicule length is shorter than that previously reported (Fortuner, 1991; Larizza et al., 1998; Van den Berg and Quénéhervé). Hoplolaimus pararobustus is commonly found in Namibia, reported from both cultivated and noncultivated areas, but this is according to our knowledge the first report from maize roots. This study reported the first molecular characterization of an African population of Hoplolaimus, in this case H. pararobustus. We resolved the evolutionary relationship of H. pararobustus based on partial 18 S and 28 S rDNA sequences. The constructed Bayesian tree using 18 S data set showed that H. pararobustus is in a well-supported clade with two populations of H. galeatus and one population of H. columbus, with H. columbus being the closest to the Namibian population of H. pararobustus. Ultimately, the monophyletic nature of the genus was confirmed using both phylogenetic trees.

Acknowledgments

Funding by the Agricultural Research Council and the North-West University is acknowledged. The authors would like to thank Dr Chantelle Girgan, Mrs Adoration Shubane, and Mrs Elsa van Niekerk (ARC-PHP) for technical assistance.

References

  1. Ali, S. S. , Shaheen, A. and Pervez, R. . 2009. A new species of Hoplolaimus (Basirolaimus) (Hoplolaiminae: Tylenchida) from pigeon pea ecosystem of Bumdelkhand region. Trends in Biosciences 2:36–38. [Google Scholar]
  2. Bae, C. , Szalanski, A. L. and Robbins, R. T. . 2008. Molecular analysis of the lance nematode, Hoplolaimus spp., using the first Internal Transcribed Spacer and the D1-D3 expansion segments of 28S Ribosomal DNA. Journal of Nematology 40:201–209. [PMC free article] [PubMed] [Google Scholar]
  3. Bae, C. , Szalanski, A. L. and Robbins, R. T. . 2009. Genetic variation of Hoplolaimus columbus populations in the United States using PCR-RFLP analysis of nuclear rDNA ITS regions. Journal of Nematology 41:197–193. [PMC free article] [PubMed] [Google Scholar]
  4. Blaxter, M. L. , De Ley, P. , Garey, J. R. , Liu, L. X. , Scheldeman, P. , Vierstraete, A. , Vanfleteren, J. R. , Mackey, L. Y. , Dorris, M. , Frisse, L. M. , Vida, J. T. and Thomas, W. K. . 1998. A molecular evolutionary framework for the phylum Nematoda. Nature 392:71–75. [DOI] [PubMed] [Google Scholar]
  5. Bridge, J. , Price, N. S. and Kofi, P. . 1995. Plant parasitic nematodes of plantain and other crops in Cameroon, West Africa. Fundamental and Applied Nematology 18:251–260. [Google Scholar]
  6. CABI 2014. Hoplolaimus pararobustus (Sch. Stek. & Teun., 1938) Sher in Coomans, 1963, lance nematode. Crop Protection Compendium No AQB CPC records. Sheet 1188.
  7. Caveness, F. E. 1967. Shade house host range of some Nigerian nematodes. Plant Disease Reporter 51:33–37. [Google Scholar]
  8. Chaturvedi, Y. and Khera, S. . 1979. Studies on taxonomy, biology and ecology of nematodes associated with jute crops. Zoological Survey of India, Technical Monograpghs No. 2:1–105.
  9. Cobb, N. A. 1913. New nematode genera found inhabiting fresh water and non-brackish soils. Journal of the Washington Academy of Sciences 3:432–444. [Google Scholar]
  10. Darriba, D. , Taboada, G. L. , Doallo, R. and Posada, D. . 2012. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9:772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. De Waele, D., Mc Donald, A. H. , Jordaan, E. M. , Orion, D. , Van den Berg, E. and Loots, G. C. . 1998. Plant-parasitic nematodes associated with maize and pearl millet in Namibia. African Plant Protection 4:113–117. [Google Scholar]
  12. EPPO 2020. Hoplolaimus pararobustus. EPPO Global Database, available at: http://gd.eppo.int.
  13. Edgar, R. C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32:1792–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Filipjev, I. N. 1936. On the classification of the Tylenchinae. Proceedings of the Helminthological Society of Washington 3:80–82. [Google Scholar]
  15. Fortuner, R. 1991. The Hoplolaimidae. In Nickle, W. R. (Ed.), Manual of agricultural nematology Marcel Dekker, New York, NY, p. 669. [Google Scholar]
  16. Handoo, Z. and Golden, A. M. . 1992. A key and diagnostic compendium to the species of the genus Hoplolaimus Daday, 1905. Journal of Nematology 24:45–53. [PMC free article] [PubMed] [Google Scholar]
  17. Holguin, C. , Baeza, Muller, J. D. and Agudelo, P. . 2015. High genetic diversity and geographic subdivision of three lance nematode species (Hoplolaimus spp.) in the United States. Ecology and Evolution 5:2929–2944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Huelsenbeck, J. P. and Ronquist, F. . 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17:754–755. [DOI] [PubMed] [Google Scholar]
  19. Larget, B. and Simon, D. L. . 1999. Markov chain Monte Carlo algorithms for the Bayesian analysis of phylogenetic trees. Molecular Biology and Evolution 16:750–759. [Google Scholar]
  20. Larizza, A. , Lamberti, F. and Ekanyaka, H. M. R. K. . 1998. The genus Hoplolaimus in Sri Lanka (Nematoda: Tylenchida). Nematologia Meditteranea 26:79–86. [Google Scholar]
  21. Loubana, P. M. , Sarah, J. L. , Sakwe, P. , Mavoungou, J. F. , Gnonhouri, P. , Boisseau, M. and Foure, D. . 2007. Study of the genetic diversity of plant parasitic nematodes on banana and plantains of Central and West Africa. African Crop Science Conference Proceedings 8:783–786. [Google Scholar]
  22. Luc, M. 1958. Nematodes and wilting in cotton in Southwestern Madagascar. Coton et Fibres Tropicales 13:239–256. [Google Scholar]
  23. Ma, X. , Agudelo, P. , Mueller, J. D. and Knap, H. T. . 2011. Molecular characterization and phylogenetic analysis of Hoplolaimus stephanus . Journal of Nematology 43:25–34. [PMC free article] [PubMed] [Google Scholar]
  24. Ma, X. , Robbins, R. T. , Bernard, E. C. , Holgun, C. M. and Agudelo, P. . 2019. Morphological and molucular characterisation of Hoplolaimus smokyensis n. sp. (Nematoda: Hoplolaimidae), a lance nematode from Great Smoky Mountains National Park, USA. Nematology 21:923–935. [Google Scholar]
  25. Mansourabad, M. A. , Ghaderi, R. , Kashi, L. and Karegar, A. . 2016. Observations on Hoplolaimus indicus Sher, 1963 and Hoplolaimus serinhorsti Luc, 1958 (Nematoda: Hoplolaimidae) from Southern Iran. Journal of Crop Protection 5:189–201. [Google Scholar]
  26. Marais, M. , Swart, A. and Buckley, N. H. . 2017. Overview of the South African Plant-Parasitic Nematode Survey (SAPPNS). In Fourie, H. , Spaull, V. W. , Jones, R. K. , Daneel, M. S. and De Waele, D. (Eds), Nematology in South Africa: A view from the 21st Century Springer International Publishing, Cham, p. 451. [Google Scholar]
  27. Marais, M. , Swart, A. , Fourie, H. , Berry, S. D. , Knoetze, R. and Malan, A. P. . 2017. Techniques and procedures. In Fourie, H. , Spaull, V. W. , Jones, R. K. , Daneel, M. S. and De Waele, D. (Eds), Nematology in South Africa: A view from the 21st Century Springer International Publishing, Cham, 73: 117. [Google Scholar]
  28. Nguyen, T. H. , Bui, Q. D. and Trinh, P. Q. . 2015. Description of Hoplolaimus bachlongviensis sp. n. (Nematoda: Hoplolaimidae) from banana soil in Vietnam. Biodiversity Data Journal 3:e6523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Rashidifard, M. , Marais, M. , Daneel, M. S. , Mienie, C. M. S. and Fourie, H. . 2019. Molecular characterisation of Meloidogyne enterolobii and other Meloidogyne spp. from South Africa. Tropical Plant Pathology 44:213–224. [Google Scholar]
  30. Robbin, R. T. , Szalanski, A. L. and Bae, C. . 2009. Molecular identification of some Hoplolaimus species from the USA based on duplex PCR, multiplex PCR and PCR-RFLP analysis. Nematology 11:471–480. [Google Scholar]
  31. Schmidt, A. 1871. Über den Rüben-Nematoden (Heterodera schachtii A.S). Zetsschrift der Vereinte Rübenzukerindustrie Zolliverrin 21:1–19. [Google Scholar]
  32. Schuurmans Stekhoven, J. H. and Teunissen, R. J. H. . 1938. Nématodes libres terrestres. Expl. Parc. Nat. Albert, Mission de Witte (1933-35) Bruxelles. Institut des Parcs Nationaux du Congo Belge 2:1–229.
  33. Shafiee, M. F. and Osman, A. . 1971. The use of nematicides and acaricides for the control of nematodes and mites in established Manho orchards. Phytopathologia Mediterranea 10:271–272. [Google Scholar]
  34. Sher, S. A. 1963. Revision of the Hoplolaiminae (Nematoda). II. Hoplolaimus Daday, 1905 and Aorolaimus n. gen. Nematologica 9:267–295. [Google Scholar]
  35. Siddiqi, M. R. 1974. Hoplolaimus pararobustus. C. I. H. Descriptions of Plant Parasitic Nematodes. Set 3 No. 33. [Google Scholar]
  36. Siddiqi, M. R. 2000. Tylenchida parasites of plants and insects 2nd ed., CABI, Wallingford. [Google Scholar]
  37. Sikora, R. A. , Coyne, D. and Quénéhervé, P. . 2018. Nematode parasites of bananas and plantain. In Sikora, R. A. , Coyne, D. , Hallman, J. and Timper, P. (Eds), Plant parasitic nematodes in subtropical and tropical agriculture 3rd edition, CABI, Wallingford, p. 617. [Google Scholar]
  38. Skarbilovich, T. S. 1959. On the structure of systematics of nematodes. Order Tylenchida Thorne, 1949. Acta Parasitologica Polonica 7:117–132. [Google Scholar]
  39. Subbotin, S. A. , Sturhan, D. , Chizhov, V. N. , Vovlas, N. and Baldwin, J. G. . 2006. Phylogenetic analysis of Tylenchida Thorne, 1949 as inferred from D2 and D3 expansion fragments of the 28S rRNA gene sequences. Nematology 8:455–474. [Google Scholar]
  40. Swart, A. , Fourie, H. , Tiedt, L. R. and Rashidifard, M. . 2020. Description of Calcaridorylaimus heynsi n. sp. (Nematoda: Dorylaimidae) from Potchefstroom, South Africa. Nematology 23:1–11. [Google Scholar]
  41. Thorne, G. 1935. Notes on free-living and plant-parasitic nematodes, 2. Proceedings of the Helminthological Society of Washington 2:96–98. [Google Scholar]
  42. Tiwari, A. K. , Misra, S. L. and Malhotra, S. K. . 2001. Bioecology of nematodes in soil of a sub-humid region. I. Hoplolaimus johani sp. nov. and Hoplolaimus caudifurcatus sp. nov. around fruit crops. Bulgarian Academy of Science Experimental Pathology and Parasitology 4:8–19. [Google Scholar]
  43. Van den Berg, E. and Buckley, N. H. . 1987. Observation on some South African Hoplolaimus species (Hoplolaimidae: Nematoda) using the scanning electron microscope. Phytophylactica 19:355–362. [Google Scholar]
  44. Van den Berg, E. and Heyns, J. . 1970. South African Hoplolaiminae. 1. The genus Hoplolaimus Daday. 1905. Phytophylactica 2:221–226. [Google Scholar]
  45. Van den Berg, E. and Quénéhervé, P. . 2012. Hoplolaimidae. In Manzanilla-López, R. H. and Marbán-Mendoza, N. (Eds), Practical plant Nematology Biblioteca Básico de Agricultura, Montecillo, p. 251. [Google Scholar]
  46. Von Daday, E. 1905. Untersuchungen fiber die Siisserwasser-Mikrofauna Paraguays. Zoologica, Stuttgart 18:1–349. [Google Scholar]
  47. Vovlas, N. and Lamberti, F. . 1985. Observations on the morphology and histopathology of Hoplolaiamus pararobustus attacking coffee in Sao Tome. Nematologia Meditteranea 13:73–80. [Google Scholar]
  48. Whitehead, A. G. 1959. Hoplolaimus angustulatus n.sp. (Hoplolaimidae: Tylenchida). Nematologica 4:99–105. [Google Scholar]
  49. Wollenweber, H. 1923. Krankheiten und Beschädingun der Kartoffel. Arbeiten Forschungs Instituut für Kartoffel, Berlin 7:1-56.
  50. Yeates, G. W. , Bongers, T. , De Goede, R. G. M. , Freckman, D. W. and Georgieva, S. S. . 1993. Feeding habits in soil nematode families and genera – an outline for soil ecologists. Journal of Nematology 25:315–331. [PMC free article] [PubMed] [Google Scholar]
  51. Zarina, B. and Maqbool, M. A. . 1998. Description of Dolichorhynchus (Dolichorhynchus) motiaii n.sp. (Nematoda: Tylenchida) and observations on Basirolaimus dubius (Chaturvedi & Khera, 1979) Siddiqi 1986 from Pakistan. Pakistan Journal of Nematology 16:85–93. [Google Scholar]

Articles from Journal of Nematology are provided here courtesy of Society of Nematologists

RESOURCES