Generation of Functional Organs Using a Cell Competitive Niche in Intra-and Inter-species Rodent Chimeras

SUMMARY

Interspecies organ generation via blastocyst complementation has succeeded in rodents, but not yet in evolutionally more distant species: Early developmental arrest hinders formation of highly chimeric fetuses. We demonstrate that deletion of Insulin-like growth factor 1 receptor (Igf1r) in mouse embryos creates a permissive “cell competitive niche”, in several organs significantly augmenting both mouse intra- and mouse/rat interspecies donor chimerism that continuously increases from embryonic day 11 onward, sometimes even taking over entire organs within intra-species chimeras. Since Igf1r deletion allows evasion of early developmental arrest, inter-species fetuses with high levels of organ chimerism can be generated via blastocyst complementation. This observation should facilitate donor cell contribution to host tissues, resulting in whole-organ generation via blastocyst complementation across wide evolutionary distances.

INTRODUCTION

Generation of functional organs using stem cell technology can solve the critical problem of shortages of organs needed for transplantation. Despite advances in deriving tissue-specific cells (De Luca et al., 2019) and organoids (Takebe and Wells, 2019), reconstituting a whole organ in a dish continues to be challenging. We have used blastocyst complementation in rodents to generate fully functional xenogenic organs from pluripotent stem cells (PSCs) in vivo by exploiting developmental organ niches (Goto et al., 2019; Isotani et al., 2011; Kobayashi et al., 2010; Yamaguchi et al., 2017). Nonetheless, a human organ has not yet been generated within a developing animal via blastocyst complementation. A major reason is that very few human cells engraft and contribute to animal tissues (Wu et al., 2017), leaving not enough cells to complement a developmental niche in interspecies chimeras (Goto et al., 2019). Increasing donor cell contribution might substantially benefit efforts to generate functional human organs for clinical transplantation.

Generating an interspecies embryo with robust levels of chimerism encounters both regional and temporal barriers. Xenogenic cells may contribute unevenly to varying lineages, resulting in regions with low chimerism (Yamaguchi et al., 2018). Blastocyst complementation with more donor cells, however, does not boost overall chimerism: High xenogenic cell contribution at early developmental stages is associated with anomalies or embryonic death (Yamaguchi et al., 2018). As this effect is less pronounced between closely related rodent species than between distantly related ones, high chimerism early in development is thought more likely to be lethal between more evolutionarily diverse species. Thus, lower chimerism is advantageous during early development, while higher chimerism may be needed later to complement an organ niche effectively.

Insulin-like growth factor 1 (Igf1) in pre- and postnatal growth in mammals is a key mediator of growth (Baker et al., 1993; Liu et al., 1993; Lupu et al., 2001). It acts through the Igf1 receptor (Igf1r), which is ubiquitously expressed in tissues, modulating mitogenic, anti-apoptotic, and transformational pathways (Bentov and Werner, 2013). Disruption of Igf1r in mouse embryos induces growth retardation, usually with neonatal death (Baker et al., 1993; Liu et al., 1993). We here demonstrate that deletion of Igf1r in mouse host embryos creates a “cell competitive niche” that substantially increases donor chimerism in both intra- and interspecies rodent chimeras. Of importance is that Igf1r deletion opens this niche in stages of development later than those affected by the early developmental arrest seen in interspecies highly chimeric fetuses. Donor cells that persist until the niche opens can thereafter proliferate within it. Our observations thus may facilitate in vivo organ generation within interspecies chimeras. Access to an amenable host niche may promote the contribution of donor cells during fetal development.

RESULTS

Donor Cells Predominantly Proliferate in Igf1r-null Mouse Embryos Generated Using the CRISPR/Cas9

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (CRISPR/Cas9) and single guide RNA (sgRNA) complex targeting the Igf1r gene locus was electroporated into mouse zygotes to induce out-of-frame mutations that lead to premature termination of transcription. (Figures 1A and S1A). Genomic DNA was extracted from blastocysts for Igf1r locus analysis tracking indels by decomposition (TIDE webtool; Brinkman et al., 2014).

Figure 1. Donor Cells Predominantly Proliferate in Igf1r-null Embryos Generated Using the CRISPR/Cas9 and sgRNA Complex.

(A) Targeting locus of sgRNA1 in mouse Igf1r. (B) Representative images of Igf1r-null (Null) and wild-type (WT) neonates at E18.5. (C) Body weight and length of Igf1r-null (n=10) and wild-type (n=4) at E18.5. Mean ± s.d. Statistical significance was calculated by Mann-Whitney U testing. **P < 0.005, ***P < 0.0005. (D) Experimental flow for generating Igf1r-null and wild-type chimeras. (E) Chimerism, Igf1r or wild-type chimeras (n=6 chimeras per group) in blood and connective tissue (CT) at E11.5 measured by flow cytometry. Mean ± s.d. (F) CT : blood chimerism ratio of Igf1r-null or wild-type chimeras at E10.5 (n=3 Igf1r-null, n=4 wild-type chimeras per group), E11.5 (n=3 Igf1r-null, n=4 wild-type chimeras per group), E12.5 (n=3 Igf1r-null, n=7 wild-type chimeras per group), and E18.5 (n=7 Igf1r-null, n=3 wild-type chimeras per group). Mean ± s.d. Statistical significance was calculated by Mann-Whitney U testing (WT vs. Igf1r-null). *P < 0.05.

As knockout efficiency was higher with sgRNA1 than sgRNA2 (Figure S1B; Table S1), sgRNA1 was used in subsequent experiments. Igf1r-null neonates were smaller than wild-type neonates and died postnatally in breathing difficulties, as reported (Baker et al., 1993; Liu et al., 1993; Powell-Braxton et al., 1993) (Figures 1B, 1C, S1C, and S1D). IGF1R was not detected in skin, heart, or bone of Igf1r-null neonates (Figure S1E).

The behavior of Igf1 in intra-species chimeric embryos is unexplored. We hypothesized that in embryos composed of wild-type and Igf1r-null cells, wild-type cells would predominantly proliferate since only they can receive the Igf1 signal. To generate chimeric embryos, we first derived a mouse embryonic stem cell (mESC) line with constitutive GFP expression and validated its pluripotency by using teratoma- and chimera-formation assays (Figures S2A–S2E). The mESCs were then injected into wild-type and Igf1r-null embryos (Figure 1D). Since Igf1r-null mouse embryos do not manifest growth retardation until after embryonic day (E) 10.5 (Baker et al., 1993; Liu et al., 1993), we first investigated the chimeric embryo at E11.5. Blood and connective tissue (CT) were collected at E11.5 and chimerism was analyzed by flow cytometry (Figure 1E). Average CT chimerism increased by nearly 20% in the Igf1r-null embryos, while blood chimerism was not affected. As expected, statistical analysis of chimeras was impeded by huge variation in systemic chimerism among individual embryos (e.g., wild-type chimerism varied from ~10% to ~90% within a single injection experiment). Since blood chimerism appeared unaffected by knocking out Igf1r, we instead analyzed the ratio of CT : blood chimerism over time. Remarkably, the ratio increased until it was approximately 3x higher at E18.5 only in Igf1r-null fetuses (Figure 1F). In contrast, the CT : blood chimerism ratio was constant in wild-type embryos throughout and in Igf1r-null embryos before E11.5. Analysis of variance (ANOVA) further evaluated the effect of Igf1r knockout with respect to time and CT : blood chimerism. The results indicated that (1) Igf1r knockout resulted in significantly higher CT : blood ratios overall (p=0.001), and (2) the effect of Igf1r knockout was a function of time, increasing with longer embryonic development (p=0.013). Further statistical analysis, using non-parametric testing to accommodate the small sample sizes, demonstrated significance (Figure 1F). These data suggest that 1) wild-type donor cells have a growth advantage over Igf1r-null host cells in the developing embryo, 2) the extent of growth advantage vary from organ to organ, 3) it becomes evident after E10.5, regardless of initial chimerism level.

Increasing Organ and Tissue Specific Chimerism in Igf1r-null Chimeras During Fetal and Neonatal Mouse Development

We next examined extent of donor chimerism in individual tissues of Igf1r-null chimeras. Most mouse organs (lung, liver, heart, brain, intestine, kidney, blood, gonad, and thymus) can be identified by appearance on dissecting microscopy from E11.5 onward. We harvested each of these organs or tissues from both Igf1r-null and wild-type chimeras at E11.5 and E18.5 (neonate) and extracted DNA individually from each. Chimerism was analyzed with the droplet digital PCR (ddPCR) platform (Figure 2A), because it does not require careful single-cell dissociation, which may introduce biases toward specific cell types, and it is unaffected by reporter silencing (Calvo et al., 2020; Hamanaka et al., 2018). The ratio of organ : blood chimerism in Igf1r-null chimeras was significantly higher at E11.5 in 7 of 9 organs / tissues (lung, brain, CT, heart, intestine, thymus, and liver) than in wild-type chimeras and was higher still at E18.5 in almost all organs except the thymus, probably due to the homing of blood cells to the thymus at later developmental stages (Owen and Ritter, 1969) (Figures 2B–2E, S2F–S2J). In addition, at E18.5 gonad : blood chimerism was higher in Igf1r-null chimeras than in wild-type chimeras. The kidney displayed the highest increase in chimerism, with 3- to 10-fold higher levels than that of blood (Table S2). This is consistent with a crucial role for Igf1r in renal development (Rogers et al., 1999; Rogers et al., 1991; Wada et al., 1993). Interestingly, Igf1r-null chimeras were normal in gross appearance and proportions of body parts, indicating that host and donor tissues grew in concert during development (Figure 2F). The increase in chimerism thus was not simply due to unregulated overgrowth of donor cells. These results show that wild-type cells outcompete Igf1r-null cells in developing embryos, though the extent of chimerism varies among organs.

Figure 2. Increased Organ and Tissue Chimerism in Igf1r-null Chimeras from Fetal to Neonatal Stage.

(A) Experimental flow of organ chimerism analysis using the ddPCR platform. (B-E) Comparisons of organ : blood chimerism (kidney, lung, brain) and connective tissue : blood chimerism (CT) in Igf1r-null chimeras (n=3 at E11.5, n=7 at E18.5 chimeras per group) with wild-type chimeras (n=4 at E11.5, n=3 at E18.5 chimeras per group). Statistical significance was calculated by Mann-Whitney U testing (Igf1r-null vs. wild-type). *P < 0.05. (F) GFP expression and macroscopic appearance of an Igf1r-null (right) and wild-type (non-chimera) (left) at E18.5. BF: bright field.

The Cell Competitive Niche Induces Almost Entirely Donor-Derived Organs in Igf1r-null Mouse Chimeras

To analyze the postnatal effect of Igf1r disruption, we investigated chimerism in adult Igf1r-null chimeras. Although Igf1r disruption causes postnatal death in breathing difficulties, Igf1r-null chimeras survived postnatally and grew normally to adulthood (Figure 3A). This indicates that blastocyst-injected wild-type cells can rescue chimeras from the lethal phenotype of Igf1r disruption. We again analyzed chimerism in each organ or tissue and normalized it against chimerism in blood (organ : blood chimerism ratio). Kidney, liver, brain, and lung ratios were significantly higher in Igf1r-null chimeras than in wild-type chimeras (Figures 3B, S3A–S3C). Organ : blood chimerism ratios in the gonads of adult mice did not shift with genotype, in contrast to the increase in Igf1r-null chimerism ratio over wild-type chimerism ratio observed in the neonatal gonad (Figure S3D). In several Igf1r-null mice, absolute chimerism in kidney, brain, and lung approached 100%, not the case in other organs or tissues (Figures 3C, S3E–S3H). Since chimerism was consistently higher in Igf1r-null kidneys than in other Igf1r-null organs, we further investigated the structure and function of these almost entirely donor-derived organs. The donor-derived kidneys expressed GFP throughout (Figure 3D), and were normal on macroscopy and microscopy, without hydronephrosis or fibrosis (Figure 3E). Other highly chimeric organs in the Igf1r-null chimeras were morphologically normal, with unremarkable tissue architecture (Figures S3I and S3J). Renal function was assessed by measuring serum blood urea nitrogen, creatinine, and albumin concentrations. All levels were within normal ranges in both Igf1r-null and wild-type chimeras (Figures 3F, 3G, and S3K). These results indicate that Igf1r-null chimeras have high donor-cell contributions and can develop into healthy adults. Additionally, Igf1r disruption creates a niche that allows donor cells to constitute some organs almost entirely, while maintaining normal structure and function. Immunohistologic techniques were used to identify the extent and distribution of chimerism in the kidneys. Antibodies specific to renal components (nephrin, aquaporin 1, Na⁺/K⁺ ATPase α-1, and calbindin) were used for analysis (Kestila et al., 1998; Nielsen et al., 1993; Rhoten et al., 1985; Sabolic et al., 1999). The kidneys of wild-type chimeras contained a mixture of host and donor cells in all components (Figures 3H, 3I, S3L, and S3M). In contrast, the kidneys of Igf1r-null chimeras were almost entirely composed of GFP-expressing donor cells, including calbindin-expressing collecting ducts (Figures 3H, 3I, S3L, and S3M). Consistent with this result, all components of the lung were also almost entirely derived from GFP-expressing donor cells (Figures S3N and S3O). These results suggest that donor cells can generate and constitute all renal and pulmonary components in the Igf1r-null environment.

Figure 3. Dissection and Characterization of Adult Igf1r-null Chimeras.

(A) Igf1-null chimera aged 3 weeks. *Igf1r-null chimera, C: wild-type (non-chimera), W: wild-type chimera. (B) Kidney : blood chimerism ratio of Igf1r-null (n=4) and wild-type chimeras (n=7). Mean ± s.d. Statistical significance was calculated by Mann-Whitney U testing. *P < 0.05. (C) Median chimerism, kidneys of Igf1r-null chimeras. Statistical significance was calculated by Mann-Whitney U testing. *P < 0.05. (D) Macroscopic appearance and GFP expression in kidneys of Igf1r-null and wild-type chimeras. (E) Microscopic appearance in kidneys of Igf1r-null chimera and wild-type mouse (control). Scale bar: 200 μm. (F-G) Median blood urea nitrogen (BUN) and creatinine (CRE) concentrations in sera of Igf1r-null chimeras (BUN: n=4, CRE: n=3) and wild-type mice (n=3, control). (H and I) GFP expression (green) and immunohistochemical staining (red) of adult kidneys of Igf1r-null chimera (Igf1r-null, n=4), wild-type chimera (Igf1r-WT, n=4), and wild-type mouse (control, n=4) for GFP (green) with antibodies against specific renal components nephrin for podocytes and calbindin for collecting ducts in renal medulla. Nuclei were stained with DAPI (gray). Scale bars: 50 μm (left panel), 25um (right). Arrowheads, co-staining of GFP with specific markers in Igf1r chimera. Dotted lines, enlarged areas presented in panels at right.

Reducing Competition in the Tissue Niche Enhances Donor Cell Contribution in Interspecies Mouse-Rat Chimeras

Having established that the Igf1r-null host provides a niche that enables wild-type cells to proliferate predominantly intra-species, we assessed whether this niche accepted donor cells in an inter-species environment. We injected EGFP-labeled rat induced pluripotent stem cells (iPSCs; (Yamaguchi et al., 2018) into Igf1r-null mouse embryos and obtained interspecies chimeric neonates that expressed EGFP (Figure 4A and 4B). These interspecies chimeras were larger than Igf1r-null mouse neonates (Figure 4C). Rat PSCs contribute less than mouse PSCs to mouse embryos after blastocyst injection; this is ascribed to an interspecies developmental barrier around E10.5 (Yamaguchi et al., 2018). However, overall rat chimerism increased in Igf1r-null chimeras at E18.5, viz., in neonates (Figure 4D). Donor contribution differs across organs/tissues specifically in inter-species, and contributions differ from those seen in intra-species chimeras (Yamaguchi et al., 2018). Thus, for interspecies chimeras, the absolute chimerism observed in each organ was used for subsequent analysis. Rat chimerism in individual organs was significantly higher in the kidney, lung, heart, thymus, and CT (Figures 4E–4I), but not in the brain, gonad, liver and intestine (Figures S4A–S4D). In these organs, Igf1r mediated signaling plays little or no role in organ development. Liver was particularly free from donor cell contribution in both wild-type and Igf1r-null chimeras (Figure S4C). This may suggest a lack of cross-reactivity in the ligand-receptor system required for liver development. Donor chimerism reached almost 70% in lung in rat-mouse chimeras (Figure 4F). In addition, frequency of successful chimeric-fetus generation did not differ between wild-type and Igf1r-null chimeras, suggesting that high chimeric fetuses that were generated using the cell competitive niche were not affected by early developmental arrest (Table S3). These results indicate that wild-type rat cells can multiply to become the dominant population in Igf1r-null inter-species animals despite the interspecies barrier. We infer that Igf1r deletion in host embryos selectively favours wild type donor cells in both intra- and inter-species chimeras.

Figure 4. Dissection and Characterization of Interspecies Igf1r-null Chimera Neonate.

(A) Experimental flow for generating interspecies Igf1r-null chimeras. (B) EGFP expression (rat cells), interspecies rat-mouse Igf1r-null chimera at E18.5. (C) Macroscopic appearance, interspecies rat-mouse Igf1r-null chimera (upper) and Igf1r-null mouse (lower) at E18.5. (D) Whole-body chimerism, interspecies rat-mouse Igf1r-null chimeras (Igf1r-null, n=6) and interspecies rat-mouse wild-type chimeras at E18.5 (WT, n=7 chimeras). Mean ± s.d. Statistical significance was calculated by unpaired two-tailed t-testing. *P < 0.05. (E-I) Chimerism of each organ or tissue (kidney, lung, heart, thymus and CT) in interspecies rat-mouse Igf1r-null chimeras (Igf1r-null, n=6 chimeras per group) or interspecies rat-mouse wild-type chimeras at E18.5 (WT, n=7 chimeras per group). Mean ± s.d. Statistical significance was calculated by unpaired two-tailed t-testing. *P < 0.05, ***P < 0.0005. (J) Schematic representation of the cell competitive niche.

DISCUSSION

Our work demonstrates a proof-of-concept approach for facilitating in vivo organ generation. By opening a competitive cell niche, we could (1) gradually increase donor cell contribution in later stages of development in intra- and inter species chimeric embryos, (2) evade early developmental arrest observed in interspecies chimeras by increasing systemic chimerism at later developmental stages, and (3) generate entire donor-derived organs in intra-species chimeras by supplanting host cells within an organ niche (summarized in Figure 4j).

A barrier prevents a highly chimeric interspecies embryo from developing. This barrier exists in early developmental stages and impedes in vivo organ generation, since donor-cell contribution must meet a certain level for successful blastocyst complementation (Goto et al., 2019; Yamaguchi et al., 2018). In contrast, opening the cell competitive niche allows interspecies donor chimerism to increase gradually from mid- to late-developmental stages, circumventing the problems of early developmental arrest associated with high donor-cell chimerism during embryogenesis. Igf1r-null embryos thus can be used to overcome temporal aspects of the xenogenic developmental barrier.

Variation in chimerism among organs was greater in interspecies chimeras than in intraspecies chimeras. This is common in interspecies environments. To speculate on the role of varying affinities of xenogenic molecules in orthologous signaling pathways is tempting. Indeed, while mouse PSCs can generate kidneys in a rat, it is much more difficult for rat PSCs to generate kidneys in a mouse (Goto et al., 2019; Usui et al., 2012). Opening the cell competitive niche increased donor contribution in almost all organs, including those previously found challenging. This system thus could overcome the inter-species organ / tissue-specific barrier.

While a mouse PSC-derived kidney can be generated in a Sall1-null rat, the regenerated kidney contains rat cells in the collecting ducts, suggesting that to knock out a different gene or several genes may be necessary for fully donor-derived kidney generation (Goto et al., 2019). Injected donor PSCs in an Igf1r-null host fetus by contrast proliferated and gave rise to the entire kidney, including the collecting ducts. We infer that Igf1r plays crucial roles in whole-kidney development in the mouse.

Opening the cell competitive niche also dramatically increases donor chimerism in interspecies chimeras, despite the less fit xenogenic environment such as that experienced by rat PSCs in mouse kidneys (Yamaguchi et al., 2018). Donor chimerism in lungs was the highest, reaching almost 70% in rat-mouse chimeric neonates. If these interspecies Igf1r -null chimeras had survived to adulthood, chimerism might well have been much higher. However, all interspecies Igf1r-null chimeras died perinatally. Those that were liveborn evidenced breathing difficulties that we ascribe to lung problems. To avoid this, we plan an organ-specific knockout of Igf1r that may let the mice grow to adulthood. After birth, the contribution of rat cells should increase further in the target organ. We anticipate that various modulations will permit opening of the competitive cell niche to facilitate whole organ regeneration, even in species more evolutionarily divergent than rats are from mice.

Although several approaches exploit developmental niches (e.g., blastocyst complementation, in utero transplantation) to achieve in vivo organ generation (Ma et al., 2018; Yamanaka et al., 2019), blastocyst complementation has succeeded in generating whole organs from PSCs in vivo only when an empty organ niche has first been created in a developing host animal (Goto et al., 2019; Hamanaka et al., 2018; Kobayashi et al., 2010; Yamaguchi et al., 2017). To open the cell competitive niche differs in that it provides an environment in which donor cells gradually supplant host cells within a developing and growing organ, leading to complete donor derivation. Of relevance is that Igf1 is widely conserved among mammals, including human IGF1 (Rotwein, 2017). Thus, we believe that the strategy that we describe can move forward the generation of human organs in evolutionarily divergent interspecies organ niches.

Our data evince that host-cell lack of Igf1r expression confers selective advantages upon donor cells in most, if not all, organs and tissues. This may result from decreased proliferation or inefficient differentiation of host cells due to absence of Igf1-mediated signaling, which may be organ-specific – but that is not yet established. Patterns of Igf1r expression in organs of the postnatal mouse may assist in evaluating this possibility. In rat-mouse interspecies chimeras, selective advantage is less robust in most organs than in mouse-rat interspecies chimeras. This may indicate lower affinity of mouse Igf1 for rat Igf1r than that of rat Igf1 for mouse Igf1r. Interspecies chimeras promise better understanding of cues and pathways required for organogenesis.

In conclusion, these observations will advance our current understanding of cell-cell interaction in fetal development as well as facilitate interspecies in vivo organ generation. This has direct applications for modeling diseases, exploring developmental biology, and ultimately generating human organs for transplantation.

Limitations of the Study

In addition to common technical caveats in chimera experimentation, such as the effects of cell injection, embryo handling, and embryo transfer, our experiment comprises several aspects that may affect donor cell behavior. These include the potential effects of the number of injected cells and their heterogeneity, although within experiments we injected the same number of cells from the same cell line. Additionally, developmental stages differ slightly with every fetus, even among those in a single gestation. We cannot rule out effects of such differences on donor chimerism. We also cannot rule out the possibility that enhanced donor contribution may not be functionally connected to compromise of cellular competition due to uncharacterized organ-specific loss of IGF1R-mediated signaling.

STAR Methods

Resource Availability

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Hiromitsu Nakauchi (nakauchi@stanford.edu).

Materials Availability

Mouse and rat PSCs are available from the Lead Contact’s laboratory upon request and following the completion of a Material Transfer Agreement.

Data and Code Availability

This study did not generate any code or dataset.

Experimental Model and Subject Details

Animals

C57BL/6-Tg (UBC-GFP) 30Scha/J (RRID:IMSR_JAX:004353), C57BL/6J (RRID:IMSR_JAX:000664), and NSG (NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ, RRID:IMSR_JAX:005557) mice were purchased from Jackson Laboratories (Bar Harbor, ME: 004353, 000664, and 005557). For blastocyst injection experiments, three to seven-week-old CD1 female mice and 10-week-old male mice (RRID:IMSR_CRL:022) were purchased from Charles River Laboratory (Wilmington, MA). Littermates of the same sex were randomly assigned to experimental groups. All mice were housed in specific pathogen-free conditions with free access to food and water. All animal protocols were approved by the Administrative Panel on Laboratory Animal Care at Stanford University.

ESCs / iPSCs: Derivation and culture

Undifferentiated mouse ESCs (a2i/LIF2 line) were maintained in DMEM based-serum medium containing 1000 U/ml LIF (Peprotech, Cranbury, NJ; 300-05), 1.5 µM Src kinase inhibitor CGP77675 (Sigma, St. Louis, MO; SML0314) and 3 μM GSK3 inhibitor CHIR99021 (Tocris, Barton Ln, Abingdon, United Kingdom; 4423) for a2i/LIF medium as described (Mori et al., 2019; Shimizu et al., 2012). Cells from the mESCs line (EB3DR line) were maintained as described (Yamaguchi et al., 2018). Undifferentiated rat iPSCs were maintained in N2B27 medium containing 1 μM MEK inhibitor PD0325901 (Tocris), 3 μM CHIR99021, and 1000 U/ml of rat LIF as described (Yamaguchi et al., 2014). Mouse ESCs (a2i/LIF2 line) were derived from C57BL/6-Tg (UBC-GFP) 30Scha/J mice. Their pluripotency was confirmed by chimera generation assay and by teratoma formation on injection into immunodeficient mice. The rat iPSCs ubiquitously express EGFP under the control of the ubiquitin-C promoter. All PSCs lines used in this study were male lines: We have not seen any sex difference in organ chimerism.

Method Details

Cas9 ribonucleoprotein electroporation

Cas9 ribonucleoproteins were introduced into zygotes of mice as described (Hashimoto et al., 2016; Mizuno et al., 2018). In brief, two-pronuclear zygotes were washed three times with Opti-MEM I medium (Gibco, Waltham, MA). 20–30 zygotes were transferred into 5 μl Opti-MEM I medium containing 100 ng/μl Cas9 protein (IDT, Coralville, IA) and 100 ng/μl sgRNA (Synthego, Redwood City, CA) on LF501PT1–10 electrode (BEX, Tokyo, Japan). Electroporation was performed with Genome Editor (BEX) under the following conditions: 25 V, 3 ms ON, 97 ms OFF, Pd Alt 3 times. The sgRNA targets were: Igf1r sgRNA1, 5’- GAAAACTGCACGGTGATCGA -3’; sgRNA2, 5’- GGCCCCTGCCCCAAAGTCTG -3’.

Flow cytometry analysis

Mouse peripheral blood cells were isolated from retroorbital sinus blood and stained with BV421-anti-CD45 antibody (Biolegend, San Diego, CA; 103134). Fetal blood cells obtained from the liver, aorta-gonad-mesonephros, and yolk sac were stained with BV421-anti-CD45 antibody. Donor chimerism was analyzed by detecting GFP-expressing cells. Analysis and sorting were performed by cytometry using FACS Aria II (BD, Franklin Lakes, NJ).

Digital droplet PCR (ddPCR) for chimerism analysis

Each organ or tissue (lung, liver, heart, brain, intestine, kidney, blood, gonad, thymus, and CT) was harvested from chimeric embryos at E10.5–12.5 and E18.5 and from adult chimeras after which DNA was extracted. Chimerism was determined by counting host and donor alleles with ddPCR as described below. Each reaction was prepared and analyzed with the QX200 ddPCR system (BioRad, Hercules, CA) in accordance with BioRad’s standard recommendations for use with their ddPCR™ Supermix for Probes (No dUTP) unless otherwise stated. All reactions were 20 ul and contained up to 5 ul of extracted genomic DNA. BL6 (donor) versus CD1 (host) chimerism was analyzed using a digital PCR single-nucleotide discrimination assay (Hindson et al., 2011; Suchy et al., 2020). In brief, primers amplified a common region of the tyrosinase gene in CD1 and BL6 mouse (forward, mTyr-F/1, 1.8 uM AATAGGACCTGCCAGTGCTC; reverse, mTyr-R/1, 1.8 uM, TCAAGACTCGCTTCTCTGTACA), that differs by a single nucleotide between CD1 and BL6 mice. Two TaqMan probes with different fluorophores were used to detect either the CD1 mutant albino allele (mTyr-alb-P/1, 0.25 uM, fluorescein amidites (FAM)-cttaGagtttccgcagttgaaaccc-Black Hole Quencher [BHQ]) or the BL6 wild-type allele (mTyr-wt-P/1, 0.25 uM, hexachloro-fluorescein [HEX]-cttaCagtttccgcagttgaaaccc-BHQ) in a single reaction with the above primers. Fifty PCR cycles were run with 30-second melting at 94 °C and 1-minute (min) combined annealing/extension at 64 °C. All reactions contained a total of 50–2000 copies/ul of the tyrosinase gene and at least 10,000 partitions.

For rat chimerism, primers and TaqMan probe were designed to detect a region of P53 that is specific to rat (forward, rP53-F/1, 0.9 uM, GGCAGGACAAAGAAGGTGGA; reverse, rP53-R/1, 0.9 uM, GGGCAGTGCTATGGAAGGAG; Probe, rP53-P/1, 0.25 uM, FAM-CGCCCTTCAGCTTCACCCCA-BHQ). Another set of primers and probe was designed to detect a genomic region identical in rat and mouse (forward, Zeb2-F/5, 0.9 uM, GGATGGGGAATGCAGCTCTT; reverse, Zeb2-R/5.1, 0.9 uM, AGTGCGGCAGAATACAGCA; Probe, 0.25 uM, Zeb2-P/5, HEX-TGATGGGTTGTGAAGGCAGCTGCACCT-BHQ). Both primer/probe sets were multiplexed in a single reaction. 50 PCR cycles were run with 30-second melting at 94 °C and 1-min combined annealing/extension at 60 °C. The ratio of rP53:Zeb2 was used to determine percentages of chimerism. All reactions contained a total of 50–2000 copies/ul of Zeb2 and at least 10,000 partitions. Primers and probes were obtained from Sigma or IDT. Probes were labelled with either the FAM or HEX fluorophore at the 5’ end and with the BHQ quencher at the 3’ end.

Embryo culture and manipulation

Wild-type mouse embryos were prepared according to published protocols (Brownstein, 2003; Mizuno et al., 2018). In brief, zygotes were obtained by oviduct perfusion from superovulated CD1 mice. Zygotes were cultured in KSOM-AA medium (CytoSpring, Mountain View, CA; K0101) for 1–4 hours and two-pronucleus zygotes were collected. Cas9 ribonucleoproteins were transfected by electroporation according to published protocols (Mizuno et al., 2018). After electroporation, zygotes were transferred to KSOM-AA medium and incubated for 3–5 days. For micromanipulation, ESCs or iPSCs were trypsinized and suspended in ESC or iPSC culture medium. A piezo-driven micromanipulator (Prime Tech, Tsuchiura, Japan) was used to drill the zona pellucida and trophectoderm under microscopy and 5–10 ESCs or iPSCs were introduced into blastocyst cavities near the inner cell mass. After blastocyst injection, embryos were cultured for 1–2 hours. Mouse blastocysts were then transferred into uteri of pseudopregnant recipient CD1 female mice (2.5 days post coitum). Table S3 shows results of the blastocyst injections.

Genotyping

Host embryos were genotyped by PCR using crude lysate. Aliquots of lysate were incubated in 20 mM Tris-HCl (pH8.0;, 100 mM NaCl, 5 mM EDTA, 0.1% SDS, 200 μg/mL proteinase K) at 60°C for 5 minutes to 24 hours, followed by 98°C proteinase K heat inactivation for 2 minutes. Genomic PCR was performed with SeqAmp DNA Polymerase (Takara Bio, Kusatsu, Japan) and these primers: mouse Igf1r sgRNA1 and 2, forward 5’- CAACCCTTTGTGACCTCGGA -3’, reverse 5’- AGAGGAAGAAAGCACGGAG -3’.

Teratoma formation

Approximately 1 × 10⁶ mESCs were injected subcutaneously into immunodeficient mice. Four weeks later, the resultant tumor mass was excised. Hematoxylin and eosin – stained histologic sections were evaluated by light microscopy.

Biochemical assays in serum

Serum levels of blood urea nitrogen, creatinine, and albumin were measured with routine techniques by Stanford Diagnostic Clinical Laboratory at Stanford University.

Histological analysis

Tissues were fixed with 4% paraformaldehyde and embedded in paraffin. Paraffin-embedded sections were deparaffinized with xylene and hydrated with graded ethanol. An autoclave was used for antigen retrieval. Sections were stained with hematoxylin and eosin for light microscopy. When immunostaining, each section was incubated with the primary antibody for 1–2 hours and with the secondary antibody for 1 hour, both at room temperature (detailed in Table S4). Following a wash step, sections were mounted with Fluoromount-G™, containing 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Carlsbad, CA; 00-4959-52), and observed under fluorescence microscopy or confocal laser scanning microscopy. Diaminobenzidine development was performed with ImmPRESS Horse anti-Rabbit IgG PLUS Polymer Kit, peroxidase (Vector Laboratories, Burlingame, CA; MP-7801) according to the manufacturer’s instructions.

Quantification and Statistical Analysis

Upon log transformation, organ : blood ratios and % chimerism measurements achieved normal distribution, justifying the use of parametric statistics where indicated. Analysis of variance (ANOVA) was undertaken with CT : blood ratio as the dependent variable, and embryonic day (E10.5, E11.5, E12.5, and E18.5) and Igfr1 genotype (WT and null) as two between-subjects factors. Analysis was performed with SPSS version 19 software. The few embryos with no chimerism (0%) or high blood chimerism (>40%) were excluded from analysis.

When n ≥ 5, unpaired two tailed t-tests were performed, as indicated in the figures, using Prism 7 software. When n < 5, unpaired Mann-Whitney U non-parametric tests were performed, as indicated in the figures, using SPSS version 19 software. Chimerism and organ : blood ratios were log transformed if analyzed with a parametric test. Flow cytometry data was analyzed using FlowJo 10.6.2.

Supplementary Material

1

Table S2: Organ chimerism of Igf1r-null chimeras at E18.5

* Not determined

Table S3: Results of blastocyst injection

^a.ET: Embryo transfer

^b.E: Embryonic day

^c.No.: Number

^d.Frequencies of neonates (%) were determined by dividing the number of neonates by the number of transferred embryos.

^e.Frequencies of knockout offsprings (%) were determined by dividing the number of knockout offsprings by the numbers of neonates.

^f.Frequencies of chimeras (%) were determined by dividing the number of chimeras by the numbers of neonates.

^g.ND: Not determined

KEY RESOURCES TABLE.

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rat anti-mouse CD45 antibody	Biolegend	Cat#103134; RRID:AB_2562559
Chicken anti-GFP antibody	Abcam	Cat#ab13970; RRID:AB_300798
Rabbit anti-rat AQP1 antibody	Millipore	Cat#AB2219; RRID:AB_1163380
mouse anti-rabbit Na+/K+ ATPase alpha-1 antibody	Millipore	Cat#05–369; RRID:AB_309699
Goat anti-mouse Nephrin antibody	R&D	Cat#AF3159; RRID:AB_2155023
Goat anti-mouse Podoplanin antibody	R&D	Cat#AF3244; RRID:AB_2268062
Rabbit anti-mouse N-Terminal Pro-Surfactant Protein-C antibody	Seven Hills Bioreagents	Cat#WRAB-9337; RRID:AB_2335890
Mouse anti-bovine Calbindin-D-28K Antibody	Sigma-Aldrich	Cat#C9848; RRID:AB_476894
Goat anti-rabbit IgG (H+L) Antibody	Thermo Fisher Scientific	Cat#A-11035; RRID:AB_2534093
Donkey anti-goat IgG (H+L) Antibody	Thermo Fisher Scientific	Cat#A-11056; RRID:AB_142628
Goat anti-mouse IgG1 Antibody	Thermo Fisher Scientific	Cat#A-21124; RRID:AB_2535766
Goat anti-chicken IgY (H+L) Antibody	Thermo Fisher Scientific	Cat#A-11039; RRID:AB_2534096
Bacterial and Virus Strains
Biological Samples
Chemicals, Peptides, and Recombinant Proteins
Critical Commercial Assays
Deposited Data
Experimental Models: Cell Lines
Mouse ESCs: EB3DR	Kobayashi et al., 2010	N/A
Mouse ESCs: a2i/LIF2	This paper	N/A
Rat iPSCs: T1–3	Yamaguchi et al., 2014	N/A
Experimental Models: Organisms/Strains
Mouse: C57bL/6J: C57BL/6-Tg(UBC-GFP)30Scha/J	The Jackson Laboratory	RRID:IMSR_JAX:00 4353
Mouse: C57BL/6J	The Jackson Laboratory	RRID:IMSR_JAX:00 0664
Mouse: NSG: NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ	The Jackson Laboratory	RRID:IMSR_JAX:00 5557
Mouse: Crl:CD1(ICR)	Charles River Laboratories	RRID:IMSR_CRL:02 2
Oligonucleotides
Primers for ddPCR	This paper	N/A
Primers for genotyping	This paper	N/A
Probes for ddPCR	This paper	N/A
Recombinant DNA
Software and Algorithms
FlowJo	Tree Star;https://www.flowjo.com	Version 10.6.2
GraphPad Prism	GraphPad Software;https://www.graphpad.com/scientific-software/prism	Version 8
SPSS software	https://www.ibm.com/support/pages/ibmspss-statistics-19-documentation	version 19
Other