Abstract
A randomized complete block design experiment with 30 yearling crossbred steers (average BW = 436.3 ± 39.8 kg) fed a steam-flaked corn-based diet was used to evaluate the effects dietary vitamin A (Rovimix A 1000; DSM Nutritional Products Ltd., Sisseln, SUI) supplementation on myogenic gene expression and skeletal muscle fiber characteristics during the finishing phase. Steers were blocked by BW (n = 5 blocks; 6 steers/block), randomly assigned to pens (n = 2 steers/pen), and one of the following treatments: no added vitamin A (0 IU; 0.0 IU/kg of dietary dry matter intake of additional vitamin A), vitamin A supplemented at the estimated requirement (2,200 IU; 2,200 IU/kg of dietary dry matter (DM) of additional vitamin A), and vitamin A supplemented at 5× the estimated requirement (11,000 IU; 11,000 IU/kg of dietary DM of additional vitamin A). After all treatments underwent a 91-d vitamin A depletion period, additional vitamin A was top-dressed at feeding via a ground corn carrier. Blood, longissimus muscle, and liver biopsy samples were obtained on days 0, 28, 56, 84, and 112. Biopsy samples were used for immunohistochemical and mRNA analysis. Sera and liver samples were used to monitor circulating vitamin A and true vitamin A status of the cattle. Expression for myosin heavy chain (MHC)-I diminished and rebounded (P = 0.04) over time. The intermediate fiber type, MHC-IIA, had a similar pattern of expression (P = 0.01) to that of MHC-I. On day 84, C/EBPβ expression was also the greatest (P = 0.03). The pattern of PPARγ (P < 0.01) and PPARδ (P < 0.01) expression seemed to mimic that of MHC-I expression, increasing from days 84 to 112. Distribution of MHC-IIA demonstrated a change over time (P = 0.02). Muscle fiber cross-sectional area increased by day (P < 0.01) for each MHC with the notable increase between days 0 and 56. Total nuclei density decreased (P = 0.02) over time. Cells positive for only Myf5 increased (P < 0.01) in density early in the feeding period, then declined, indicating that satellite cells were fusing into fibers. The dual-positive (PAX7+Myf5) nuclei also peaked (P < 0.01) around day 56 then declined. These data indicated that gene expression associated with oxidative proteins may be independent of vitamin A status in yearling cattle.
Keywords: beef, fiber type, gene expression, muscle biopsy, steer, vitamin A
Introduction
Postnatal skeletal muscle growth is primarily a product of hypertrophy, or the accumulation of protein within existing myofibers. This accumulation of muscle mass is determined by many factors, one of which is muscle fiber type. As they develop and undergo various environmental changes, hormonal stimulation, and maturation, muscle fibers in cattle can be converted from slow twitch, oxidative fibers to fast twitch, glycolytic fibers [myosin heavy chain (MHC) I to IIA to IIX], or vice versa (Pette and Staron, 2000). As cattle mature and cross-sectional myofiber area increases, the muscle fibers tend to become more glycolytic (Pette and Staron, 2000; Hergenreder et al., 2016). Increased fiber diameter may increase yield, but also reduces tenderness, which is the most economically relevant meat attribute (Savell et al., 1987; Miller et al., 2012). The investigation of muscle energetics provides an opportunity to optimize the balance between meat yield and quality.
Peroxisome proliferator-activated receptor (PPAR) δ, or β, plays a critical role in energy homeostasis of skeletal muscle. A recent in vitro study by Kim et al. (2018), which proposed that retinoic acid may upregulate oxidative metabolism in muscle through the activation of PPARδ, observed an increase in oxidative (MHC-I) cultured muscle fibers as a result of treatment with retinoic acid (10 nM all-trans-retinoic acid). Wang et al., (2018) took a different approach, evaluating PPARγ coactivator-1 (PGC-1α) upon neonatal vitamin A injection in cattle. Several studies proposed that PGC-1α activates calcineurin signaling, which leads to the formation of type I muscle fibers, likely resulting in a measurable change in PPARγ expression (Amin et al., 2010; Zierath et al., 1998; Park et al., 1997). Based upon this research, it was hypothesized that dietary vitamin A supplementation would alter myofiber type.
Additionally, to accumulate protein, sufficient DNA must be incorporated into the muscle cell (Mauro, 1961). This is done through the integration of satellite cells into the myofiber. These stem cells remain quiescent until environmental stress or molecular signaling indicates that more DNA is needed (Le Grand and Rudnicki, 2007). Satellite cells are heterogeneous, with the ability to express paired box 7 (Pax7) and myogenic factor (Myf) 5. During myogenic differentiation of satellite cells, basic helix-loop-helix transcription factor Myf5 plays an important role (Wang and Rudnicki, 2012). One review explained that a family of related genes, myoblast determination protein 1, myogenin, Myf5, and myogenic regulatory factor (MRF) 4 (or Myf6), are responsible for the initiation of myogenesis, but each individual gene could initial myogenesis (Tapscott and Weintraub, 1991). Satellite cells that express Pax7 may produce either Myf5+ or Myf5- satellite cells. However, only cells that express both Pax7 and Myf5 are capable of myogenic differentiation, while Pax7-positive, Myf5-negative satellite cells can still proliferate (Punch et al., 2009). A recent study experienced an increase in Pax7-positive satellite cells as a result of neonatal vitamin A injection (Wang et al., 2018). Based on this research, it was hypothesized that dietary vitamin A supplementation would alter satellite cell activity.
Therefore, objective of the current study was to evaluate the effect of vitamin A status on myogenic gene expression, muscle fiber type, cross-sectional myofiber area, and satellite cell expression, Pax7, and Myf5 throughout the finishing feeding phase in steers.
Materials and Methods
Animal management and treatments
All procedures were approved by the Texas Tech University Institutional Animal Care and Use Committee (Protocol Number: 18003-01). Bos taurus crossbred steers (n = 30; average BW = 297.6 ± 32.8 kg) were obtained from a commercial cattle company and processed upon arrival at the Burnett Center of Texas Tech University, New Deal, TX. Steers received ear tags for identification, were treated with anthelmintics, and vaccinated in accordance with Texas Tech University health protocols. After a 91-d vitamin A depletion period, the steers [average body weight (BW) = 436.3 ± 39.8 kg] were blocked by initial BW and organized in a randomized complete block design (2 steers/pen; 15 pens total; 5 pens/treatment). At day 0, the average liver concentration for all animals was 26.33 µg/g depleted from 145.78 µg/g at day −91 (Wellmann et al., 2020). Pens within block were randomly assigned 1 of 3 treatments: no added vitamin A (0 IU; 0.0 IU/kg of dietary dry matter intake of additional vitamin A), vitamin A supplemented at the estimated requirement (2,200 IU; 2,200 IU/kg of dietary dry matter (DM) of additional vitamin A), and vitamin A supplemented at 5× the estimated requirement (11,000 IU; 11,000 IU/kg of dietary DM of additional vitamin A). Steers were fed ad libitum, using clean bunk management, with a 90% concentrate finishing diet designed to deplete vitamin A, while meeting the remaining NASEM (2016) requirements for growing-finishing beef cattle (Table 1). The diet contained 12.5% crude protein (DM basis), recommended levels of supplemental vitamins and minerals, monensin (Rumensin: Elanco Animal Health, Greenfield, IN; 30 g/ton of DM) and tylosin tartrate (Tylan: Elanco Animal Health; 10 g/ton of DM). No β-adrenergic agonist was fed, nor were steers provided with implants during the finishing phase to minimize any factors that could influence muscle fiber characteristics beyond the dietary treatments. Animal health and welfare were monitored daily. The basal diet included minimal vitamin A activity (<200 IU of vitamin A activity/kg of dietary DM) via the provitamin A, β -carotene. Additional vitamin A was top-dressed at feeding via a ground corn carrier (0.45 kg/pen/d). Daily feed deliveries were recorded, and orts were weighed weekly to calculate feed intake. The live and carcass performance of these sample groups were evaluated separately as explained by Wellmann et al. (2020).
Table 1.
Description of experimental diets (DM basis)1
| Ingredients, % DM | Value |
|---|---|
| Steam-flaked corn | 64.72 |
| Wet corn gluten feed | 19.92 |
| Cottonseed hulls | 4.00 |
| Native grass hay, chopped | 3.94 |
| Fat (yellow grease) | 3.08 |
| Supplement | 1.95 |
| Limestone | 1.88 |
| Urea | 0.51 |
| Chemical composition, DM4 | |
| DM, % | 78.88 |
| Crude protein, % | 12.53 |
| Acid detergent fiber, % | 10.1 |
| Neutral detergent fiber, % | 17.30 |
| Ash, % | 4.63 |
| Total digestible nutrients, % | 84.5 |
| NEM, Mcal/kg | 2.15 |
| NEG, Mcal/kg | 1.48 |
| Vitamin A activity, IU5 | 167 |
1Diets were formulated to meet or exceed NASEM (2016) requirements for growing-finishing beef cattle.
2 Supplement composition (DM basis): 67.755% ground corn, 15.000% NaCl, 10.000% KCl, 3.760% urea, 0.986% zinc sulfate, 0.750% Rumensin-90 (Elanco, Greenfield, IN), 0.506 Tylan-40 (Elanco), 0.500% Endox (Kemin Industries, Des Moines, IA), 0.196% copper sulfate, 0.167% manganese oxide, 0.157% vitamin E (500 IU/g), 0.125% selenium premix (0.2% Se), 0.083% iron sulfate, 0.003% ethylenediamine dihydroiodide, and 0.002% cobalt carbonate.
4Values as measured by proximate analysis of bunk samples on a DM basis except diet DM (Servi Tech Laboratories, Amarillo, TX).
5Vitamin A activity was calculated based on ingredient β -carotene content, and its conversion in cattle. Treatments were added to basal content: 0 IU; 0.0 IU/kg of additional vitamin A, 2,200 IU; 2,200 IU/kg of dietary DM of additional vitamin A, 11,000 IU; 11,000 IU/kg of dietary DM of additional vitamin A.
Animal removal
One steer (11,000 IU) contracted chronic pneumonia resulting in death on day 114. Day 112 liver retinol, blood, and muscle were unable to be collected for this animal. The steer was not an outlier for any data recorded up to the time of death; therefore, data contributions for this steer from day −91 through 84 remained in the analyses.
Sample collection
All data were collected on a designated sampling day prior to feeding. Body weights for all cattle were measured on days 0, 28, 56, 84, 112 and on day 119 prior to shipping. Skeletal muscle tissue, liver tissue, and blood samples were acquired on days 0, 28, 56, 84, and 112. Blood was obtained via jugular venipuncture.
Longissimus muscle samples were obtained via a biopsy procedure to evaluate muscle fiber type (Dunn et al., 2003). During the biopsy procedure, steers were restrained using a hydraulic squeeze chute. The area surrounding the incision site was shaved using a disposable razor, then sanitized using a solution of water, 7.5% povidone iodine surgical scrub (Betadine, Purdue Products, L.P., Stamford, CT), and 70% ethanol. A local anesthetic (lidocaine HCl, 20 mg/mL, 8 mL per biopsy) was administered subcutaneously in a 6 cm2 rhombus-shaped pattern (4 injection sites, 2 mL lidocaine HCl per site) no less than 5 min prior to the biopsy incision. The area was sterilized using 70% ethanol and sterile gauze post-numbing, then a 1-cm long incision was made using a sterile scalpel. A sterile 6-mm diameter Bergstrom biopsy needle was used to collect ~2 g of longissimus tissue. The sample was placed on sterile gauze in a covered plastic container to be taken to the sample preparation area. The incision was closed using veterinary tissue adhesive (VetBond, 3M Animal Care Products, St. Paul, MN) and coated with a protective aerosol bandage (AluShield, Neogen Corp, Lexington, KY) to aid in infection prevention during the healing process. The initial biopsy punctured the interior portion of the longissimus between the 12th and 13th rib on the left side of the spine. Subsequent consecutive biopsies alternated laterally across the spine; therefore, the second biopsy collected muscle between the 12th and 13th rib on the right side of the spine. Proceeding beyond the second sample day, tissue collection progressed anteriorly along the spine to avoid previous surgery sites, but samples were not collected at a distance greater than 15 cm from the initial biopsy site respective to each side of the spine.
In the sample preparation area, the tissue was divided into portions for immunohistochemical (IHC) and mRNA analysis. The IHC sample was analyzed under a magnifying glass, and muscle fibers were identified. The fibers were placed parallel to each other on a 1 × 1.5-cm piece of cork board and frozen in clear frozen section compound (VWR International, West Chester, PA) using isopentane cooled with dry ice. The samples on cork pieces were wrapped in foil, placed in sample bags (Whirl-Pak, NASCO, Fort Atkinson, WI), and stored on dry ice until transport back to Texas Tech University, Lubbock, TX. The portions for RNA analysis were sealed in sample bags, frozen in liquid-N, and stored on dry ice until transport back to Texas Tech University. All skeletal muscle samples were stored at −80 °C until further processing.
Steers were transported 203 km to a commercial abattoir for harvest on day 119 after undergoing a 7-d observational period to allow for withdrawal from lidocaine. Carcass data were collected by West Texas A&M University Beef Carcass Research Center personnel and included hot carcass weight, 12th rib fat thickness, longissimus muscle area, percent kidney/pelvic/heart fat, yield grade, and marbling score.
Sample processing
Longissimus biopsy sample processing and analysis for immunohistochemistry, RNA, and protein were adapted from standard operating procedures in the Texas Tech University laboratory, previously established by Hergenreder et al. (2016). Liver and blood samples were analyzed by the Michigan State University Veterinary Diagnostic Laboratory (Wellmann et al., 2020).
Immunohistochemical analysis
Embedded longissimus samples for IHC staining and analysis were moved from −80 to −20 °C to reduce brittleness for 24 hr. Samples were removed from cork, cut into 10 µm-thick cross sections at −20 °C using a Leica CM1950 cryostat (Leica Biosystems, Buffalo Grove, IL) and affixed to positively charged glass slides (4 slides per sample, 5 cross sections per slide; Superfrost Plus, VWR International). Cross sections were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS; Thermo Fisher Scientific, Waltham, MA) for 10 min at room temperature, then rinsed briefly twice in PBS followed by one 10 min bath in PBS at room temperature. A blocking solution consisting of 2% bovine serum albumin (MD Biomedical, Solon, OH), 5% horse serum (Invitrogen, Carlsbad, CA), and 0.2% Triton-X 100 (Thermo Fisher Scientific) in PBS was then applied to the fixed cross sections and allowed to incubate for 30 min at room temperature to prevent nonspecific antibody binding. The cross sections were incubated with primary antibodies in blocking solution for 1 hr at room temperature. The muscle fiber type and cross-sectional area slides were evaluated using the following primary antibodies: 1:100 α-dystrophin, rabbit, immunoglobulin (Ig) G (PA5-16734, Thermo Scientific); 1:100 supernatant anti-MHC-I, mouse, IgG2b (BA-D5, AB_2235587; Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA); and supernatant anti-MHC all except type IIX, mouse, IgG1 (BF-35, AB_2274680, Developmental Studies Hybridoma Bank). The cross sections were rinsed in PBS for 5 min at room temperature three times. Secondary antibodies in blocking solution were then applied to the cryosections for 30 min at room temperature in the dark. The secondary antibodies included: 1:1,000 goat α-rabbit, IgG, Alexa-Fluor 488 (Invitrogen); 1:1,000 goat α-mouse, IgG2b, Alexa-Fluor 546 (Invitrogen); 1:1,000 goat α-mouse, IgG1, Alexa-Fluor 633 (Invitrogen). Following the incubation period, the slides were rinsed 3 times with PBS for 5 min at room temperature. Muscle fiber type and cross-sectional area slides were then cover-slipped using ProLong Gold with 4′6-diamidino-2-phenylindole (DAPI) mounting media (Life Technologies, Carlsbad, CA) and thin glass cover slips (VWR International). Slides were then left to cure in the dark for 36 hr at room temperature. The satellite cell slides were evaluated using primary antibodies, 1:100 anti-Myf5, rabbit, IgG (Abcam, Cambridge, UK) and 1:100 anti-Pax7, mouse, IgG1 (PAX7; Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA). The cross sections were rinsed in PBS for 5 min at room temperature 3 times. Secondary antibodies in blocking solution were then applied to the cryosections for 30 min at room temperature in the dark. Slides were then treated with 1:1,000 goat α-rabbit, IgG, Alexa-Fluor 488 (Invitrogen) and 1:1,000 goat α-mouse, IgG1, Alexa-Fluor 546 (Invitrogen). Following the incubation period, the slides were rinsed 3 times with PBS for 5 min at room temperature. Post-rinse, slides were incubated in a 1:1,000 DAPI PBS solution for 5 min. Slides were briefly rinsed 2 times for ~30 s, then cover-slipped using Aqua-Mount mounting media (Thermo Scientific), and thin glass cover slips (VWR International). Slides were then left to cure in the dark for 24 hr at room temperature.
Muscle fiber type and cross-sectional area slides underwent 100× magnification and satellite cell slides underwent 200× magnification with an inverted fluorescence microscope (Nikon Eclipse, Ti-E; Nikon Instruments Inc., Mellville, NY) using a UV light source (Nikon Intensilight Inc.; C-HGFIE), and images were obtained using a CoolSnap ES2 monochrome camera. Five images of the longissimus IHC sections were randomly captured from each slide. For fiber type distribution and satellite cell data, the mean of the measurements from 5 images per animal were used. The area of each fiber type per sample was averaged for fiber cross-sectional areas prior to statistical analysis. Images were artificially colored and analyzed with NIS Elements Imaging software. Muscle fibers in each image were identified and reported as a percentage of the total number of muscle fibers. The cross-sectional area of each fiber in each image was measured using NIS Elements software (Nikon Instruments Inc.) and reported on a micro meter squared basis. Total nuclei, Pax7 positive, Myf5 positive, and dual positive were quantified using NIS Elements software (Nikon Instruments Inc.) and reported on a density per millimeter square basis.
RNA isolation and real-time quantitative reverse transcription polymerase chain reaction
Ribonucleic acid from longissimus tissue was isolated with cold buffer containing TRI Reagent (Sigma, St. Louis, MO). Approximately 0.8 g of frozen tissue was homogenized with TRI Reagent at a ratio of 0.5:1 g of tissue to milliliter reagent. The homogenate was pipetted into 1 microcentrifuge tube (1 mL sample per tube), 200 μL chloroform was added to each tube, vortexed for 30 s, and incubated for 5 min. The sample was then centrifuged at 15,000 × g for 15 min. The most superficial supernatant layer was pipetted into new microcentrifuge tubes. Cold isopropyl alcohol (250 μL) was added to the supernatant, mixed, and incubated for 10 min on ice. The samples were then centrifuged at 15,000 × g for 10 min. The supernatant was decanted, and the RNA pellet at the bottom of each tube were allowed to dry. Then, 500 μL of 75% ethanol was added to each tube to rinse and suspend the RNA pellet. Samples were then placed in a −80 °C freezer. Upon further analysis, samples were removed from the freezer and thawed on ice. Samples were then centrifuged at 15,000 × RPM for 10 min, ethanol was poured off, and the pellet was air dried. Nuclease-free water (30 μL) was then added to each sample to dissolve the RNA pellet. The concentration of RNA was determined with a spectrophotometer at an absorbance of 260 nm using a NanoDrop 1000 (NanoDrop products, Wilmington, DE). Samples were then treated with gDNA wipeout to remove any DNA contaminants using a QuantiTect Reverse Transcription Kit (Qiagen, Gaithersburg, MD). The RNA then underwent reverse transcription to synthesize cDNA. The cDNA was used for real-time quantitative reverse transcription-polymerase chain reaction to measure the abundance of MHC-I, MHC-IIA, MHC-IIX, Ccaat-enhancer-binding protein (C/EBP)β, lipoprotein lipase (LPL), PPARγ, PPARδ, and eukaryotic elongation factor 1- α 2 (EEF1A2) mRNA as a fraction of total RNA isolated from muscle tissue (Table 2). Expression for EEF1A2 was not different across tissue samples, therefore it was used as the endogenous control to normalize gene expression. Normalization and calculation of gene expression levels from LM biopsy samples were obtained via the SDS RQ Manager Program (Applied Biosystems). Assays were performed in the GeneAmp 7900HT Sequence Detection System (Applied Biosystems, Life Technologies) using thermal cycling parameters recommended by the manufacturer (40 cycles of 15 s at 95 °C and 1 min at 60 °C).
Table 2.
Primer and probe sequences for the gene expression analysis
| Genes | Sequence (5′ to 3′) |
|---|---|
| MHC-I | |
| Forward | CCCACTTCTCCCTGATCCACTAC |
| Reverse | TTGAGCGGGTCTTTGTTTTTCT |
| TaqMan probe | 6FAM-CCGGCACGGTGGACTACAACATCATAG-TAMRA |
| MHC-IIA | |
| Forward | GCAATGTGGAAACGATCTCTAAAGC |
| Reverse | GCTGCTGCTCCTCCTCCTG |
| TaqMan probe | 6FAM- TCTGGAGGACCAAGTGAACGAGCTGA-TAMRA |
| MHC IIX | |
| Forward | GGCCCACTTCTCCCTCATTC |
| Reverse | CCGACCACCGTCTCATTCA |
| TaqMan probe | 6FAM-CGGGCACTGTGGACTACAACATTACT-TAMRA |
| PPARγ | |
| Forward | ATCTGCTGCAAGCCTTGGA |
| Reverse | TGGAGCAGCTTGGCAAAGA |
| TaqMan probe | 6FAM-CTGAACCACCCCGAGTCCTCCCAG-TAMRA |
| PPARδ | |
| Forward | GCCCTTCAGTGACATCATTGAG |
| Reverse | CAGGTCACTGTCATCAAGTTCCA |
| TaqMan probe | 6FAM- CCAAGTTCGAGTTTGCCGTCAAGTTCAA –TAMRA |
| CEBPβ | |
| Forward | CCAGAAGAAGGTGGAGCAACTG |
| Reverse | TCGGGCAGCGTCTTGAAC |
| TaqMan probe | 6FAM-CGCGAGGTCAGCACCCTGC-TAMRA |
| LPL | |
| Forward | CGGACTCCAACGTCATCGT |
| Reverse | GCTTGGTGTACCCTGCAGACA |
| TaqMan probe | 6FAM-TCACGGGCCCAGCAGCATTATCC-TAMRA |
| EEF1A2 | |
| Forward | CAGGCCACCTCATCTACAAGTG |
| Reverse | CTCTGCTGCCTCCTTCTCAAA |
| TaqMan probe | 6FAM-CATCGACAAGCGGACCATCGAGAA-TAMRA |
MHC: myosin heavy chain, C/EBPβ: CCAAT/enhancer-binding protein β, PPAR: peroxisome proliferated activated receptor, LPL: lipoprotein lipase, and EEF1A2: eukaryotic elongation factor 1-α 2.
Statistical analysis
Cross-sectional fiber area data were analyzed using the MIXED procedure of SAS 9.4 (SAS Inst. Inc., Cary, NC), while fiber type and satellite data were analyzed using the GLIMMIX procedure of SAS. All data were run as a randomized complete block design appropriate for repeated measures considering pen as the experimental unit. The statistical model for the effect of treatment and days on feed included the fixed effect of treatment, day, and the interaction of treatment × day, while block was considered a random effect. Least squares means were generated using the LSMEANS statement of SAS. Data were separated and denoted to be different using the pairwise comparisons option of SAS when a significant preliminary F-test was detected. The covariance structure with the lowest Akaike information criterion was used. All results are reported as least-squares means. Data were separated using the PDIFF option of SAS if a significant preliminary F-test was detected. The Kenward–Roger adjustment was utilized to correct the degrees of freedom. An α-level of 0.05 was used to determine significance, with tendencies discussed at P-values between 0.05 and 0.10. Analyses regarding live animal vitamin A status were fully explained by Wellmann et al. (2020).
Results and Discussion
Upon arrival, steers from all treatments had liver retinol values >140 µg/g of liver tissue. By day 0, after the depletion phase, liver concentrations for all treatments were below 30 µg/g of liver tissue (Wellmann et al., 2020). The liver retinol concentration for the 0 IU and 2,200 IU treatments remained below 30 µg/g of liver tissue for the duration of the feeding period. Even the 11,000 IU treatment group did not fully recover to their original vitamin A status, only returning to above 100 µg of retinol/g of liver tissue at day 112 (Wellmann et al., 2020).
There were no treatment × time interactions for MHC-I, IIA, or IIX, PPARγ or δ, C/EBPβ, or LPL gene expression (Table 3). Several genes did demonstrate a day effect, but there were no differences between treatments. Expression for MHC-I diminished and rebounded (P = 0.04) from the beginning to the end of the trial. The intermediate fiber type, MHC-IIA, had a similar pattern of expression (P = 0.01) to that of MHC-I, with its peak on day 84. The addition of retinoic acid altered gene expression of MHCs in an in vitro study using a primary bovine satellite cell culture (Kim et al., 2018). Expression of MHC-I, which is associated with oxidative, slow twitch muscle fiber types, increased with the inclusion of all-trans-retinoic acid. Additionally, retinoic acid downregulated the expression of MHC-IIA and -IIX (Kim et al., 2018). It is reported that all-trans retinoic acid has a high affinity for PPARδ and results in activation of transcription by promoting the coactivator SRC-1 (Shaw et al., 2003). The increased expression of genes related to oxidative proteins, compared with glycolytic-associated genes, reported by Kim et al. (2018) may be attributed to this phenomenon. Wang et al. (2018) reported a similar occurrence in calves injected with vitamin A at birth and 1 mo of age. To better understand this mode of action, PGC-1α was evaluated upon the neonatal vitamin A injection. This study and others proposed that PGC-1α activates calcineurin signaling, leading to the formation of type I fibers, which would result in some subsequent change in PPARγ (Park et al., 1997; Zierath et al., 1998; Amin et al., 2010). However, the effect of retinoic acid on PPARγ is thought to be indirect for both activation and suppression of the gene (Shaw et al. 2003). The pattern of PPARγ (P < 0.01) and PPARδ (P < 0.01) expression seemed to more closely mimic that of MHC-I expression, increasing from days 84 to 112, supporting the previously reported data.
Table 3.
Effects of vitamin A supplementation on relative mRNA concentrations of genes in longissimus tissue relative to EEF1A2
| Day | Treatment, IU/kg vitamin A | P-values | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene | 0 | 28 | 56 | 84 | 112 | SEM | 0 IU | 2,200 IU | 11,000 IU | SEM | TRT | Day | TRT×Day |
| MHC I | 1.46ab | 1.26abc | 1.18c | 1.23bc | 1.46a | 0.079 | 1.39 | 1.25 | 1.3 | 0.137 | 0.71 | 0.04 | 0.63 |
| MHC-IIA | 1.06ab | 0.81bc | 0.61c | 1.12a | 1.02ab | 0.104 | 1.00 | 0.86 | 0.91 | 0.18 | 0.44 | 0.01 | 0.72 |
| MHC IIX | 1.76 | 1.67 | 1.67 | 1.67 | 1.56 | 0.097 | 1.74 | 1.6 | 1.66 | 0.167 | 0.28 | 0.54 | 0.37 |
| PPARγ | 0.23b | 0.2b | 0.32a | 0.27ab | 0.31a | 0.027 | 0.25 | 0.28 | 0.25 | 0.047 | 0.93 | <0.01 | 0.20 |
| PPARδ | 0.85c | 0.93bc | 1.07ab | 0.75c | 1.21a | 0.076 | 0.99 | 0.93 | 0.96 | 0.132 | 0.62 | <0.01 | 0.44 |
| C/EBPβ | 1.24b | 1.37b | 1.31b | 1.8a | 1.09b | 0.120 | 1.34 | 1.41 | 1.34 | 0.209 | 0.09 | 0.03 | 0.59 |
| LPL | 1.11 | 0.94 | 0.91 | 0.93 | 1.06 | 0.069 | 0.95 | 1.00 | 1.02 | 0.12 | 0.72 | 0.15 | 0.14 |
abcMeans within same row with different superscripts differ for effect of day (P < 0.05).
xyMeans within same row with different superscripts differ for effect of treatment (P < 0.05).
MHC: myosin heavy chain, PPAR: peroxisome-proliferator activated receptor, C/EBP: Ccaat/enhancer binding protein, and LPL: lipoprotein lipase.
Accompanying the expression of the MHCs, C/EBPβ expression was also the greatest (P = 0.03) on day 84. Discussion regarding C/EBPβ is most often associated with the cascade of signaling that occurs during adipogenesis. Similar to satellite cell activation, adipogenesis requires determination and differentiation of multipotent cells (Lefterova and Lazar, 2009). Upon the expression of preadipocyte factor-1, these cells lose their pluripotency and succumb to the expression of C/EBPβ, postclonal expansion (Symonds, 2012). As a result of C/EBPβ expression, PPARγ is activated, eventually leading to the maturation of adipocytes. The close proximity of intramuscular fat (IMF) and muscle fibers, and the ability of the muscle to utilize IMF for energy may result in an indirect manipulation of the surrounding muscle fiber types related to adipogenic gene expression. The increase in C/EBPβ expression seems to preface the more oxidative gene expression, indicating that the transcription factor, C/EBPβ, plays a role in oxidative metabolism in the muscle. Pickworth et al. (2012) conducted a feedlot trial using 2 concentrations of vitamin A (3,750 IU/kg dietary DM or 1,860 IU/kg dietary DM). Retinol concentration of the intramuscular adipose tissue was 38% lower than that of the subcutaneous adipose tissue. Indicating that vitamin A storage in IMF may be influenced by muscle metabolism.
There was no interaction for treatment × day in total nuclei, Myf5-positive, Pax7-negative, or dual-positive myonuclei. Total nuclei density decreased (P = 0.01) gradually over time (Figure 1), an expected result of the incorporation of DNA into muscle for the process of hypertrophy. As they are only a fraction of the total nuclei, cells positive for only Myf5 increased (P < 0.01) in density early in the feeding period, before plateauing at day 56 (Figure 2). Rather than mirroring the steady decline in total nuclei, these cells, predestined to become myofibers, were about 10 times more prevalent than either the PAX7- or dual-positive nuclei.
Figure 1.
Effects of vitamin A supplementation on muscle nuclei density (mm2) in feedlot steers from longissimus biopsies collected on days 0, 28, 56, 84, and 112 of the feeding trial (n = 15). Treatments were 0 IU vitamin A/kg diet DM, 2,200 IU vitamin A/kg diet DM (Rovimix A 1000; DSM Nutritional Products Ltd., Sisseln, SUI), and 11,000 IU vitamin A/kg diet DM. Cross sections of skeletal muscle samples were stained by immunohistochemistry using DAPI. Superscripts (a–c) denote differences between days.
Figure 2.
Effects of vitamin A supplementation on Myf5-positive, PAX7-negative myonuclei density (mm2) in feedlot steers from longissimus biopsies collected on days 0, 28, 56, 84, and 112 of the feeding trial (n = 15). Treatments were 0 IU vitamin A/kg diet DM, 2,200 IU vitamin A/kg diet DM (Rovimix A 1000; DSM Nutritional Products Ltd., Sisseln, SUI), and 11,000 IU vitamin A/kg diet DM. Cross sections of skeletal muscle samples were stained by immunohistochemistry using DAPI, anti-Myf5 antibodies, and antil-PAX7 antibodies. Superscripts (a–c) denote differences between days.
An increase in the population of satellite cells leaving the quiescent state to proliferate and differentiate can indicate the skeletal muscle is preparing for hypertrophy (Schultz and Lipton, 1982; Gibson and Schultz, 1983). As satellite cell fusion provides the additional nuclei to support increased protein synthesis in skeletal muscle, nuclei density will inherently decline (Cheek et al., 1971; Mesires and Doumit, 2002; Li et al., 2011). Unlike Myf5-positive cells, PAX7-positive, and Myf5-negative satellite cells are still proliferative. Cells positive for only PAX7 had an effect for treatment (P = 0.03) and day (P < 0.01). Initially, the 0 IU treatment had the greatest PAX7 density; however, by day 56, the PAX7 density had declined and there was no longer a difference between treatments (Figure 3). The dual-positive (PAX7+Myf5; Figure 4) nuclei also increased through day 56 prior to a decline to day 112 (Figure 5) As Myf5-positive cells, these nuclei are no long pluripotent and will be readily collected into the muscle.
Figure 3.
Effects of vitamin A supplementation on Myf5-negative, PAX7-positive myonuclei densities (mm2) in feedlot steers from longissimus biopsies collected on days 0, 28, 56, 84, and 112 of the feeding trial (n = 15). Treatments were 0 IU vitamin A/kg diet DM, 2,200 IU vitamin A/kg diet DM (Rovimix A 1000; DSM Nutritional Products Ltd., Sisseln, SUI), and 11,000 IU vitamin A/kg diet DM. Cross sections of skeletal muscle samples were stained by immunohistochemistry using DAPI, anti-Myf5 antibodies, and antil-PAX7 antibodies. Superscripts (a–g) denote differences between treatments at each day.
Figure 4.
Effects of vitamin A supplementation on Myf5-, PAX7-, and dual-positive myonuclei densities (mm2) in feedlot steers from longissimus biopsies collected on days 0, 28, 56, 84, and 112 of the feeding trial (n = 15). Treatments were 0 IU vitamin A/kg diet DM, 2,200 IU vitamin A/kg diet DM (Rovimix A 1000; DSM Nutritional Products Ltd., Sisseln, SUI), and 11,000 IU vitamin A/kg diet DM. Cross sections of skeletal muscle samples were stained by immunohistochemistry using DAPI, anti-Myf5 antibodies, and antil-PAX7 antibodies. Superscripts (a–c) denote differences between days.
Figure 5.
Immunohistochemical staining of skeletal muscle for Myf5-, PAX7-, and dual-positive myonuclei in feedlot steers from longissimus biopsies collected on days 0, 28, 56, 84, and 112 of the feeding trial (n = 15). Treatments were 0 IU vitamin A/kg diet DM, 2,200 IU vitamin A/kg diet DM (Rovimix A 1000; DSM Nutritional Products Ltd., Sisseln, SUI), and 11,000 IU vitamin A/kg diet DM. Cross sections of skeletal muscle samples were stained by immunohistochemistry using DAPI, anti-Myf5 antibodies, and antil-PAX7 antibodies.
Wang et al. (2018) observed an increase in PAX7-positive satellite cells in 2-mo-old calves injected with vitamin A intramuscularly. Considering the rapid growth of neonatal animals, it is critical that satellite cells maintain their proliferative capabilities. The same study used an anti-desmin stain to determine whether the mononuclear cells were myogenic, similar to the evaluation of Myf5-positive cells in the current study (Wang et al., 2018). The basis for the increase in PAX7-positive satellite in the vitamin A treated calves was not discussed by Wang et al. (2018), but recorded an increase in oxidative muscle fibers in the same group of calves. Lin et al. (2002) states that the activation of PGC-1α upregulates the transcription and translation of oxidative muscle fibers. This transcription factor is activated by the all-trans retinoic acid form of vitamin A. This sequence was demonstrated in primary myogenic cells (Kim et al., 2018; Wang et al., 2018). The combination of vitamin A activation of oxidative muscle fibers in conjunction with the growth stage of the younger animals likely resulted in the PAX7-positive satellite cell increase reported by Wang et al. (2018). Animals entering the feedlot have progressed further in chronological maturity than younger, preweaned calves and the rate of muscle hypertrophy and rate of satellite cell proliferation has begun to slow (Berg and Butterfield, 1968; White et al., 2010). This supports the trend of the PAX7-positve cells in the current study and accounts for the differences in the data between the calves from the previous study and the growing steers in the current study.
Additionally, the increase in Myf5-positive and dual-positive satellite cells, followed by a decline in density supports the idea that muscle maximum muscle hypertrophy for that state of animal had been achieved. Moss and Leblond (1971) explained the crucial role of the satellite cell in muscle growth. Because the steers in the current study were not implanted, nor fed β -adrenergic agonists, the stimulation for late-stage muscle hypertrophy did not exist (Johnson et al., 1998). Therefore, the activation of myogenic satellite cells decreased.
Muscle fiber distribution (Figure 6) for MHC-IIX had a tendency for a treatment × day interaction (P = 0.10), an effect for day (P = 0.05), and no treatment effect (P = 0.36). The distribution for MHC-IIA did not demonstrate an interaction (P = 0.53), but did result in a day effect (P = 0.02). Although the proportion of MHC-IIA fibers equalized across treatments by day 112, the distribution of this muscle fiber type varied over time. Wang et al. (2018) reported an increase of this intermediately oxidative fiber type as a result of intramuscular vitamin A injection. However, in an in vitro study using retinoic acid, MHC-IIA expression decreased in response to high doses of the vitamin A metabolite (Kim et al., 2018). This may be caused by differences in metabolism by cells in living animals compared with those in cell culture. The distribution for MHC-I did not result in a treatment × day interaction, or have an effect of treatment or day. This somewhat challenged the hypothesis for the current study, but may be explained by the vitamin A status of the steers.
Figure 6.
Effects of vitamin A supplementation on skeletal muscle MHC-I, -IIA, and -IIX distribution in feedlot steers from longissimus biopsies collected on days 0, 28, 56, 84, and 112 of the feeding trial (n = 15). Treatments were 0 IU vitamin A/kg diet DM, 2,200 IU vitamin A/kg diet DM (Rovimix A 1000; DSM Nutritional Products Ltd., Sisseln, SUI), and 11,000 IU vitamin A/kg diet DM. Cross sections of skeletal muscle samples were stained by immunohistochemistry for presence of MHC isoforms. For distribution of fiber type, MHC-I was not different for treatment, day, nor was there a treatment × day interaction. Over time, MHC-IIA was variable (P = 0.02), generally increasing for all treatments. The tendency for a treatment × day interaction for MHC-IIX (P = 0.10) suggests that the pattern of change by day (P = 0.05) was not the same for all treatments.
There were no interactions for treatment × time for any of the MHC cross-sectional areas (P > 0.87). However, the main effects of treatment and time were evaluated for each myosin isoform (Figure 7). Over time, muscle fiber cross-sectional area increased for each MHC (P < 0.01) with a notable increase between days 0 and 56. As animals mature and accumulate protein, muscle hypertrophy begins to manifest (Dayton and White, 2008). For all MHC types, myofiber cross-sectional area was not different across treatments. After reviewing Wellmann et al. (2020), the circulating levels of vitamin A of the 0IU animals were relatively unchanging over time (~100 ng/mL), even throughout the depletion period. Although the 2,200 IU and 11,000 IU cattle did show a gradual increase in sera retinol concentrations over time, these data indicate that the 0 IU group was able to support similar anabolic activity (Figure 8). Although sera retinol levels did reflect the dietary vitamin A inclusions, the steers’ ability to accrue protein was not vitamin A status dependent.
Figure 7.
Effects of vitamin A supplementation on skeletal muscle MHC-I, -IIA, and -IIX cross-sectional area (µm2; SEM = 98.450, 115.737, and 133.122, respectively) in feedlot steers from longissimus biopsies collected on days 0, 28, 56, 84, and 112 of the feeding trial (n = 15). Treatments were 0 IU vitamin A/kg diet DM, 2,200 IU vitamin A/kg diet DM (Rovimix A 1000; DSM Nutritional Products Ltd., Sisseln, SUI), and 11,000 IU vitamin A/kg diet DM. Cross sections of skeletal muscle samples were stained by immunohistochemistry for the presence of MHC isoforms. The figure depicts the main effects of treatment and day.
Figure 8.
Immunohistochemical staining of skeletal muscle for MHC fiber types in feedlot steers from longissimus biopsies collected on days 0, 28, 56, 84, and 112 of the feeding trial (n = 15). Treatments were 0 IU vitamin A/kg diet DM, 2,200 IU vitamin A/kg diet DM (Rovimix A 1000; DSM Nutritional Products Ltd., Sisseln, SUI), and 11,000 IU vitamin A/kg diet DM. Cross sections of skeletal muscle samples were stained by immunohistochemistry for presence of MHC isoforms.
Conclusion
These data indicate that oxidative gene expression may be independent of vitamin A status. Vitamin A status of the steers did not affect expression of genes related to oxidative proteins. Moreover, animals with an inadequate vitamin A status were able to maintain protein deposition in muscle as well as those animals that have adequate vitamin A, when circulating vitamin A does not decrease over time. Another evaluation of these parameters should be completed using supranutritional amounts of vitamin A in animals not previously depleted.
Glossary
Abbreviations
- BW
body weight
- C/EBP
Ccaat-enhancer-binding protein
- DAPI
4′6-diamidino-2-phenylindole
- DM
dry matter
- EEF1A2
eukaryotic elongation factor 1- α 2
- Ig
immunoglobulin
- IHC
immunohistochemical
- IMF
intramuscular fat
- LPL
lipoprotein lipase
- MHC
myosin heavy chain
- MRF
myogenic regulatory factor
- Myf
myogenic factor
- Pax7
paired box 7
- PBS
phosphate-buffered saline
- PGC-1α
peroxisome proliferator-activated receptor γ coactivator-1
- PPAR
peroxisome proliferator-activated receptor
Conflict of Interest Statement
The authors declare no real or perceived conflicts of interest.
Literature Cited
- Amin, R., Mathews S., Camp H., Ding L., and Leff T.. . 2010. Selective activation of PPARγ in skeletal muscle induces endogenous production of adiponectin and protects mice from diet-induced insulin resistance. Am. J. Physiol. -Endocrinol. Metab. 298:E28–E37. doi: 10.1152/ajpendo.00446.2009 [DOI] [PubMed] [Google Scholar]
- Berg, R., and Butterfield R.. . 1968. Growth patterns of bovine muscle, fat and bone. J. Anim. Sci. Vol. 273:611–619. doi: 10.2527/jas1968.273611x [DOI] [Google Scholar]
- Cheek, D., Holt A., Hill D., and Talbert J.. . 1971. Skeletal muscle mass and growth: the concept of the deoxyribonucleic acid unit. Pediatr. Res. 5:312–328. doi: 10.1203/00006450-197107000-00004 [DOI] [Google Scholar]
- Dayton, W. R., and White M. E.. . 2008. Cellular and molecular regulation of muscle growth and development in meat animals. J. Anim. Sci. 86(14 Suppl.):E217–E225. doi: 10.2527/jas.2007-0456 [DOI] [PubMed] [Google Scholar]
- Dunn, J. D., Johnson B. J., Kayser J. P., Waylan A. T., Sissom E. K., and Drouillard J. S.. . 2003. Effects of flax supplementation and a combined trenbolone acetate and estradiol implant on circulating insulin-like growth factor-I and muscle insulin-like growth factor-I messenger RNA levels in beef cattle. J. Anim. Sci. 81:3028–3034. doi: 10.2527/2003.81123028x [DOI] [PubMed] [Google Scholar]
- Gibson, M. C., and Schultz E.. . 1983. Age-related differences in absolute numbers of skeletal muscle satellite cells. Muscle Nerve 6:574–580. doi: 10.1002/mus.880060807 [DOI] [PubMed] [Google Scholar]
- Hergenreder, J. E., Legako J. F., Dinh T. T. N., Spivey K. S., Baggerman J. O., Broadway P. R., Beckett J. L., Branine M. E., and Johnson B. J.. . 2016. Zinc methionine supplementation impacts gene and protein expression in calf-fed holstein steers with minimal impact on feedlot performance. Biol. Trace Elem. Res. 171:315–327. doi: 10.1007/s12011-015-0521-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Johnson, B. J., Halstead N., White M. E., Hathaway M. R., DiCostanzo A., and Dayton W. R.. . 1998. Activation state of muscle satellite cells isolated from steers implanted with a combined trenbolone acetate and estradiol implant. J. Anim. Sci. 76:2779–2786. doi: 10.2527/1998.76112779x [DOI] [PubMed] [Google Scholar]
- Kim, J., Wellmann K. B., Smith Z. K., and Johnson B. J.. . 2018. All-trans retinoic acid increases the expression of oxidative myosin heavy chain through the PPARδ pathway in bovine muscle cells derived from satellite cells. J. Anim. Sci. 96: 2763–2776. doi: 10.1093/jas/sky155 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Le Grand, F., and Rudnicki M. A.. . 2007. Skeletal muscle satellite cells and adult myogenesis. Curr. Opin. Cell Biol. 19:628–633. doi: 10.1016/j.ceb.2007.09.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lefterova, M. I., and Lazar M. A.. . 2009. New developments in adipogenesis. Trends Endocrinol. Metab. 20:107–114. doi: 10.1016/j.tem.2008.11.005 [DOI] [PubMed] [Google Scholar]
- Li, J., Gonzalez J. M., Walker D. K., Hersom M. J., Ealy A. D., and Johnson S. E.. . 2011. Evidence of heterogeneity within bovine satellite cells isolated from young and adult animals. J. Anim. Sci. 89:1751–1757. doi: 10.2527/jas.2010-3568 [DOI] [PubMed] [Google Scholar]
- Lin, J., Wu H., Tarr P. T., Zhang C. Y., Wu Z., Boss O., Michael L. F., Puigserver P., Isotani E., Olson E. N., . et al. 2002. Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres. Nature. 418:797–801. doi: 10.1038/nature00904 [DOI] [PubMed] [Google Scholar]
- Mauro, A. 1961. Satellite cell of skeletal muscle fibers. J. Biophys. Biochem. Cytol. 9:493–495. doi: 10.1083/jcb.9.2.493 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mesires, N. T., and Doumit M. E.. . 2002. Satellite cell proliferation and differentiation during postnatal growth of porcine skeletal muscle. Am. J. Physiol. Cell Physiol. 282:C899–C906. doi: 10.1152/ajpcell.00341.2001 [DOI] [PubMed] [Google Scholar]
- Miller, E. K., Chung K. Y., Hutcheson J. P., Yates D. A., Smith S. B., and Johnson B. J.. . 2012. Zilpaterol hydrochloride alters abundance of β-adrenergic receptors in bovine muscle cells but has little effect on de novo fatty acid biosynthesis in bovine subcutaneous adipose tissue explants. J. Anim. Sci. 90:1317–1327. doi: 10.2527/jas.2011-4589 [DOI] [PubMed] [Google Scholar]
- Moss, F. P., and Leblond C. P.. . 1971. Satellite cells as the source of nuclei in muscles of growing rats. Anat. Rec. 170:421–435. doi: 10.1002/ar.1091700405 [DOI] [PubMed] [Google Scholar]
- National Academies of Sciences, E., and Medicine . 2016. Nutrient requirements of beef cattle. 8th Revised ed. The; Washington, DC: National Academies Press. doi: 10.17226/19014 [DOI] [Google Scholar]
- Park, K. S., Ciaraldi T. P., Abrams-Carter L., Mudaliar S., Nikoulina S. E., and Henry R. R.. . 1997. PPAR-gamma gene expression is elevated in skeletal muscle of obese and type II diabetic subjects. Diabetes 46:1230–1234. doi: 10.2337/diab.46.7.1230 [DOI] [PubMed] [Google Scholar]
- Pette, D., and Staron R. S.. . 2000. Myosin isoforms, muscle fiber types, and transitions. Microsc. Res. Tech. 50:500–509. doi: 10.1002/1097-0029(20000915)50:6<500::AID-JEMT7>3.0.CO;2-7 [DOI] [PubMed] [Google Scholar]
- Pickworth, C., L., S. C., Loerch, and Fluharty F. L.. 2012. Restriction of vitamin A and D in beef cattlefinishing diets on feedlot performance andadipose accretion1. J. Anim. Sci. 90:1866–1878. doi: 10.2527/jas.2010-3590 [DOI] [PubMed] [Google Scholar]
- Punch, V. G., Jones A. E., and Rudnicki M. A.. . 2009. Transcriptional networks that regulate muscle stem cell function. Wiley Interdiscip. Rev. Syst. Biol. Med. 1:128–140. doi: 10.1002/wsbm.11 [DOI] [PubMed] [Google Scholar]
- Schultz, E., and Lipton B. H.. . 1982. Skeletal muscle satellite cells: changes in proliferation potential as a function of age. Mech. Ageing Dev. 20:377–383. doi: 10.1016/0047-6374(82)90105-1 [DOI] [PubMed] [Google Scholar]
- Savell, J., R.Branson,Cross H., Stiffler D., Wise J., Griffin D., and Smith G.. . 1987. National consumer retail beef study: palatability evaluations of beef loin steaks that differed in marbling. J. Food Sci. 52: 517–519. doi: 10.1111/j.1365-2621.1987.tb06664.x [DOI] [Google Scholar]
- Shaw, N., Elholm M., and Noy N.. . 2003. Retinoic acid is a high affinity selective ligand for the peroxisome proliferator-activated receptor Β/Δ. J. Biol. Chem. 278:41589–41592. doi: 10.1074/jbc.C300368200 [DOI] [PubMed] [Google Scholar]
- Symonds, M. 2012. Adipose tissue biology. Springer Science & Business Media. doi: 10.1007/978-1-4614-0965-6 [DOI] [Google Scholar]
- Tapscott, S. J., and Weintraub H.. . 1991. MyoD and the regulation of myogenesis by helix-loop-helix proteins. J. Clin. Invest. 87:1133–1138. doi: 10.1172/JCI115109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang, B., Nie W., Fu X., de Avila J. M., Ma Y., Zhu M. J., Maquivar M., Parish S. M., Busboom J. R., Nelson M. L., . et al. 2018. Neonatal vitamin A injection promotes cattle muscle growth and increases oxidative muscle fibers. J. Anim. Sci. Biotechnol. 9:82. doi: 10.1186/s40104-018-0296-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang, Y., and Rudnicki M.. . 2012. Satellite cells, the engines of muscle repair. Nat. Rev. Mol. Cell Biol. 13:127–133. doi: 10.1038/nrm3265 [DOI] [PubMed] [Google Scholar]
- Wellmann, K., Kim J., Urso P., Smith Z., Johnson B.. . 2020. Evaluation of the dietary vitamin A requirement of finishing steers via systematic depletion and repletion, and its effects on performance and carcass characteristics. J. Anim. Sci. 98. doi: 10.1093/jas/skaa266 [DOI] [PMC free article] [PubMed] [Google Scholar]
- White, R. B., Biérinx A. S., Gnocchi V. F., and Zammit P. S.. . 2010. Dynamics of muscle fibre growth during postnatal mouse development. BMC Dev. Biol. 10:21. doi: 10.1186/1471-213X-10-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zierath, J. R., Ryder J. W., Doebber T., Woods J., Wu M., Ventre J., Li Z., McCrary C., Berger J., Zhang B., . et al. 1998. Role of skeletal muscle in thiazolidinedione insulin sensitizer (PPARgamma agonist) action. Endocrinology 139:5034–5041. doi: 10.1210/endo.139.12.6364 [DOI] [PubMed] [Google Scholar]








